Kit and method for detecting rna at room temperature
The CRISPR-Cas12a system enables direct RNA detection at room temperature. By utilizing target RNA to identify amplified components and fluorescence signal amplification components, it solves the problems of complex reverse transcription process and low sensitivity in existing technologies, achieving low background and high sensitivity RNA detection. This kit is suitable for room temperature RNA detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- WUHAN LIPU MEDICAL TECH CO LTD
- Filing Date
- 2022-11-05
- Publication Date
- 2026-06-23
AI Technical Summary
Existing RNA detection methods require a reverse transcription process, which is complex, costly, and has low sensitivity, making it difficult to achieve rapid, low-cost, and highly sensitive detection.
The CRISPR-Cas12a system is used to directly detect RNA at room temperature. It recognizes amplified components and fluorescent signal amplification components through target RNA recognition, including DNA signal recognition strand sequence, DNA auxiliary strand sequence, Cas12a, crRNA, Blocker strand sequence and fluorescent probe sequence, to achieve direct amplification and detection of RNA signal.
It eliminates the need for reverse transcription, enabling low-background, high-sensitivity RNA detection with a detection limit down to the fM level. It is fast, simple, low-cost, and versatile.
Smart Images

Figure CN115820809B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of RNA detection technology, specifically to a kit and method for detecting RNA at room temperature. Background Technology
[0002] RNA in organisms primarily exerts its biological activity in single-stranded form. With the development of genomics, the biological significance of single-stranded RNA has been gradually revealed. Rapid, specific, and highly sensitive detection of single-stranded RNA is of great importance for early disease diagnosis and prognostic assessment. Taking tumors as an example, multiple studies have shown that abnormal expression levels of miRNAs in vivo are closely related to the occurrence and development of various tumors, and the detection of related RNAs has become an important method for early tumor diagnosis and prognostic assessment.
[0003] Currently, RNA detection methods mainly include sequencing, Northern blotting, PCR, microarrays, and fluorescent probes. Sequencing can comprehensively display RNA information within a sample, but it is costly, time-consuming, and requires complex and expensive equipment, hindering widespread adoption. Northern blotting is simple, inexpensive, but time-consuming, has low sensitivity, and poor specificity. Microarrays can perform high-throughput miRNA analysis, but have low sensitivity, high cost, and require further improvement in specificity. PCR requires reverse transcription pretreatment of RNA to convert it to cDNA before analysis. This step involves multiple reactions at different temperatures, increasing detection time and operational complexity. Furthermore, PCR requires strict control of heating and annealing temperatures, necessitates specialized equipment and professionally trained operators, resulting in high operational complexity and relatively high cost.
[0004] In recent years, nucleic acid detection systems based on CRISPR-Cas12a have attracted widespread attention due to their good specificity and sensitivity. When substrate DNA activates the CRISPR-Cas12a system, its trans-cleavage activity can be activated, and the single-stranded DNA fluorescent probe in the system can be cyclically cleaved at room temperature to amplify the signal. However, the detection of RNA using this technology still faces two major bottlenecks: (1) a relatively complex reverse transcription process is required to convert RNA into cDNA; (2) the sensitivity is relatively low. Summary of the Invention
[0005] Therefore, it is necessary to provide a method and kit for detecting RNA at room temperature, which does not require reverse transcription and can achieve RNA signal conversion at room temperature (25℃~40℃, preferably 37℃), thereby improving detection efficiency and sensitivity.
[0006] The present invention adopts the following technical solution:
[0007] This invention provides a kit for detecting RNA at room temperature, comprising a target RNA recognition and amplification component and a fluorescence signal amplification component; the target RNA recognition and amplification component includes: a DNA signal recognition strand sequence and a DNA auxiliary strand sequence that can recognize the target RNA sequence, wherein the DNA auxiliary strand sequence is used to assist in amplifying the DNA signal recognition strand sequence; the fluorescence signal amplification component includes: Cas12a, crRNA, a Blocker strand sequence, and a fluorescent probe sequence.
[0008] The present invention can also provide a room-temperature RNA detection kit in another reagent composition, comprising the following components: 1) a target RNA recognition amplification complex, wherein the target RNA recognition amplification complex is mainly prepared by DNA polymerase reaction of a DNA signal recognition strand sequence that can recognize the target RNA sequence and a DNA auxiliary strand sequence that can assist in amplifying the DNA signal recognition strand sequence; 2) a CRISPR-Cas12a component: a complex containing Cas12a and crRNA; 3) an iCas12a (inactive Cas12a) component: a complex containing crRNA and Blocker and Cas12a; the CRISPR-Cas12a component and the iCas12a component are used to bind the target RNA recognition amplification complex to the amplification product of the target RNA and activate Cas12a, and the iCas12a can be cleaved by the activated Cas12a; 4) a fluorescent probe sequence.
[0009] In some embodiments, the common segment of the DNA signal recognition strand sequence is shown in SEQ ID NO:1.
[0010] In some embodiments, the DNA helper strand sequence is as shown in SEQ ID NO:2; and / or the crRNA sequence is as shown in SEQ ID NO:3; and / or the Blocker strand sequence is as shown in SEQ ID NO:4; and / or the fluorescent probe sequence is: FAM-TTTATT-BHQ.
[0011] In some embodiments, the kit may further include at least one of DNA ligase, DNA polymerase, magnesium sulfate, and buffer solution.
[0012] In some embodiments, the preparation process of the target RNA recognition amplification complex includes: dissolving the DNA signal recognition strand sequence and the DNA auxiliary strand sequence in a buffer containing DNA polymerase, denaturing at 85°C for 3 min, annealing at 55°C for 3 min, and incubating at 37°C.
[0013] In some embodiments, the preparation process of the Cas12a and crRNA complex includes: mixing Cas12a and crRNA in a buffer environment and incubating at 37°C.
[0014] In some embodiments, the preparation process of the iCas12a component includes: mixing crRNA and Blocker chains in an NE Buffer environment and incubating at 37°C to obtain a complex of crRNA and Blocker; then mixing the Cas12a and crRNA complex and iCas12a in a buffer environment and incubating at 37°C.
[0015] This invention also provides a method for detecting RNA at room temperature, comprising the following steps: obtaining the RNA sample to be detected and the components of a kit for detecting RNA at room temperature; placing the RNA sample to be detected and the target RNA recognition amplification complex in a buffer system containing DNA ligase and DNA polymerase, and reacting at 37°C for 15 min to obtain the amplification product; adding CRISPR-Cas12a components, iCas12a components, fluorescent probes, and magnesium sulfate to the amplification product, and adding water to make up the preset volume to form a mixture; reacting the mixture at 37°C for 10-75 min (the differentiation time varies for samples of different concentrations; 1 nM samples can be differentiated from blank tubes in about 10 min; 10 fM samples can be differentiated after 60 min), using an excitation wavelength of 485 nm and an emission wavelength of 520 nm to detect the fluorescence results.
[0016] Compared with the prior art, the beneficial effects of the present invention are:
[0017] The present invention provides a method and kit for room-temperature RNA detection that eliminates the need for reverse transcription and operates under mild reaction conditions. When the detection system lacks target RNA, the target RNA recognition amplification component cannot be effectively activated, thus failing to activate the "dual signal reporter amplification (containing CRISPR-Cas12a component, iCas12a component, and fluorescent probe sequence)" reaction, achieving the advantage of low background. Furthermore, the present invention fully utilizes the CRISPR-Cas12a system to amplify the signal, enabling the system to achieve fM-level detection, thus achieving a balance between low background and high sensitivity.
[0018] The technical concept of the room-temperature RNA detection method and kit of the present invention is to achieve universal detection by adjusting the recognition region of the DNA signal recognition strand sequence that recognizes the target RNA sequence, which has good flexibility. Attached Figure Description
[0019] Figure 1The image shows the detection gel image of step (3) in Example 1. Lane 1 is the DNA marker, lane 2 is the result after standing for 15 minutes without adding the RNA to be tested, and lanes 3 to 6 are the results after adding the RNA to be tested (100pM) for 15, 30, 60 and 120 minutes respectively.
[0020] Figure 2 This is a statistical evaluation chart of the detection limit of the target miRNA in Example 1.
[0021] Figure 3 This is a statistical graph showing the secondary amplification signals of ovarian cancer tissue markers miR-100, miR126, miR150, miR200, and miR1246 under the same concentration conditions using the room-temperature RNA detection method of this invention; where "AMP" refers to the secondary amplification signal module.
[0022] Figure 4 This is a statistical graph showing the rising rate of fluorescence curves for interfering RNA strand testing in Example 6.
[0023] Figure 5 This is a statistical graph showing the rate of increase of the fluorescence curve in Comparative Example 1. Detailed Implementation
[0024] The present invention will be further described in detail below with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention. The following embodiments are only used to illustrate the present invention, and are not intended to limit the scope of the present invention. Based on the specific embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the protection scope of the present invention. In the embodiments of the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art; in the embodiments of the present invention, unless specifically specified, the technical means used are conventional means well known to those skilled in the art.
[0025] The technical concept of this invention is to provide a kit and detection method for detecting RNA at room temperature (25℃~40℃, preferably 37℃).
[0026] The room-temperature RNA detection kit consists of two components: a target RNA recognition and amplification component system and a dual signal amplification (also known as "fluorescence signal amplification") component system. The target RNA recognition and amplification component includes a DNA signal recognition strand sequence and a DNA auxiliary strand sequence, which assist in amplifying the target RNA sequence. The fluorescence signal amplification component includes Cas12a, crRNA, a Blocker strand sequence, and a fluorescent probe sequence. The detection method further amplifies and reports the signal by coupling these two components, achieving highly sensitive RNA detection.
[0027] Specifically, the target RNA recognition amplification component system designed in this invention includes: a target RNA recognition amplification complex, which is mainly prepared by a DNA signal recognition strand sequence capable of recognizing the target RNA sequence and a DNA auxiliary strand sequence capable of assisting in the amplification of the DNA signal recognition strand sequence via a DNA polymerase reaction. The preparation process of the target RNA recognition amplification complex includes: dissolving the DNA signal recognition strand sequence and the DNA auxiliary strand sequence in a buffer containing DNA polymerase, denaturing at 85°C for 3 min, annealing at 55°C for 3 min, and incubating at 37°C.
[0028] The DNA signal recognition strand sequence is used to recognize target RNA sequences, achieving specific recognition through the principle of complementary base pairing. The binding of the two components shortens the distance between the two ends of the signal recognition strand, providing the necessary reaction conditions for subsequent amplification. The signal recognition strand consists of two main parts: a recognition region and a universal region. For different target RNAs, only the recognition region sequence needs to be changed; the universal region sequence does not need to be altered.
[0029] Further design of a universal segment sequence for the DNA signal recognition strand includes: TTTTTTTAT ACA TAT TTATGG GTT TG GCT CTG GGA AAGT AT (SEQ ID NO:1), with the aim of amplifying and generating single-stranded DNA that activates downstream CRISPR-Cas12a with the help of a DNA auxiliary strand. However, an inappropriate signal recognition strand design will lead to system leakage and affect the system's detection performance.
[0030] The DNA auxiliary strand is used as an amplification primer to form a single-stranded DNA that activates CRISPR-Cas12a. The sequence design can be: ATA CTT TCC CAG AGC (SEQ ID NO:2).
[0031] The dual signal amplification component system designed in this invention includes a CRISPR-Cas12a component, an iCas12a component, and a fluorescent probe sequence.
[0032] The CRISPR-Cas12a component contains a complex of Cas12a and crRNA. (Cas12a and crRNA...)
[0033] The preparation process of the complex of UUUG (SEQ ID NO:3) includes: mixing Cas12a and crRNA in a buffer environment and incubating at 37°C. The function of the Cas12a and crRNA complex is: the complex recognizes single-stranded DNA complementary to crRNA, activates the trans-cleavage activity of the CRISPR-Cas12a system, and then cleaves the single-stranded DNA fluorescent probe in the detection system to generate a signal.
[0034] The preparation process of the iCas12a (inactive Cas12a) component includes: mixing crRNA and the Blocker chain (CAAACCCATTATATAAATATGTATAATCTACACTTAGTAGTTTTTA AATTA, SEQ ID NO:4) in a buffer environment and incubating at 37°C to obtain a crRNA-Blocker complex; then mixing the Cas12a and crRNA complex with iCas12a in a buffer environment and incubating at 37°C. The function of the iCas12a component: This component is a pre-blocked CRISPR-Cas12a system. When the single-stranded DNA generated by upstream amplification activates the existing unblocked CRISPR-Cas12a in the system, it can cleave the iCas12a Blocker chain, allowing crRNA to bind to the residual segment of the Blocker chain. It should be noted that the residual DNA segment is the recognition region of crRNA, which can then reactivate iCas12a, enabling it to exert its trans-cleavage activity and form a positive feedback loop amplification signal.
[0035] The fluorescent probe sequence was designed as: FAM-TTTATT-BHQ.
[0036] This invention also provides a method for detecting RNA at room temperature, comprising the following steps: obtaining the RNA sample to be detected and a kit for detecting RNA at room temperature; placing the RNA sample to be detected and the target RNA recognition amplification complex in a buffer system containing DNA ligase and DNA polymerase, and reacting at 37°C for 15 min to obtain the amplification product; then adding CRISPR-Cas12a components, iCas12a components, fluorescent probes, and magnesium sulfate to the amplification product, and adding water to make up the preset volume to form a mixture; reacting the mixture at 37°C for 10-75 min (generally, the total detection time of the microplate reader can be set to 90 min. The detection time for different concentrations of samples and the effect of distinguishing them from the blank is different. For 1 nM samples, they can be distinguished from the blank group after 10 min of detection; for 10 fM samples, they can be distinguished from the blank group after about 50 min of detection), using an excitation wavelength of 485 nm and an emission wavelength of 520 nm to detect the fluorescence results.
[0037] The core advantages of this method for room-temperature RNA detection are: 1) The DNA signal recognition strand does not need to be pre-circulated; 2) After the DNA signal recognition strand binds to the target RNA, the T4 ligase treatment time is shorter than existing methods; 3) Low background, high sensitivity (detection limit can reach the fM level), rapid and simple. In the absence of target RNA, recognition and amplification will not be initiated, no fluorescent signal will be generated, and there is no significant leakage; for low-abundance target RNA, the amplification effect of double amplification can quickly distinguish it from the blank group; 4) Low design cost and versatility. For different target RNAs, only a portion of the recognition strand needs to be modified and optimized, while the remaining segments do not require modification, reducing design costs. Furthermore, the auxiliary DNA strand, fluorescent probe, and crRNA do not need to be changed, reducing the system application cost.
[0038] The following example illustrates the experiment involving miRNA.
[0039] All oligonucleotide chains used in the experimental examples of this invention were synthesized and purified by Shanghai Sangon Biotech using HPLC. Agarose, DNA marker, and DNA loading buffer were purchased from Shanghai Sangon Biotech.
[0040] Lba Cas12a and NEBuffer 2.1 were purchased from New England Biolabs. T4 DNA ligase and Phi 29 DNA polymerase were purchased from BBI Life Sciences.
[0041] Testing instrument: Biotek microplate reader.
[0042] Example 1: Room Temperature Detection of miR-100
[0043] Studies have shown that miR-100 is highly expressed in ovarian cancer tissues and can serve as a biomarker for the diagnosis of ovarian cancer.
[0044] (1) The following sequence is synthesized by commission:
[0045] The sequence of the synthesized target RNA miR-100 (the RNA to be tested) is as follows:
[0046] AA CCCGUAGAUCCGAACUUGUG (SEQ ID NO:5).
[0047] Synthesized DNA signal recognition strand sequence:
[0048] ATCTACGGGTT TTTTTTTATACATATTTATGGGTTTGGCTCTGGGAAAGTAT CACAAGTTCGG (SEQ ID NO:6)
[0049] The crRNA sequence shown in SEQ ID NO:3, the Blocker chain sequence shown in SEQ ID NO:4, and the fluorescent probe sequence (FAM-TTTATT-BHQ) were synthesized.
[0050] (2) Preparation of recognition chain-auxiliary chain complex:
[0051] The DNA signal recognition strand sequence and the DNA auxiliary strand sequence were dissolved in PHI29 DNA polymerase buffer at a concentration ratio of 1:1.5. The mixture was denatured at 85°C for 3 minutes, annealed at 55°C for 3 minutes, and incubated at 37°C for 10 minutes. The specific reaction system is shown in the table below.
[0052]
[0053] (3) Construction of target RNA recognition amplification components:
[0054] The RNA to be tested, the recognition strand-helper strand complex, T4 ligase, and phi29 enzyme were dissolved together in a buffer solution and reacted at 37°C for 15 minutes. The specific reaction system is shown in the table below:
[0055]
[0056] The target RNA recognition amplification components from this step were detected by agarose gel electrophoresis, and the results are shown in [Figure number missing]. Figure 1 From left to right, lane 1 is the DNA marker, lane 2 is the result after standing for 15 minutes without adding the RNA to be tested, and lanes 3 to 6 are the results after reaction times of 15, 30, 60, and 120 minutes, respectively.
[0057] Depend on Figure 1It can be seen that: when the target RNA is absent, effective amplification cannot be generated, ensuring a low background in the detection system; after adding the target RNA, the amplified product can be observed at the top of the lane after 15, 30, 60, and 120 minutes of amplification. Amplification for at least 15 minutes is sufficient to obtain a sufficient amount of product.
[0058] (4) Pre-construction of CRISPR-Cas12a component system:
[0059] Mix Cas12a and crRNA in NEBuffer 2.1 and incubate at 37°C for 30 minutes. See the table below for the specific reaction mixture.
[0060]
[0061] (5) Construction of iCas12a component:
[0062] Preparation of the crRNA-Blocker complex: Dissolve the crRNA and Blocker strands in NEBuffer 2.1 at a 1:2 molar ratio, denature at 85°C for 3 minutes, anneal at 55°C for 3 minutes, incubate at 37°C for 1 hour, and then store at 4°C for later use. See the table below for the specific reaction system:
[0063]
[0064] The crRNA-Blocker complex and Cas12a were mixed in NEBuffer 2.1 and incubated at 7°C for 30 minutes. The specific reaction system is shown in the table below:
[0065]
[0066] (6) Construction and fluorescence detection of the CRISPR-Cas12a cleavage system:
[0067] The pre-constructed target RNA recognition amplification component, CRISPR-Cas12a component, iCas12a component, and fluorescent probe were mixed. The mixture was then analyzed in a microplate reader at 37°C for 90 minutes. The actual discrimination time was 10-50 minutes.
[0068] The specific reaction system is shown in the table below:
[0069]
[0070] The reaction conditions for the fluorescence microplate reader are: 37℃, excitation wavelength 485nm, emission wavelength 520nm, and detection time 90 minutes.
[0071] See the statistics of test results. Figure 2 .Depend on Figure 2It can be seen that there are significant differences in the linear rise rate of the fluorescence curves corresponding to different concentrations. After analyzing the linear rise rate of the fluorescence curves corresponding to different concentrations, it was found that the system can detect target miR-100 at the 10 fM level.
[0072] Example 2
[0073] This embodiment provides a method for detecting miR-126 at room temperature. The experimental materials and process steps are basically the same as in Example 1, with the only difference being:
[0074] The sequence of the target RNA miR-126 is as follows:
[0075] CAUUAUUACUUUUGGUACCGG (SEQ ID NO:7).
[0076] The designed DNA signal recognition strand sequence is as follows:
[0077] AAG TAA TAA TG TTTTTT TAT ACA TAT TTA TGG GTT TG GCT CTG GGA AAGT AT CGC GTA CCA A (SEQ ID NO:8).
[0078] The test results are shown in the table below:
[0079]
[0080] The room temperature detection method in this embodiment has a detection sensitivity of 10 fM for miR-126.
[0081] Example 3
[0082] This embodiment provides a method for detecting miR-150 at room temperature. The experimental materials and process steps are basically the same as in Example 1, with the only difference being:
[0083] The sequence of the target miR-150 is: UCU CCC AAC CCU UGUACCAGUG (SEQ ID NO:9).
[0084] The designed DNA signal recognition strand sequence includes: AGG GTT GGG AGA TTTTTT TAT ACA TAT TTA TGG GTT TG GCT CTG GGA AAGT AT CAC TGG TAC A (SEQ ID NO: 10).
[0085] The test results are shown in the table below:
[0086]
[0087] The room temperature detection method in this embodiment achieves a detection sensitivity of 10 fM for miR-150.
[0088] Example 4
[0089] This embodiment provides a method for detecting miR-200 at room temperature. The experimental materials and process steps are basically the same as in Example 1, with the only difference being:
[0090] The sequence of the target miR-200 is: UAAUACUGCCU GGUAAUGAUGAC (SEQ ID NO:11).
[0091] The designed DNA signal recognition strand sequence includes: AGG CAG TAT TA TTTTTT TAT ACA TAT TTA TGG GTT TG GCT CTG GGA AAGT AT GTC ATC ATT ACC (SEQ ID NO: 12).
[0092] The test results are shown in the table below:
[0093]
[0094] The room temperature detection method in this embodiment achieves a detection sensitivity of 100 fM for miR-2000.
[0095] Example 5
[0096] This embodiment provides a method for detecting miR-1246 at room temperature. The experimental materials and process steps are basically the same as in Example 1, with the only difference being:
[0097] The sequence of target miR-1246 is: AAUGGAUUUU UGGAGCAGG (SEQ ID NO:13).
[0098] The designed DNA signal recognition strand sequence is: AA AAT CCA TTTTTTTT TAT ACA TAT TTA TGG GTT TG GCT CTG GGA AAGT AT CCT GCT CCA (SEQ ID NO:14).
[0099] The test results are shown in the table below:
[0100]
[0101] The room temperature detection method in this embodiment achieves a detection sensitivity of 1 pM for miR-1246.
[0102] In addition, statistical analysis was conducted on the secondary amplification signals of ovarian cancer tissue markers miR-100, miR126, miR150, miR200, and miR1246 under the same concentration conditions. Figure 3It can be seen that the dual signal amplification component system has a good secondary signal amplification effect for different miRNAs and has good versatility.
[0103] Example 6
[0104] This embodiment evaluates the anti-interference ability of the detection system for random, irrelevant RNA. The experimental materials and process steps are basically the same as in Example 1, with the only difference being:
[0105] An interfering RNA strand was used instead of the target RNA in Example 1. The sequence of the interfering RNA strand is as follows:
[0106] GUUUGCGGUGGUGACAGUGA (SEQ ID NO: 15).
[0107] The rising rate of the fluorescence curve during instrument testing is as follows: Figure 4 As shown, the results indicate that the rising rate of the fluorescence curve detected by the instrument was not significantly different from that of the blank group.
[0108] Comparative Example 1
[0109] This comparative example provides an alternative DNA signal recognition strand for the target miR-100, and the detection leakage level of this signal recognition strand was evaluated. The specific operating procedures are the same as in Example 1, except that the signal recognition strand sequence is adjusted to: ATCTACGGGTT TTTTTTGCT CTG GGA AAGT ATTAT ACA TAT TTA TGG GTT TG CACAAGTTCGG (SEQ ID NO:16) is different from the sequence of the common segment of the DNA signal recognition strand in Example 1.
[0110] The fluorescence curve rise rates of the blank group (without target miR-100) test corresponding to the signal recognition chain shown in SEQ ID NO:16 and the corresponding blank group (without target miR-100) test in Example 1 were further evaluated. The results are statistically shown below. Figure 5 As shown, the results indicate that an unreasonable signal recognition chain design will lead to system leakage and affect the system's detection performance.
[0111] It should be noted that the above embodiments are only for further elaboration and explanation of the technical solution of the present invention, and are not intended to further limit the technical solution of the present invention. The method of the present invention is only a preferred embodiment and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A kit for detecting RNA at room temperature, characterized in that, It includes target RNA recognition amplification components and fluorescence signal amplification components; The target RNA recognition amplification component includes: a DNA signal recognition strand sequence and a DNA auxiliary strand sequence that can recognize the target RNA sequence, wherein the DNA auxiliary strand sequence is used to assist in the amplification of the DNA signal recognition strand sequence; The fluorescence signal amplification components include: Cas12a, crRNA, Blocker strand sequence, and fluorescent probe sequence; Include: The target RNA recognition amplification complex is prepared by a DNA polymerase reaction of a DNA signal recognition strand sequence capable of recognizing a target RNA sequence and a DNA auxiliary strand sequence capable of amplifying the DNA signal recognition strand sequence. CRISPR-Cas12a component: a complex containing Cas12a and crRNA; iCas12a components: a complex containing crRNA and Blocker, and Cas12a; and Fluorescent probe sequence; The CRISPR-Cas12a component and the iCas12a component are used to bind to the target RNA, recognize the amplification complex and the amplification product of the target RNA, and activate Cas12a, and the iCas12 can be cleaved by the activated Cas12a. The binding of the DNA signal recognition strand sequence and the target RNA sequence can shorten the distance between the two ends of the signal recognition strand; The signal recognition chain consists of two main parts: a recognition segment and a universal segment. The universal segment of the DNA signal recognition chain sequence is shown in SEQ ID NO:
1. The DNA auxiliary strand is used as an amplification primer to form a single-stranded DNA that activates CRISPR-Cas12a. The role of the Cas12a and crRNA complex: The complex recognizes single-stranded DNA that is complementary to crRNA, activates the trans-cleavage activity of the CRISPR-Cas12a system, and then cleaves the single-stranded DNA fluorescent probe in the detection system to generate a signal. The function of the iCas12a component: This component is a pre-blocked CRISPR-Cas12a system. When the single-stranded DNA generated by upstream amplification activates the original, unblocked CRISPR-Cas12a in the system, it can cleave the iCas12a blocker chain, allowing crRNA to bind to the residual segment of the blocker chain. The residual DNA segment is the recognition region of crRNA, which can then reactivate iCas12a, enabling it to exert the trans-cleavage activity of Cas12a and form a positive feedback loop amplification signal.
2. The kit for detecting RNA at room temperature according to claim 1, characterized in that, The DNA auxiliary strand sequence is shown in SEQ ID NO:2; and / or The sequence of the crRNA is shown in SEQ ID NO:3; and / or The sequence of the Blocker chain is shown in SEQ ID NO:4; and / or The fluorescent probe sequence is: FAM-TTTATT-BHQ.
3. The kit for detecting RNA at room temperature according to claim 1, characterized in that, The kit also includes at least one of DNA ligase, DNA polymerase, magnesium sulfate, and buffer solution.
4. The kit for detecting RNA at room temperature according to claim 1, characterized in that, The preparation process of the target RNA recognition amplification complex includes: dissolving the DNA signal recognition strand sequence and the DNA auxiliary strand sequence in a buffer containing DNA polymerase, denaturing at 85°C for 3 min, annealing at 55°C for 3 min, and then incubating at room temperature.
5. The kit for detecting RNA at room temperature according to claim 1, characterized in that, The preparation process of the Cas12a and crRNA complex includes: mixing Cas12a and crRNA in a buffer environment and incubating at room temperature; and / or The preparation process of the iCas12a component includes: mixing crRNA and Blocker chains in a buffer environment and incubating at room temperature to obtain a complex of crRNA and Blocker; then mixing the Cas12a and crRNA complex and iCas12a in a buffer environment and incubating at room temperature.
6. The kit for detecting RNA at room temperature according to claim 1, characterized in that, The target RNA is a target miRNA.
7. The kit for detecting RNA at room temperature according to claim 6, characterized in that, The target RNA is at least one of miR-100, miR126, miR150, miR200, and miR1246.
8. The kit for detecting RNA at room temperature according to claim 7, characterized in that, When the target RNA is miR-100, the sequence of the target RNA is as shown in SEQ ID NO:5, and the DNA signal recognition strand sequence is as shown in SEQ ID NO:6; When the target RNA is miR-126, the sequence of the target RNA is as shown in SEQ ID NO:7, and the DNA signal recognition strand sequence is as shown in SEQ ID NO:8; When the target RNA is miR-150, the sequence of the target RNA is as shown in SEQ ID NO:9, and the DNA signal recognition strand sequence is as shown in SEQ ID NO:10; When the target RNA is miR-200, the sequence of the target RNA is as shown in SEQ ID NO:11, and the DNA signal recognition strand sequence is as shown in SEQ ID NO:12; When the target RNA is miR-1246, the sequence of the target RNA is as shown in SEQ ID NO:13, and the DNA signal recognition strand sequence is as shown in SEQ ID NO:14.