A method for observing plant living nuclear proteins by Halo-tag labeling and 3D super-resolution imaging

Through Halo-tag labeling and 3D super-resolution imaging technology, the problem of lack of fine observation of target molecules in the nucleus of Arabidopsis thaliana in the prior art was solved, and long-term, multi-angle imaging and quantitative analysis were achieved, and high-resolution single-molecule images were obtained.

CN115825020BActive Publication Date: 2025-07-25BEIJING FORESTRY UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211070807.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-01
Publication Date
2025-07-25
Estimated Expiration
2042-09-01

AI Technical Summary

Technical Problem

The existing technology lacks a method to quickly label target molecules in the nucleus of living cells through Halo-tag technology, especially a method to carefully observe the structure, localization and distribution of proteins in the nucleus with a 3D ultra-high resolution imaging system.

Method used

Halo-tag labeling technology is used, combined with 3D super-resolution imaging system, including obtaining Halo-tag transgenic plants, preparing and culturing plant protoplast cells, incubating and rinsing Halo-tag fluorescent dyes, observation of 3D-SIM super-resolution imaging, and software analysis of image and statistical related parameters to achieve long-term, multi-angle imaging and quantitative analysis of plant living nuclear proteins.

Benefits of technology

Long-term tracking and fine-local observation of target molecules in plant cell nucleus under live conditions was achieved, and a single molecule ultra-high resolution image was obtained, which can truly reflect the structure and distribution characteristics of the molecules. It is simple to operate and has high repetition, and is suitable for a variety of plant species.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115825020B_ABST
    Figure CN115825020B_ABST
Patent Text Reader

Abstract

The present invention provides a method for observing plant living nuclear proteins by Halo-tag labeling and 3D super-resolution imaging, belonging to the technical fields of molecular labeling technology and microscopic imaging technology. The method for observing plant living nuclear proteins provided by the present invention comprises the following steps: Step 1: Obtaining Halo-tag transgenic plants; Step 2: Preparing and culturing plant protoplast cells; Step 3: Incubating and rinsing Halo-tag fluorescent dyes; Step 4: Observing by 3D-SIM super-resolution imaging; Step 5: Analyzing images and statistically calculating relevant parameters by using software. The method of the present invention can specifically label proteins in plant cell nuclei for a long time, greatly improving the anti-quenching and anti-bleaching abilities, and the labeling process is very simple and rapid, enabling long-time tracking and fine localization observation of target molecules in plant cell nuclei.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular marker technology and microscopic imaging technology, and particularly relates to a method for observing nuclear proteins in living plant cells using Halo-tag labeling and 3D super-resolution imaging. Background Technology

[0002] Plant protoplast cells refer to all internal contents after the cell wall has been removed. They retain all the physiological activities of plant cells while eliminating the presence and interference of a thick cell wall. In molecular labeling and optical imaging research, they have advantages similar to animal cells, allowing for rapid reactions, metabolism, and expression, significantly shortening experimental cycles and providing reliable in vivo experimental data. Therefore, they are widely used in plant cell biology research. The novel Halo-tag labeling technology refers to the chemical reaction of covalent binding between Halo-tag proteins and exogenous Halo-tag ligands. It allows researchers to specifically label target molecules through genetic engineering and to add Halo-tag ligands containing different functional groups according to experimental needs. Halo-tag labeling technology overcomes the limitations of traditional molecular labeling, with rapid reactions and simple experiments requiring only the construction of a single vector to achieve multiple experimental purposes. It can also be combined with different super-resolution microscopy imaging systems and other labeling techniques, thus having wide applications in cell biology.

[0003] Previous studies on cell structure and function in vivo have mainly relied on traditional fluorescent protein (GFP / mCherry), organic dyes, or quantum dot labeling methods. However, these labeling methods have drawbacks such as easy drift, broad emission spectra, and poor specificity, which limit their application in the field of live-cell super-resolution imaging. Furthermore, they cannot accurately reflect the structure and distribution characteristics of molecules in the real state, thus hindering in-depth exploration and research on the super-resolution structure and functional mechanisms of single molecules in the cell nucleus.

[0004] Previous reports have used Halo-tag labeling technology to study molecular localization using protoplasts of tobacco and poplar trees. However, this approach has not yet been extended to live-cell super-resolution imaging, nor has it utilized the model plant Arabidopsis thaliana. Furthermore, there is a lack of quantitative analysis of the fine structure and distribution characteristics of target proteins at the single-molecule level. Therefore, current technology lacks a method for rapidly and specifically labeling target molecules within the nucleus of live cells using Halo-tag technology, particularly one that combines 3D super-resolution imaging systems for detailed observation of the structure, localization, and distribution of nuclear proteins. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a method for observing plant live cell nuclear proteins using novel Halo-tag labeling and 3D super-resolution imaging technology, which enables long-term, real-time, multi-angle imaging and quantitative analysis of the localization characteristics, fine structural features and fluorescence intensity distribution of plant live cell nuclear proteins.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides a method for observing plant live cell nuclear proteins using Halo-tag labeling and 3D super-resolution imaging, comprising the following steps: Step 1: Obtaining Halo-tag transgenic plants; Step 2: Preparing and culturing plant protoplast cells; Step 3: Incubation and rinsing with Halo-tag fluorescent dye; Step 4: Observation using 3D-SIM super-resolution imaging; Step 5: Analyzing images and statistically analyzing relevant parameters using software.

[0008] Preferably, step one specifically involves: ligating the Halo-tag gene sequence into the eukaryotic expression vector pCAMBIA2300-target gene carrying the target gene to obtain pCAMBIA2300-target gene-Halotag; infecting plants with pCAMBIA2300-target gene-Halotag to obtain transgenic plants with the Halo-tag tag.

[0009] Preferably, the target gene includes MED18.

[0010] Preferably, the Halo-tag gene sequence is based on pH6HTN. The T7 vector was used as a template and amplified by PCR.

[0011] Preferably, the cultivation of plant protoplast cells in step two specifically involves constant temperature and light-protected culture.

[0012] Preferably, the incubation in step three specifically involves staining with Halo-tagTMR fluorescent dye, mixing thoroughly, and incubating at 28-37°C for 15-60 minutes in the dark.

[0013] Preferably, the rinsing in step three specifically involves: washing with a clean culture medium, followed by incubation in a decolorizing shaker under light-protected conditions, wherein the rotation speed of the decolorizing shaker is 40 rpm-45 rpm.

[0014] Preferably, step four specifically involves: staining the labeled protoplast cell nuclei with DAPI fluorescent dye, washing them, and then using a structured light super-resolution microscope in 3D imaging mode, adjusting the laser intensity to 4-6% and the exposure time to less than 60ms, and selecting dual-channel excitation light of 405nm and 568nm to observe the stained protoplasts.

[0015] Preferably, step five specifically involves: extracting parameter information from the obtained super-resolution image using ImageJ, Imaris, Origin, and Prism 8 software; establishing simulated spots and quantitative analysis of single molecules based on the size of the target molecule; and further demonstrating the specific structural characteristics and distribution features of the target molecule within the nucleus of living cells.

[0016] Preferably, the plants include Arabidopsis thaliana, tobacco, and poplar.

[0017] The beneficial effects of this invention are:

[0018] This invention employs a novel Halo-tag labeling method, which ensures the specificity of genetic markers while maintaining the advantage of organic dyes emitting more photons. Most importantly, the Halo-tag protein and Halo-tag fluorescent ligand undergo a covalent organic reaction, ensuring the stability and irreversibility of the organic dye binding. This invention allows for long-term, specific labeling of proteins in plant cell nuclei, significantly improving resistance to quenching and bleaching. Furthermore, the labeling process is extremely simple and rapid.

[0019] This invention employs a DeltaVision OMX structured light illumination ultra-high resolution microscopic imaging system, which selects 3D imaging mode, records 3 angles and 5 phases, sets an interval of 0.125μm, and captures 1μm thickness of 135 original images. Finally, SIM super-resolution imaging images are reconstructed through different algorithms, thereby realizing long-term tracking and fine-positioning observation of target molecules in plant cell nuclei.

[0020] The labeling and imaging method of this invention was first realized in live cell samples of the model plant Arabidopsis thaliana. It can realistically reflect the distribution and structural characteristics of individual molecules under in vivo conditions and ultimately obtain single-molecule ultra-high resolution images within the plant cell nucleus.

[0021] The method of this invention utilizes four different software programs to process images, simulate data, analyze and fit data, thereby accurately identifying the characteristics of single molecules within the cell nucleus and further quantifying the fine structure and distribution characteristics of the target molecules from multiple different perspectives.

[0022] The method of this invention has high repeatability, is simple to operate, and is widely applicable to different plant species, providing a rapid method for spatiotemporal specific super-resolution imaging studies at the single-molecule level in living organisms. Attached Figure Description

[0023] Figure 1 This is an experimental flowchart of the method of the present invention;

[0024] Figure 2 This invention provides a wide-field fluorescence image of the labeled and imaged protoplast cell nucleus.

[0025] Figure 3 This invention provides dynamic images of protoplast nucleoproteins observed using a 3D super-resolution microscope.

[0026] Figure 4 This is a simulated fluorescence distribution diagram of protoplast nucleoproteins analyzed using Image J and Imaris software in this invention;

[0027] Figure 5 This invention uses Origin and Prism 8 software to generate Gaussian fitting histograms of protoplast nucleoprotein volume, ellipticity, pixel count, and fluorescence intensity.

[0028] Figure 6 and Figure 7 This is the effect of super-resolution confocal Airyscan imaging using the same material labeled with mCherry. Detailed Implementation

[0029] This invention provides a method for observing nuclear proteins in living plant cells, comprising the following steps: Step 1: obtaining Halo-tag transgenic plants; Step 2: preparing and culturing plant protoplast cells; Step 3: incubation and rinsing with Halo-tag fluorescent dye; Step 4: observation using 3D-SIM super-resolution imaging; Step 5: analyzing images and statistically analyzing relevant parameters using software.

[0030] The flowchart of the method for observing nuclear proteins in living plant cells in this invention is as follows: Figure 1 As shown. In this invention, the preferred step of obtaining Halo-tag transgenic plants is as follows: The Halo-tag gene sequence is ligated into the eukaryotic expression vector pCAMBIA1300-target gene carrying the target gene via homologous recombination to obtain pCAMBIA1300-target gene-Halotag; pCAMBIA1300-target gene-Halotag is then introduced into plants to obtain transgenic plants carrying the Halo-tag tag. The preferred Halo-tag gene sequence in this invention is pH6HTN. The T7 vector was used as a template, and the sample was obtained by PCR amplification. The preferred primer sequences used for PCR amplification were: F: GGAGGAGGTACTACATTGTCTAGAGTCGACATGGCAGAAATCGGTACT (SEQ ID NO.1); R: TACCGATGATACGAACGAAAGCTCTGCAGTTAGCCGGAAATCTCGAGCGT (SEQ ID NO.2); the preferred PCR amplification system was: 1 μL template, 1 μL each primer, and 2×Premix Taq. TM 10 μL of ddH2O and 7 μL of ddH2O are used. The preferred PCR amplification reaction program is: annealing temperature set to 55℃ for 30 seconds, for a total of 35 cycles; the remaining steps follow the standard PCR procedure in the art. In this invention, the preferred method for introducing pCAMBIA1300-target gene-Halotag into plants is Agrobacterium infection. This invention does not specifically limit the method of Agrobacterium infection; any conventional Agrobacterium infection method in the art can be used. In this invention, the target gene preferably includes MED18.

[0031] In this invention, when preparing plant protoplast cells, it is preferred to use an enzymatic hydrolysate prepared with cellulase and ionizing enzyme to prepare plant protoplast cells. After obtaining plant protoplast cells, it is preferred to culture them at a constant temperature in the dark. The culture temperature is preferably 27-29℃, more preferably 28℃.

[0032] In this invention, the incubation in step three is preferably performed as follows: staining with Halo-tag TMR fluorescent dye, mixing thoroughly, and incubating at 28-37°C for 15-60 minutes in the dark. In this invention, the preferred incubation temperature after staining with Halo-tag TMR fluorescent dye and mixing is 28°C, and the preferred incubation time is 15 minutes, under which the staining effect is best. This invention does not have a specific limitation on the specific source of the Halo-tag TMR fluorescent dye; any commercially available product in the art can be used. After incubation, the preferred rinsing is performed as follows: washing with clean culture medium, followed by incubation on a decolorizing shaker under dark conditions. The preferred rotation speed of the decolorizing shaker is 40-45 rpm, more preferably 42-43 rpm. In this invention, the number of times the clean culture medium is used for washing is preferably three.

[0033] The preferred step four of this invention involves: staining the labeled protoplast nuclei with DAPI fluorescent dye, washing them, and then observing the stained protoplasts using a structured light super-resolution microscope in 3D imaging mode. The laser intensity is adjusted to 4-6%, the exposure time is below 60ms, and dual-channel excitation light (405nm and 568nm) is selected. This invention does not specifically limit the source of the DAPI fluorescent dye; any commercially available product in the art can be used. In this invention, the preferred super-resolution microscope is the DeltaVision OMX structured light illumination super-resolution microscope.

[0034] The preferred step in this invention is as follows: Extracting parameter information from the obtained super-resolution image using ImageJ, Imaris, Origin, and Prism 8 software; establishing simulated spots and performing quantitative analysis based on the size of the target molecule; and further demonstrating the specific structural characteristics and distribution features of the target molecule within the nucleus of living cells. In this invention, when simulating the fluorescence intensity of the target molecule using ImageJ and Imaris, background signals need to be masked, and the target region needs to be selected for analysis. When performing quantitative analysis using Origin and Prism 8 software, attention needs to be paid to the specific information of the single-molecule structure and distribution.

[0035] The method provided by the present invention can be applied to a variety of plants, preferably including Arabidopsis thaliana, tobacco and poplar.

[0036] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0037] Unless otherwise specified, the following embodiments are all conventional methods.

[0038] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0039] Example 1

[0040] A method for observing nuclear proteins in living plant cells:

[0041] 1) Obtaining Halo-tag transgenic plants: using pH 6HTN Using the T7 vector as a template, the Halo-tag sequence was ligated into the eukaryotic expression vector pCAMBIA1300 carrying the target gene via PCR, double enzyme digestion, and homologous recombination. The final product was then transformed and amplified in *E. coli*, and the correctly sequenced strains (i.e., those containing the Halotag sequence) were preserved. The specific steps are as follows:

[0042] The complete genome sequence was found on TAIR (https: / / www.arabidopsis.org). Specific primers were designed using PrimerPremier5 software for gene sequence analysis: F: GGAGGAGGTACTACATTGTCTAGAGTCGACATGGCAGAAATCGGTACT (SEQ ID NO.1); R: TACCGATGATACGAACGAAAGCTCTGCAGTTAGCCGGAAATCTCGAGCGT (SEQ ID NO.2), and pH6HTN was used. PCR amplification was performed using T7 vector as a template; the PCR amplification system was 20 μL; the PCR amplification enzyme was Premix Taq. TM (RR902Q), purchased from TaKaRa. Two restriction enzyme sites (XbaI and PstI) were selected at the multiple cloning site of the pCAMBIA1300 vector containing the MED18 gene for double digestion. These enzymes were purchased from TaKaRa. The volumes of each component in the reaction system were calculated according to the requirements of the isotopic ligation system. The samples were added to PCR tubes, mixed, centrifuged to the bottom of the tube, and placed in a PCR instrument at 50°C for 30 min to obtain the recombinant plasmid pCAMBIA1300-MED18-Halotag. The ligation step above used the EasyGeno Rapid Recombinant Kit (VI201), purchased from Beijing Tiangen Biotech Co., Ltd.

[0043] After transforming the successfully constructed vector into Agrobacterium, the GV3101 Agrobacterium strain was used to infect wild-type Arabidopsis thaliana in the flowering stage using a sucrose-silwet L-77 mixture (10 μL added to 50 mL of system). The harvested mature seeds were cultured in hygromycin 1 / 2 MS solid culture plates (1.1075 g of MS (Murashige and Skoog Basal Salts) (Sigma-Aldrich) and 5 g of sucrose were dissolved in 500 mL of ddH2O, the pH was adjusted to approximately 5.9, and then 5 g of agar 1.034 × 10⁻⁶ was added). 5 Sterilize at 120℃ for 20 minutes using high pressure. After the culture medium cools to room temperature, add 80 μL of Hygromycin (50 mg / mL) to 500 mL of the system. The positive seedlings selected on the culture medium are the T1 generation transgenic plants.

[0044] The specific method for transforming Agrobacterium with the above vector is as follows: Agrobacterium chemical transformation was performed using GV3101 competent cells (AC1001), purchased from Shanghai Weidi Biotechnology Co., Ltd.; 300 ng of plasmid DNA was added to every 50 μL of Agrobacterium competent cells, mixed well, and then placed on ice for about 30 min, flash-frozen in liquid nitrogen for 5 min, and then placed in a water bath at 37°C for 5 min; 700 μL of antibiotic-free YEB liquid was added, and the mixture was placed in a shaker at 28°C and 180 rpm for 3–5 h; the bacterial cells were precipitated, and about 100 μL of supernatant was collected, the bacterial cells were resuspended, and the bacterial solution was spread on LB plates containing antibiotics and placed in an incubator at 28°C. After inverted incubation for 72 h, the cells were observed.

[0045] 2) Preparation and culture of protoplasts: Transgenic Arabidopsis thaliana leaves, grown for approximately 3 weeks without bolting under 23℃, 16h light / 8h dark conditions, were used as material. The petioles and leaf tips were removed using a Gillette double-edged blade, and the leaves were cut into thin strips approximately 0.1mm wide. These strips were placed in 10mL of a mixed enzymatic hydrolysis solution containing cellulase and cleavage enzyme (0.15g cellulase and 0.03g cleavage enzyme). The mixture was incubated for approximately 3 hours at room temperature in the dark on an Orbital Shaker TS-1 for protoplast digestion and extraction. The protoplasts, after microscopic examination, were analyzed using two W5 assays. The protoplasts were washed and resuspended in a solution to thoroughly remove any incompletely dissolved leaf debris and broken protoplasts. The centrifugation process was carried out using a refrigerated centrifuge imported from Eppendorf, Germany, with 100g centrifuged for 2 minutes at a speed of 3. After two washing and resuspension processes, cells with good activity were obtained. Subsequently, the protoplasts were cultured in a 28°C incubator in the dark (a constant temperature incubator from Shanghai Hengke Company).

[0046] 3) Incubation and rinsing of Halo-tag fluorescent dye: Using Promega's Halo-tag TMR fluorescent dye, all used W5 solution was preheated in a 28°C incubator. First, a preheated Halo-tag ligand dilution solution was prepared (1 μl Halo-tag TMR ligand + 200 μl W5 solution). Then, 200 μl of the diluted Halo-tag TMR ligand was added to 800 μl of protoplast solution, gently mixed, and incubated in a 28°C incubator in the dark for 15 min. 1 ml of Halo-tag ligand dilution solution was aspirated, and 2 ml of preheated W5 was added. The mixture was washed three times in a decolorizing shaker for 5 min each time. Then, 1 ml of preheated W5 was added, gently mixed, and the mixture was incubated at 28°C in the dark for 30 min to thoroughly wash away unbound ligands.

[0047] 4) 3D-SIM Super-Resolution Imaging Observation: DAPI Staining of Cell Nuclei: Solarbio's 10 μg / ml ready-to-use DAPI fluorescent dye working solution was used to stain the labeled protoplasts at room temperature in the dark for 10 min. After washing, 10 μL of the solution was placed on a circular slide and adapter, allowed to settle for 5 minutes, and then imaged. Observation was performed using the 3D mode of the DeltaVision OMX structured illumination super-resolution microscopy system. An immersion oil with a refractive index of 1.518 was selected, and samples were excited using both 405 nm and 568 nm lasers, with an exposure time of 50 ms and a laser intensity of 5%. Using the 3D-SIM mode, an interval of 0.125 μm was set, and images were taken at a thickness of 1 μm to capture super-resolution images of the labeled, intact protoplasts. Finally, all raw images were reconstructed and processed using a super-resolution algorithm. The images were first processed using OMX SI Reconstruction, with the Skip k0 angle refinement search and Discardnegative intensities options selected. The second step was OMX Align. Image processing is performed, with the Align Image option selected. The third step involves Deconvolution processing, with the Number of Cycles set to 8. The final processed super-resolution image is then obtained. The results are as follows: Figure 2 and Figure 3 As shown.

[0048] 5) Image analysis and parameter calculation using software: First, using the PlotProfile option of Analyze in ImageJ software, the fluorescence intensity distribution of fluorescent spots in any drawn area of ​​the cell nucleus was analyzed; simultaneously, using the Surface Plot option of Interactive3D in Plugins of ImageJ software, a 3D pseudo-color fluorescence intensity distribution map of the entire cell nucleus was obtained; second, Surfaces analysis was performed on the super-resolution image using Imaris software, setting SurfacesDetail to 0.159 μm, and adjusting the Threshold value to finally determine whether the newly established simulated Surfaces region covered the target molecule. The results are as follows. Figure 4 As shown, all parameters were exported for subsequent analysis; the Animation function of Imaris software was used to obtain a 3D GIF image; finally, Origin software was used for fitting analysis of relevant parameters to obtain the final statistical graph, and Prism 8 software was used to display the distribution of fluorescence intensity as a line graph. The results are shown in the figure. Figure 5 As shown, the image is finally named and saved.

[0049] Figure 6 and 7 The results of super-resolution confocal Airyscan imaging using mCherry-labeled materials (see the literature "Split-HaloTag imaging assay for sophisticated microscopy of protein–protein interactions in planta" for details) are clearly insufficient in resolution, failing to clearly visualize individual molecules within the cell nucleus. Furthermore, the insufficient brightness of the mCherry fluorescent protein leads to poor imaging contrast and makes it particularly prone to quenching, preventing prolonged imaging and re-imaging. This is significantly different from the results achieved in this invention using Halo-tag labeling and 3D super-resolution imaging.

[0050] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for observing plant living nuclear proteins by Halo-tag labeling and 3D super-resolution imaging, characterized in that, The method comprises the following steps: step 1: obtaining Halo-tag transgenic plants; step 2: preparing and culturing plant protoplast cells; step 3: incubating and rinsing Halo-tag fluorescent dyes; step 4: 3D-SIM super-resolution imaging observation; step 5: using software to analyze images and statistically analyze relevant parameters; The step 1 specifically comprises: connecting the Halo-tag gene sequence to the eukaryotic expression vector pCAMBIA2300-target gene carrying the target gene to obtain pCAMBIA2300-target gene-Halotag, and infecting the pCAMBIA2300-target gene-Halotag into plants to obtain transgenic plants carrying the Halo-tag label; The incubation in step 3 is specifically as follows: staining with Halo-tag TMR fluorescent dye, mixing, and incubating at 28° C.-37° C. for 15 min-60 min in a dark environment; The rinsing in step 3 is specifically as follows: after washing with a clean culture medium, incubating with a decolorizing shaker under light-proof conditions, the rotation speed of the decolorizing shaker is 40rpm-45rpm; The step 4 is specifically as follows: staining the labeled protoplast nucleus with DAPI fluorescent dye, washing, using a structured light super-resolution microscope, using a 3D imaging mode, adjusting the laser intensity to 4-6%, the exposure time to less than 60ms, and selecting 405 and 568nm dual-channel excitation light to observe the stained protoplasts.

2. The method according to claim 1, wherein The target gene includes MED18.

3. The method according to claim 1, characterized in that, The Halo-tag gene sequence is based on the pH6HTN T7 vector as a template and obtained by PCR amplification.

4. The method according to claim 1, wherein The culturing of plant protoplast cells in step 2 specifically comprises: culturing at a constant temperature and in the dark.

5. The method according to claim 1, wherein The step five is specifically as follows: for the obtained super-resolution images, ImageJ, Imaris, Origin and Prism 8 software are used to extract the obtained parameter information, and single-molecule simulation spots and quantitative analysis are established according to the size of the target molecules to further display the specific structural characteristics and distribution characteristic information of the target molecules in the nucleus of living cells.

6. The method according to any one of claims 1-5, characterized in that, The plants include Arabidopsis thaliana, tobacco and poplar.