Strain for one-step production of 2-pyrrolidone and its application
By genetically modifying Corynebacterium glutamate, an engineering strain that efficiently produces 2-pyrrolidone was constructed, which solved the problems of low yield and complex process in the existing technology, and achieved efficient fermentation and production of 2-pyrrolidone.
Patent Information
- Application Number
- CN202211544984.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-02
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2042-12-02
Smart Images

Figure CN115851566B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to strains for one-step production of 2-pyrrolidone and their applications, belonging to the field of genetic engineering technology. Background Technology
[0002] 2-Pyrrolidone (2P), also known as 2-oxopyrrolidone or γ-butyrolactam, is a class of pyrrolidine compounds with a five-membered lactam ring. It is widely found in natural products and various synthetic compounds. 2-Pyrrolidone is a raw material for the production of polyvinylpyrrolidone, nylon-4, and Cerebrolysin (amide-pyrrolidone), and has wide and important applications in the pharmaceutical and industrial fields.
[0003] 2-Pyrrolidone can be synthesized by chemical or biological methods. Chemical synthesis typically involves the amination of γ-butyrolactone. Using butanediol as a starting material, γ-butyrolactone is generated at 200°C in the presence of a copper catalyst, and then reacted with ammonia (or amine) to produce 2-pyrrolidone. Another chemical synthesis method involves dehydration of 4-hydroxybutyramide under high pressure and high temperature.
[0004] In recent years, some domestic and international literature has reported on the production of 2-pyrrolidone using microorganisms. However, it still suffers from drawbacks such as the use of fermentation strains that are not intended for food safety, relatively low yields, complex fermentation processes, and high costs, making commercial application difficult. Furthermore, systematic metabolic engineering of engineered strains is lacking. Summary of the Invention
[0005] This invention provides an engineered strain of Corynebacterium glutamicum, which is based on Corynebacterium glutamicum FF10 and has undergone at least one of the following improvements:
[0006] (1) Knock out pyruvate dehydrogenase poxB and increase the expression of aconitine hydratase;
[0007] (2) Knock out phosphoacetyltransferase and enhance the expression of 6-phosphofructokinase;
[0008] (3) Knock out transcription regulators iolR and / or sugR and overexpress glutamate decarboxylase;
[0009] (4) Knock out succinate semialdehyde dehydrogenase 3GabD3 and overexpress inositol transport protein;
[0010] (5) Reduce the expression of glutamate transporter.
[0011] In one embodiment, the pyruvate dehydrogenase poxB has the amino acid sequence shown in Genbank accession number CAF21272.1.
[0012] In one embodiment, the aconitine hydratase has the amino acid sequence shown in Genbank accession number BAB98933.1.
[0013] In one embodiment, the phosphoacetyltransferase has the amino acid sequence shown in Genbank accession number CAF20775.1.
[0014] In one embodiment, the 6-phosphofructokinase has the amino acid sequence shown in Genbank accession number BAB98643.1.
[0015] In one embodiment, the transcriptional regulator iolR has the amino acid sequence shown in Genbank accession number ASW12947.1.
[0016] In one embodiment, the transcriptional regulator sugR has the amino acid sequence shown in Genbank accession number ASW14321.1.
[0017] In one embodiment, the glutamate decarboxylase is glutamate decarboxylase GAD MUT128, which is a glutamate decarboxylase with the D38N / I89V / D92N / / E93Q / S153T / D202N / P268T / E294R / D301N / F355Y / D432N / H435Q / L451* mutation, and its amino acid sequence is shown in SEQ ID NO.1, which has been disclosed in the patent with publication number CN114752589B.
[0018] In one embodiment, the succinate semialdehyde dehydrogenase 3GabD3 has the amino acid sequence shown in Genbank accession number CAF18619.1.
[0019] In one embodiment, the inositol transporter iolT1 has the amino acid sequence shown in Genbank accession number CAF18749.1.
[0020] In one embodiment, the glutamate transporter msccg has the amino acid sequence shown in Genbank accession number CAF19973.1.
[0021] In one embodiment, the engineered Corynebacterium glutamicum also expresses coenzyme A transferase; the coenzyme A transferase has the amino acid sequence shown in GenBank accession number MCQ5130945.1.
[0022] In one embodiment, the engineered Corynebacterium glutamicum expresses coenzyme A transferase using the plasmid pCES.
[0023] In one embodiment, the Corynebacterium glutamicum FF10 is disclosed in patent publication number CN114752544B.
[0024] The present invention also provides the use of the engineered strain of Corynebacterium glutamicum in the production of γ-aminobutyric acid and / or 2-pyrrolidone.
[0025] In one embodiment, the application involves fermenting the engineered Corynebacterium glutamicum using monosaccharides, polysaccharides, or mixtures thereof available to Corynebacterium glutamicum as carbon sources at pH 7.0±0.2 to produce 2-pyrrolidone.
[0026] In one embodiment, the carbon source includes, but is not limited to, one or more of glucose, fructose, sucrose, and molasses.
[0027] In one embodiment, the application involves culturing the engineered bacteria overnight in a seed culture medium, then transferring it to a fermentation culture medium and fermenting it at 28–30°C for a period of time.
[0028] In one embodiment, the fermentation is carried out at 28–30°C and 150–250 rpm for at least 48 hours.
[0029] In this embodiment, the seed culture medium is BHIS medium.
[0030] In one embodiment, the seed culture is obtained by culturing the engineered bacteria in BHIS medium at 28–30°C for 12 hours.
[0031] In one embodiment, the seed liquid is inoculated into the fermentation medium at an inoculation rate of 5-10%.
[0032] In one embodiment, the fermentation medium contains: glucose, (NH4)2SO4, urea, KH2PO4, K2HPO4, MgSO4·7H2O, CaCl2·2H2O, MOPS, biotin, and trace elements.
[0033] In one embodiment, the fermentation medium contains: glucose 50 g / L, (NH4)2SO4 20 g / L, urea 5 g / L, KH2PO4 1 g / L, K2HPO4 1 g / L, MgSO4·7H2O 0.25 g / L, CaCl2·2H2O 13.3 mg / L, MOPS 42 g / L, biotin 0.2 mg / L, and trace element solution 1 ml / L; the trace element solution contains: FeSO4·7H2O 10 g / L, MnSO4·1H2O 10 g / L, ZnSO4·7H2O 1 g / L, CuSO4·5H2O 313 mg / L, and NiCl·6H2O 20 mg / L.
[0034] The present invention also claims protection for the use of the engineered bacteria in the production of 2-pyrrolidone or its derivatives.
[0035] In one embodiment, the derivative includes, but is not limited to, γ-aminobutyric acid or N-methylpyrrolidone.
[0036] Beneficial effects:
[0037] (1) This invention constructs a Corynebacterium glutamicum engineered strain with increased γ-aminobutyric acid production by knocking out the metabolic pathway and some branch pathways of the precursor γ-aminobutyric acid and enhancing the expression of some key genes in the synthesis pathway. As a chassis cell for 2-pyrrolidone synthesis, the γ-aminobutyric acid production of the engineered strain is the highest value of shake flask production reported to date.
[0038] (2) In this invention, CoA transferase derived from Butyricicoccus faecihominis is expressed in Corynebacterium glutamicum, enabling the constructed strain to ferment 2-pyrrolidone using glucose and other carbon sources at pH 7.0. The yield can reach 10.31 g / L after 96 h of fermentation. Attached Figure Description
[0039] Figure 1 This study investigates the synthetic pathway of 2-pyrrolidone and the genes involved.
[0040] Figure 2 Results of producing γ-aminobutyric acid by engineered strains.
[0041] Figure 3 This is a liquid phase detection image of 2-pyrrolidone.
[0042] Figure 4 Shake-flask fermentation curves of 2-pyrrolidone from different host strains expressing pCES-GAD MUT128. Detailed Implementation
[0043] Technical terms:
[0044] Expression: The term “expression” includes any step involving the production of an enzyme or protein, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0045] Expression vector: The term "expression vector" refers to a straight or circular DNA molecule containing a polynucleotide encoding the glutamate decarboxylase mutant of the present invention and operatively linked to a control sequence provided for its expression.
[0046] Host cell: The term "host cell" refers to any cell type that is readily transformed, transfected, transduced, etc., using nucleic acid constructs or expression vectors containing the polynucleotides of the present invention. The term "host cell" also encompasses any parental cell progeny that is not entirely identical to the parental cell due to mutations that occur during replication.
[0047] Fermentation broth: "Fermentation broth" refers to a preparation produced by cell fermentation that is either unrecovered or recovered and / or purified. For example, fermentation broth is produced when a microbial culture is incubated to saturation under carbon-limited conditions that allow protein synthesis (e.g., enzyme expression by the host cell) and the secretion of proteins into the cell culture medium. The fermentation broth may contain the contents of the fermentation material obtained at the end of fermentation. For example, the fermentation broth may contain culture medium components utilized by the microorganisms and cell debris remaining after the removal of microbial cells (e.g., filamentous fungal cells) by centrifugation.
[0048] Culture medium:
[0049] CGXII medium: glucose 50 g / L, (NH4)2SO4 20 g / L, urea 5 g / L, KH2PO4 1 g / L, K2HPO4 1 g / L, MgSO4·7H2O 0.25 g / L, CaCl2·2H2O 13.3 mg / L, MOPS 42 g / L, biotin 0.2 mg / L, trace element solution 1 mL / L, pH adjusted to 7.0 with KOH; wherein, the trace element solution: FeSO4·7H2O 10 g / L, MnSO4·1H2O 10 g / L, ZnSO4·7H2O 1 g / L, CuSO4·5H2O 313 mg / L, NiCl·6H2O 20 mg / L.
[0050] Detection method:
[0051] 2-Pyrrolidone yield was determined by liquid chromatography: an Agilent HPLC 1290 system equipped with a photodiode array detector; an InfinityLab Poroshell 120EC C18 column (2.7 μm, 4.6 × 100 mm, Agilent); the mobile phase was a mixture of 95% water and acetonitrile (containing 0.1% formic acid) and methanol (90:10) eluted isocratically for 5 min; the flow rate was 0.3 mL / min; the detection wavelength was 210 nm; the column temperature was 30 °C; and the injection volume was 1 μL.
[0052] Example 1: Construction of chassis cells from an engineered strain of Corynebacterium glutamicum that produces high levels of 2-pyrrolidone
[0053] Figure 1To synthesize 2-pyrrolidone, the metabolic pathway and some branch pathways of the precursor GABA were knocked out, and the expression of some key genes in the synthetic pathway was enhanced, thus constructing a Corynebacterium glutamicum capable of synthesizing 2-pyrrolidone. Details are as follows:
[0054] 1) Constructing the recombinant plasmid pK18-ΔpoxB::acn to knock out pyruvate dehydrogenase poxB and simultaneously increase the expression of aconitine hydratase (acn): Using the genome of Corynebacterium glutamicum FF10 (disclosed in patent publication number CN114752544B) as a template, clone the homologous arms upstream and downstream of the poxB gene (Genbank accession number CAF21272.1), clone the coding gene of aconitine hydratase (Genbank accession number BAB98933.1) containing the promoter, construct it between the upstream and downstream homologous arms of the poxB gene, and link it to the Pk18mobsacB backbone using the Gibson method to construct the recombinant plasmid pK18-ΔpoxB::acn. Transform the obtained recombinant plasmid pK18-ΔpoxB::acn into competent Corynebacterium glutamicum FF10 cells to obtain the recombinant strain FF10 / ΔpoxB::acn, named FF11.
[0055] 2) Following the same strategy as in step 1), construct the recombinant plasmid pK18-Δpta::pfka, which knocks out phosphorylated acetyltransferase (Genbank accession number: CAF20775.1) and enhances the expression of 6-phosphofructokinase pfka (Genbank accession number: BAB98643.1). Transform the constructed recombinant plasmid pK18-Δpta::pfka into the FF11 competent cells constructed in step 1) to obtain the strain FF11 / Δpta::pfka, named FF12.
[0056] 3) Construct a recombinant plasmid pK18-ΔiolR::GADmut that knocks out the transcriptional regulator iolR (Genbank accession number ASW12947.1) and overexpresses the GAD MUT 128 mutant gene (sequence disclosed in patent publication number CN114752589B) to enhance γ-aminobutyric acid synthesis. Transform the constructed recombinant plasmid pK18-ΔiolR::GADmut into the FF12 competent cells constructed in step 2) to obtain the recombinant strain FF12 / ΔiolR::GADmut, named FF13.
[0057] 4) Following the same strategy described above, a recombinant plasmid pK18-ΔsugR::GADmut was constructed to knock out the transcriptional regulator sugR (Genbank accession number ASW14321.1) and overexpress the GAD MUT 128 mutant gene to enhance the synthesis of γ-aminobutyric acid. The constructed recombinant plasmid pK18-ΔiolR::GADmut was transformed into FF13 competent cells to obtain the recombinant strain FF13 / ΔsugR::GADmut, named FF14.
[0058] 5) Construct a recombinant plasmid pK18-ΔGabD3::iolT1 that knocks out succinate semialdehyde dehydrogenase 3GabD3 (Genbank accession number CAF18619.1) and overexpresses the inositol transporter iolT1 gene, following the same strategy described above. Transform the constructed recombinant plasmid pK18-ΔGabD3::iolT1 into the competent cells of FF14 constructed in step 4) to obtain the recombinant strain FF14 / ΔGabD3::iolT1, named FF17.
[0059] 6) Construct the weakened glutamate transporter msccg (Genbank accession number CAF19973.1) using the same strategy described above. Replace the original RBS:TTCAGCGCTAATCTTGGCTC (SEQ ID NO.2) with the weak RBS sequence CTCACCCACGAGTTCAATAACTAGG (SEQ ID NO.3). Transform the constructed recombinant plasmid pK18-ΔRBSmsccg::wRBS into the competent cells of FF17 constructed in step 5) to obtain the recombinant strain FF17 / ΔRBSmsccg::wRBS, named FF18.
[0060] Example 2: Fermentation production of γ-aminobutyric acid by engineered strains of Corynebacterium glutamicum
[0061] The expression vector pCES-GAD MUT128, carrying the coding sequence of the mutant GAD MUT128 as disclosed in patent CN114752589B, was transformed into the *Corynebacterium glutamicum* engineered strain in Example 1 for one-step production of γ-aminobutyric acid (GABA) from glucose fermentation. The FF10 pCES-GAD MUT128 strain was used as a control. Strains FF10 pCES-GAD MUT128 to FF18 pCES-GAD MUT128 were cultured in BHIS medium at 30°C for 12 hours to obtain seed culture. This seed culture was then transferred to CGXII medium at a 10% inoculum rate and fermented at 30°C, pH 7.0±0.2 for 60 hours. The results are as follows: Figure 2With each generation of improvements, the yield of γ-aminobutyric acid (GABA) has gradually increased. The final shake-flask yield of FF18 pCES-GAD MUT128 GABA was 20.70 g / L, which is 2.25 times that of the initial FF10 pCES-GAD MUT128 and is the highest shake-flask yield reported to date.
[0062] Example 3: Construction of recombinant plasmids and recombinant bacteria expressing coenzyme A transferase
[0063] Primers for amplification were designed using the act gene from Butyricicoccus faecihominis strain (Genbank accession number MCQ5130945.1):
[0064] ACTF:CATGTGTCAATTGAAAGGACATCAACGATGCGTTCTCTGGAGGGAGTCCG, ACTR:CTACTGCCGCCAGGCAGCGGCCGCTTTAAATCGCACCGCAGGCTGCCAG,
[0065] A gene with the synthesized nucleotide sequence as shown in Gene ID: MCQ5130945.1 was used as a template for PCR amplification to obtain the target fragment. After purification using a DNA purification kit, the PCR amplification product was ligated to the backbone fragment of plasmid pCES (published in the paper "Development of a high-copy-number plasmid via adaptive laboratory evolution of Corynebacterium glutamicum") using Gibson DNA ligation. This ligation was then transformed into E. coli DH5α, and sequencing confirmed successful construction. The expression vector pCES-ACT carrying the ACT coding sequence was transformed into the Corynebacterium glutamicum engineered strain FF18 constructed in Example 1 to obtain the 2-pyrrolidone-producing recombinant strain FF18 pCES-ACT.
[0066] Example 4: Production of 2-pyrrolidone by fermentation using engineered strains of Corynebacterium glutamicum.
[0067] The recombinant 2-pyrrolidone production strain constructed in Example 2 was used for a one-step fermentation process to produce 2-pyrrolidone from glucose. The specific steps were as follows: strain FF18 pCES-ACT was cultured in BHIS medium at 30°C for 12 hours to obtain a seed culture; the seed culture was inoculated at a 10% inoculum into a 500mL shake flask containing 50mL CGXII medium, and fermented at 30°C and 200rpm for 96 hours.
[0068] like Figure 3 As shown, the peak position of 2-pyrrolidone was compared with that of the standard 2-pyrrolidone, and the peak of 2-pyrrolidone was detected in the sample, indicating that the constructed strain can produce 2-pyrrolidone.
[0069] Figure 4 The changes in OD, residual sugar, and 2-pyrrolidone yield during shake-flask fermentation are shown. After 72 hours of fermentation, the 50 g / L glucose was nearly exhausted, and the OD reached its highest value of 44. Finally, after 96 hours, shake-flask fermentation produced 10.31 g / L of 2-pyrrolidone.
[0070] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. An engineered Corynebacterium glutamicum strain, characterized in that, Based on Corynebacterium glutamicum FF10, the following improvements were made: (1) Knock out pyruvate dehydrogenase and increase the expression of aconitate hydratase; (2) Knock out phosphotransacetylase and enhance the expression of 6-phosphofructokinase; (3) Knock out transcriptional regulators iolR and sugR and overexpress glutamate decarboxylase; (4) Knock out succinic semialdehyde dehydrogenase 3 and overexpress inositol transporter; (5) Weaken the expression of glutamate transporter; The amino acid sequence of the pyruvate dehydrogenase poxB is as shown in Genbank accession number CAF21272.1; the amino acid sequence of the aconitate hydratase is as shown in Genbank accession number BAB98933.1; the amino acid sequence of the phosphotransacetylase is as shown in Genbank accession number: CAF20775.1; the amino acid sequence of the 6-phosphofructokinase is as shown in Genbank accession number: BAB98643.1; the amino acid sequence of the transcriptional regulator iolR is as shown in Genbank accession number ASW12947.1; the amino acid sequence of the transcriptional regulator sugR is as shown in Genbank accession number ASW14321.1; the amino acid sequence of the succinic semialdehyde dehydrogenase 3 is as shown in Genbank accession number CAF18619.1; the amino acid sequence of the inositol transporter iolT1 is as shown in Genbank accession number CAF18749.1; the amino acid sequence of the glutamate transporter is as shown in Genbank accession number CAF19973.1; Corynebacterium glutamicum FF10 is disclosed in the patent with publication number CN114752544B; the glutamate decarboxylase is glutamate decarboxylase GAD MUT128, and its amino acid sequence is as shown in SEQ ID NO.
1.
2. The Corynebacterium glutamicum engineering bacterium according to claim 1, wherein The engineered Corynebacterium glutamicum also expresses coenzyme A transferase; the coenzyme A transferase has the amino acid sequence shown in Genbank accession number MCQ5130945.
1.
3. A method for fermentatively producing γ-aminobutyric acid and / or 2-pyrrolidone, characterized in that, Using the engineered Corynebacterium glutamicum as claimed in claim 1 or 2, with monosaccharides, polysaccharides or their mixtures utilizable by Corynebacterium glutamicum as the carbon source, ferment to produce 2-pyrrolidone at pH 7.0 ± 0.
2.
4. The method according to claim 3, wherein The carbon source is one or more of glucose, fructose, sucrose, molasses.
5. The method according to claim 3, characterized in that Cultivate the engineered bacteria overnight in a seed medium, then transfer them to a fermentation medium and ferment at 28 - 30 °C for a period of time.
6. The method according to claim 5, wherein The fermentation medium contains: glucose, (NH4)2SO4, urea, KH2PO4, K2HPO4, MgSO4, CaCl2, MOPS, biotin and trace elements.
7. Use of the engineered Corynebacterium glutamicum as claimed in claim 1 or 2 in the production of 2-pyrrolidone.
8. Use of the Corynebacterium glutamicum engineering bacteria according to claim 1 in the production of 2-pyrrolidone derivatives, characterized in that, The derivative is γ-aminobutyric acid.
Citation Information
Patent Citations
A one-step method for producing γ-aminobutyric acid and the construction of its strain.
CN114752544B
Glutamate decarboxylase mutants and their application in the production of γ-aminobutyric acid
CN114752589B
Recombinant bacteria for producing gamma-aminobutyric acid by glycerin and construction method of recombinant bacteria
CN110283763A
Method for producing gamma-aminobutyric acid by one-step method and strain construction thereof
CN114752544A