A Mutant of Glycosylglycerol Phosphorylase with Improved Thermal Stability and Catalytic Activity and Its Application

By mutation design and screening in glycerol glucoside phosphorylase, the thermal stability and catalytic activity of the enzyme are improved, the problem of insufficient thermal stability and activity of the enzyme is solved, and the conversion rate of glycerol glucoside is significantly improved.

CN115851648BActive Publication Date: 2025-06-10TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202111123160.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-09-24
Publication Date
2025-06-10
Estimated Expiration
2041-09-24

AI Technical Summary

Technical Problem

Glycerol glucoside phosphorylase has low thermal stability and poor catalytic activity, which limits its application in the synthesis pathway of glycerol glucoside.

Method used

By rational design, site-directed saturation mutations, combined mutations, mutation sites and/or mutants that enhance enzyme stability and activity are screened out, including mutations at one or more positions selected from 64, 96, 106, 125, 127, 143, 166, 167, 185, 217, 236, 386, and combinations selected from 48, 50, 61, 119, 321, 438.

Benefits of technology

The thermal stability and catalytic activity of glycerol glucoside phosphorylase was significantly improved. T1/2 at 55°C was 2-1730 times higher than that of wild type, and the catalytic efficiency of glycerol and α-G1P was also improved by 2-30 times, effectively improving the conversion rate of glycerol glucoside.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure QLYQS_1
    Figure QLYQS_1
  • Figure QLYQS_2
    Figure QLYQS_2
  • Figure QLYQS_3
    Figure QLYQS_3
Patent Text Reader

Abstract

The present invention relates to mutation sites and / or mutant variants of thermostable and catalytically active glucosylglycerol phosphorylase, and combinations thereof, as well as the use of the above combined mutation sites and / or mutants in the synthesis of glucosylglycerol in a sucrose system, particularly in the synthesis of glucosylglycerol in a maltodextrin system. The mutant of the present invention has a T1 / 2 at 55 °C that is increased by 800 - 2000 times compared to the wild type, and the catalytic efficiency for glycerol and α-G1P is increased by 2 - 30 times compared to the wild type. Moreover, this enzyme mutant can prepare glucosylglycerol using amylose, amylopectin, maltodextrin, and glycerol as substrates.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a thermostable and catalytically active glyceroglucoside phosphorylase variant, a preparation method thereof and an application thereof, belonging to the field of biotechnology. Background Art

[0002] Glyceroglucoside is formed by connecting one molecule of glucose and one molecule of glycerol in the form of a glycosidic bond. In nature, six structurally different GGs have been identified so far. According to the differences in glycosidic bonds and stereochemical structures, they can be divided into 2-O-α-D-glucosylglycerol (αGG), (2S)-1-O-α-D-glucosylglycerol, (2R)-1-O-α-D-glucosylglycerol, 2-O-β-D-glucosylglycerol, (2S)-1-O-β-D-glucosylglycerol, (2R)-1-O-β-D-glucosylglycerol. Among them, αGG has attracted extensive attention as a moisturizer in cosmetics and is one of the common ingredients in expensive cosmetics. At present, the synthesis methods of glyceroglucoside mainly include chemical methods, fermentation methods and enzyme-catalyzed methods, etc. The chemical synthesis method has a low yield, poor stereoselectivity, and the products are mostly mixtures, and the subsequent separation and purification steps are cumbersome and costly; the fermentation strains for synthesizing glyceroglucoside generally have low production efficiency, and the in vivo metabolic pathways are not clear; the enzyme-catalyzed method utilizes the side reaction of sucrose phosphorylase - the transglycosylation reaction, which has a thermodynamic equilibrium, so the conversion rate is low. In addition, Patent CN201910710353.3 discloses that using sucrose or starch as a substrate, an intermediate α-G1P is generated under the catalysis of phosphorylase, and then glyceroglucoside phosphorylase catalyzes α-G1P and glycerol to generate glyceroglucoside. This route is driven by thermodynamics, so it has a better conversion rate. However, the thermostability of glyceroglucoside phosphorylase is low and the catalytic activity is poor, which greatly limits its application. Therefore, improving the thermostability and catalytic efficiency of glyceroglucoside phosphorylase is of great significance for the synthesis pathway of glyceroglucoside. Summary of the Invention

[0003] The present invention relates to a mutation site and / or mutant of glyceroglucoside phosphorylase with thermostability and catalytic activity and a combination thereof. The present invention screens mutants with improved enzyme activity and thermostability through rational design, site-directed saturation mutagenesis and combinatorial mutagenesis. The present invention is realized through the following technical solutions:

[0004] One of the objectives of the present invention is to provide mutation sites that can enhance the stability of glyceroglucoside phosphorylase. Among them, the mutation sites are mutated at one or more positions selected from 64, 96, 106, 125, 127, 143, 166, 167, 185, 217, 236, and 386, and the positions are numbered corresponding to the amino acid sequence shown in SEQ ID NO:1.

[0005] The present invention also provides mutants that can enhance the stability of glyceroglucoside phosphorylase, which contain the above-mentioned mutation sites, that is, mutated at one or more positions selected from 64, 96, 106, 125, 127, 143, 166, 167, 185, 217, 236, and 386, and the positions are numbered corresponding to the amino acid sequence shown in SEQ ID NO:1.

[0006] According to the preferred technical solution of the present invention, the mutation sites and / or mutants are mutated at one or more positions selected from 64, 96, 125, 127, 143, 166, 217, 236, and 386.

[0007] According to the preferred technical solution of the present invention, the mutation sites and / or mutants include substitutions at one or more positions where 64 is mutated to F, C, A; 96 is mutated to K, M; 106 is mutated to S; 125 is mutated to I, L, E, P; 127 is mutated to A, S, L; 143 is mutated to A, P, E, K; 166 is mutated to P, A, R; 167 is mutated to K; 185 is mutated to K; 217 is mutated to L, I, V, Y; 236 is mutated to L, I, D; 386 is mutated to Q, T, G, H.

[0008] According to the preferred technical solution of the present invention, the mutation sites and / or mutants are mutated at one or more positions where 64 is mutated to F, C, A; 96 is mutated to K, M; 125 is mutated to I, L, E, P; 127 is mutated to A, S, L; 143 is mutated to A, P, E, K; 166 is mutated to P, A, R; 217 is mutated to L, I, V, Y; 236 is mutated to L, I, D; 386 is mutated to Q, T, G, H.

[0009] Another objective of the present invention is to provide mutation sites that can enhance the activity of glyceroglucoside phosphorylase, which are characterized in that the mutation sites and / or mutants are mutated at one or more positions selected from 48, 50, 61, 119, 321, and 438, and the positions are numbered corresponding to the amino acid sequence shown in SEQ ID NO:1.

[0010] The present invention also provides mutants capable of enhancing the activity of glyceroglucoside phosphorylase, which contain the above mutation sites, that is, mutations at one or more positions selected from 48, 50, 61, 119, 321, and 438, wherein the positions are numbered corresponding to the amino acid sequence shown in SEQ ID NO: 1.

[0011] According to a preferred technical solution of the present invention, the mutation site and / or mutant is selected from mutations at one or more positions of 119, 321, and 438.

[0012] According to a preferred technical solution of the present invention, the mutation site and / or mutant contains substitutions at one or more positions selected from: 48 mutated to G; 50 mutated to S; 61 mutated to E; 119 mutated to I, P, L, A; 321 mutated to V, Y, I, K, L; 438 mutated to F, D, P.

[0013] According to a preferred technical solution of the present invention, the mutation site and / or mutant is selected from mutations at one or more positions of 119 mutated to I, P, L, A; 321 mutated to V, Y, I, K, L; 438 mutated to F, D, P.

[0014] The third object of the present invention is to provide a combined mutation site capable of enhancing the stability and / or activity of glyceroglucoside phosphorylase, which is characterized in that it is selected from the combination of the above-mentioned mutation sites. It is selected from any one of the following:

[0015] (1) A combination of two or more mutation sites in one of the objects of the present invention;

[0016] (2) A combination of two or more mutation sites in the second object of the present invention; or

[0017] (3) At least one mutation site in one of the objects of the present invention and at least one mutation site in the second object of the present invention.

[0018] According to the technical solution of the present invention, a combined mutant capable of enhancing the stability and / or activity of glyceroglucoside phosphorylase is provided, which is characterized in that it is selected from the combination of the above-mentioned mutants. It is selected from any one of the following:

[0019] (1) A combination of two or more mutants in one of the objects of the present invention;

[0020] (2) A combination of two or more mutants in the second object of the present invention; or

[0021] (3) At least one mutant in one of the objects of the present invention and at least one mutant in the second object of the present invention.

[0022] According to the technical solution of the present invention, the combination is selected from

[0023] (1) a combination of mutation sites and / or mutants mutated at two or more positions among 64, 96, 106, 125, 127, 143, 166, 167, 185, 217, 236, 386, or

[0024] (2) a combination of mutation sites and / or mutants mutated at two or more positions selected from 48, 50, 61, 119, 321, and 438, or

[0025] (3) a combination of a mutation site and / or a mutant mutated at one or more positions selected from 64, 96, 106, 125, 127, 143, 166, 167, 185, 217, 236, 386 and a mutation site and / or a mutant mutated at one or more positions selected from 48, 50, 61, 119, 321, and 438.

[0026] According to a preferred technical solution of the present invention, among the mutation sites and / or mutants of the combination, one or more positions selected from 64, 96, 125, 127, 143, 166, 217, 236, 386 are mutated, and one or more positions selected from 119, 321, 438 are mutated. For example, two positions or more than two positions.

[0027] According to a preferred technical solution of the present invention, among the mutation sites and / or mutants of the combination, one or more positions selected from 64 mutated to amino acids F, C, A; 96 mutated to K, M; 125 mutated to I, L, E, P; 127 mutated to A, S, L; 143 mutated to A, P, E, K; 166 mutated to P, A, R; 217 mutated to L, I, V, Y; 236 mutated to L, I, D; 386 mutated to Q, T, G, H are mutated, and one or more positions selected from 119 mutated to I, P, L, A; 321 mutated to V, Y, I, K, L; 438 mutated to F, D, P are mutated in combination.

[0028] A fourth object of the present invention is to provide an enzyme, characterized in that the amino acid sequence of the enzyme contains the above mutation sites and / or combined mutation sites.

[0029] According to the enzyme of the present invention, it is characterized in that it contains mutants with the above mutation sites and / or mutants with the above combined mutation sites.

[0030] A fifth object of the present invention is to provide a method for catalyzing a higher conversion rate of glycerol glucoside, characterized in that the above mutation sites and / or mutants and / or combined mutation sites and / or mutants of the present invention are used for preparing glycerol glucoside.

[0031] According to a preferred technical solution of the present invention, it is characterized in that the above-mentioned mutation site and / or mutant, and / or combined mutation site and / or mutant are used for preparing glucosyl glycerol using amylose, amylopectin, sucrose, maltodextrin and glycerol as substrates.

[0032] According to a preferred technical solution of the present invention, the system for preparing glucosyl glycerol using starch or maltodextrin as raw materials includes: isoamylase, dextran phosphorylase, 4-α-glucanotransferase, phosphate buffer, sucrose and glycerol.

[0033] According to a preferred technical solution of the present invention, it is characterized in that isoamylase (EC 3.2.1.68), derived from the hyperthermophilic archaeon Sulfurisphaera tokodaii, named StIA, and the gene number on UniProt is Q973H3. This enzyme catalyzes the cleavage of the branches linked by α-1,6 glycosidic bonds in maltodextrin to form linear glucan, and its dosage in the reaction system is 1-1000 U / mL, preferably 0.5 U / mL; dextran phosphorylase is derived from Thermotoga maritima, named TmGP, and the gene number on KEGG is TM1168. This enzyme has the function of catalyzing the synthesis of α-G1P from linear glucan and phosphate group (PO 4 3- ) and its dosage in the reaction system is 1-1000 U / mL, preferably 10 U / mL; 4-α-glucanotransferase is derived from Thermococcus litoralis, named TlGT, and the gene number on UniProt is O32462. This enzyme has the function of catalyzing the polymerization of maltose and maltotriose to generate maltotetraose or oligosaccharides with higher degrees of polymerization, and its dosage in the reaction system is 1-1000 U / mL, preferably 0.5 U / mL; the glucosyl glycerol phosphorylase mutant is the above-mentioned mutation site and / or mutant, and / or combined mutation site and / or mutant, and its dosage in the reaction system is 1-1000 U / mL, preferably 10 U / mL; the concentration of phosphate buffer is 1-100 mM, preferably 20 mM; the concentration of starch or maltodextrin is 0.01-150 g / L, preferably 100 g / L; the concentration of glycerol is 0.001-1 mol / L, preferably 0.6 mol / L.

[0034] According to a preferred technical solution of the present invention, it is characterized in that the reaction temperature of the above reaction system is 30-55 °C, preferably 55 °C; the reaction time is 1-48 h, preferably 12 h.

[0035] According to another preferred technical solution of the present invention, the system for preparing glucosyl glycerol using sucrose as raw material includes: sucrose phosphorylase, phosphate buffer, sucrose and glycerol.

[0036] According to the preferred technical solution of the present invention, the sucrose phosphorylase (EC 2.4.1.7) is derived from Bifidobacterium adolescentis, named BaSP, and its number on UniProt is A0ZZH6. This enzyme has the function of catalyzing the synthesis of α-G1P and fructose from sucrose and phosphate. Its dosage in the reaction system is 1-1000 U / mL, preferably 10 U / mL; the mutant of glyceroglucoside phosphorylase is the above-mentioned mutation site and / or mutant and / or combined mutation site and / or mutant, and its dosage in the reaction system is 1-1000 U / mL, preferably 10 U / mL; the concentration of phosphate buffer is 1-100 mM, preferably 50 mM; the sucrose concentration is 0.01-2 mol / L, preferably 1 mol / L; the glycerol concentration is 1-2.4 mol / L, preferably 1.2 mol / L.

[0037] According to the preferred technical solution of the present invention, it is characterized in that the reaction temperature of the above reaction system is 30-55 °C, preferably 55 °C; the reaction time is 1-48 h, preferably 12 h.

[0038] The sixth object of the present invention is to provide the application of the above-mentioned mutation site and / or mutant, and / or combined mutation site and / or mutant of the present invention in the preparation of glyceroglucoside.

[0039] According to the preferred technical solution of the present invention, there is provided the application of the above-mentioned mutation site and / or mutant, and / or combined mutation site and / or mutant in the preparation of glyceroglucoside using amylose, amylopectin, sucrose, maltodextrin and glycerol as substrates.

[0040] For example, the present invention provides the application of the above-mentioned combined mutation site and / or mutant in the synthesis of glyceroglucoside in a sucrose system.

[0041] For another example, the present invention provides the application of the described combined mutation site and / or mutant in the synthesis of glyceroglucoside in a maltodextrin system.

[0042] In addition, the present invention also includes the expression vector and / or host cell of the above-mentioned mutation site and / or mutant, and / or combined mutation site and / or mutant.

[0043] The seventh object of the present invention is to provide a method for preparing a thermostable and catalytically active glyceroglucoside phosphorylase variant, including site-directed mutagenesis, and / or culturing a host cell containing the above-mentioned mutation site and / or mutant, and / or combined mutation site and / or mutant in a medium under suitable conditions to produce the mutation site and / or mutant.

[0044] According to the preferred technical solution of the present invention, amino acid sites potentially affecting activity and thermal stability are designed rationally for enzyme molecules by methods such as protein structure simulation, error-prone PCR, site-directed saturation mutagenesis, etc. A site-directed saturation mutagenesis strategy is adopted to construct a mutant library and verified by sequencing, and mutants with improved enzyme activity or thermal stability are screened. Furthermore, by means of combinatorial mutagenesis, these sites are combinatorially mutated to obtain mutants with both improved thermal stability and catalytic activity for the preparation of glycerol glucoside.

[0045] Beneficial effects

[0046] The present invention obtains a series of mutants with significantly improved thermal stability and catalytic activity. The T1 / 2 at 55 °C is increased by 2 - 1730 times compared with the wild type, and the catalytic efficiency for glycerol and α-G1P is increased by 2 - 30 times compared with the wild type. Applying this enzyme mutant can prepare glycerol glucoside using amylose, amylopectin, maltodextrin and glycerol as substrates, effectively improving the conversion rate. Brief description of the drawings

[0047] Figure 1 It is the HPLC diagram of the mutant catalyzing sucrose to produce glycerol glucoside.

[0048] Figure 2 It is the HPLC diagram of the mutant catalyzing maltodextrin to produce glycerol glucoside. Detailed implementation manners

[0049] The technical solution of the present invention will be further described in detail below with specific embodiments. It should be understood that the following embodiments are only for exemplarily illustrating and explaining the present invention, and should not be construed as limiting the protection scope of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.

[0050] Example 1 Construction of prokaryotic expression system

[0051] 1. Synthesize the gene fragment of glycerol glucoside phosphorylase gene (MaGGP) (Nanjing Genscript Biotech Co., Ltd.), and its corresponding amino acid sequence is shown in SEQ ID NO.1, and it is recombined onto the PUC57 vector.

[0052] 2. Using the synthesized gene as a template, design primers P1 and P2 for PCR amplification, and recover the PCR amplification product.

[0053] P1: GGAATTCCATATGATGCATCATCACCATCACCATCTGCTGAAAAACGCTGTTC

[0054] P2: CCGCTCGAGTTAGCATTCCAGGTGACGGG

[0055] 3. Take the PCR amplification product obtained in step 2, use restriction endonucleases NdeI and XhoI to perform double enzyme digestion, and recover the enzyme digestion product.

[0056] 4. Use restriction endonucleases NdeI and XhoI to double-digest the vector pET21a and recover the digestion products.

[0057] 5. The restriction fragment obtained in step 3 and the restriction vector obtained in step 4 are connected using T4 DNA ligase, and the connection product is transformed into DH5α.

[0058] 6. After colony PCR screening and sequencing verification, the positive recombinant plasmid MaGGP-pET21a was obtained.

[0059] 7. The positive recombinant plasmid MaGGP-pET21a was transformed into the Escherichia coli expression host BL21 (DE3) to obtain the prokaryotic expression strain MaGGP-pET21a (BL21), which was used as the primary strain for subsequent directed evolution and fermentation.

[0060] Example 2. Expression and activity evaluation of glycerol glucoside phosphorylase

[0061] 1. The primary strain MaGGP-pET21a (BL21) and its mutants were inoculated in 3 mL LB medium for overnight activation to obtain seed solution, and then transferred to LB medium with an inoculum of 1% to culture until OD600 = 0.6-0.8, and a final concentration of 0.1 mM IPTG was added for induction expression of heterologous proteins. The strains were collected by centrifugation, the bacteria were suspended with 50 mM MES (pH = 6.5) buffer, and then ultrasonically disrupted, and the supernatant was obtained by centrifugation at 14000 rpm for 30 min, and purified by Ni column affinity chromatography, and further ultrafiltered with a 30 kDa ultrafiltration tube to obtain concentrated and purified wild-type and mutant proteins.

[0062] 2. The enzyme activity assay system of glycerol glucoside phosphorylase is as follows: 50mM α-G1P, 50mM glycerol, 50mM MES buffer (pH=6.5), 50μg / mL purified protein, 30℃, 850rpm for 10 minutes. After the reaction, immediately place in a boiling water bath for 10 minutes to terminate the reaction, and measure by high performance liquid chromatography. High performance liquid chromatography analysis was carried out under the following conditions: the instrument was Agilent high performance liquid chromatograph 1200, the chromatographic column was Sugar-Pak column, column temperature: 80℃, mobile phase: ddH2O, flow rate: 0.4mL / min, and the sample volume was 10μL.

[0063] Example 3. Construction of mutant library

[0064] 1. The primers used for error-prone PCR are as follows:

[0065] P3: GGAATTCCATATGATGCATCATCACCATCACCA

[0066] P4: CCGCTCGAGTTAGCATTCCAGGTGACGGG

[0067] 2. Using the gene of the glyceroglucoside phosphorylase synthesized in Example 1 as a template, PCR amplification was carried out with the above primers and a random mutagenesis PCR kit using the gene of wild-type glyceroglucoside phosphorylase as a template. The PCR product was subjected to gel cutting and recovery, and after treatment with restriction enzymes NdeI and XhoI, it was ligated to the pET21a vector that had also been double-digested, and then transformed into competent Escherichia coli BL21(DE3). The mutant LB plate (containing 100 μg / mL ampicillin) was incubated overnight at 37°C. After the transformants grew, single transformants were picked with a sterilized toothpick into a 96-well plate. 1 mL of LB liquid medium was added to each well, and after culturing at 37°C for 6 h, IPTG with a final concentration of 0.1 mM was added, and the temperature was lowered to 16°C for overnight induction.

[0068] 3. The above-mentioned cultured 96-well plate was centrifuged, the supernatant was discarded, the cell pellet was resuspended with 50 mM MES (pH = 6.5), and lysozyme was added. After treatment at 37°C for 1 h and repeated freezing and thawing 2 times, an Escherichia coli cell lysate containing glyceroglucoside phosphorylase was obtained.

[0069] 4. Take 20 μL of the above Escherichia coli cell lysate to measure the activity and thermal stability of the mutant, and obtain the mutant sites with improved activity or thermal stability.

[0070] Example 4. Site-directed saturation mutagenesis of the sites with improved thermal stability

[0071] Using the recombinant plasmid pET21a-MaGGP as a template and a pair of primers with the mutant sites, whole plasmid PCR amplification was carried out with a high-fidelity enzyme to obtain a recombinant plasmid with the specified mutant sites. The amplification product was digested with DpnI enzyme at 37°C for 2 h to degrade the initial template. The digested product was transformed into E. coli BL21 and spread on an LB agar plate containing 100 μg / mL ampicillin, and cultured overnight at 37°C. 100 positive clones were screened for each site.

[0072] Analyze and measure the catalytic activity and thermal stability of the mutant. Sequence the glyceroglucoside phosphorylase mutants with improved catalytic activity or thermal stability, and analyze which amino acids the amino acids at the corresponding positions are mutated to. The mutant sites of the mutants with improved thermal stability and their relative thermal stability at 55°C are shown in Table 1. The T1 / 2 of the wild type at 55°C is 1.

[0073] Table 1 Mutants with Improved Thermal Stability

[0074]

[0075] The present invention provides mutation sites and / or mutants capable of enhancing the stability of glyceroglucoside phosphorylase. Through screening, it is found that amino acid mutations at positions 64, 96, 106, 125, 127, 143, 166, 167, 185, 217, 236, and 386 have a greater impact on thermal stability. Among them, as shown in Table 1, the stability of these mutants is increased by 2 - 25 times. In particular, the mutation of the amino acid residue at position 96 has a significant effect on the improvement of thermal stability. The T1 / 2 time of 96K at 55 °C is the longest, which is 25 times higher than that of the wild type. Therefore, based on the mutation of 96K, the next round of combinatorial mutation is carried out.

[0076] Example 5 Combinatorial Mutations at Sites with Improved Thermal Stability

[0077] The double mutants with significantly improved relative thermal stability mentioned above were subjected to round-by-round combinatorial mutations with other sites with improved thermal stability in single-site saturation mutations, and the T1 / 2 at 55 °C was measured, and the multiple of improvement compared with the wild type was calculated. Table 2 lists the relative thermal stability and mutation conditions of the combinatorial mutants with significantly improved thermal stability, with the wild type being 1.

[0078] Table 2 Combinatorial Mutants with Significantly Improved Thermal Stability

[0079]

[0080]

[0081]

[0082]

[0083]

[0084] The present invention provides combinatorial mutation sites and / or mutants capable of enhancing the stability of glyceroglucoside phosphorylase. Through screening, it is found that, as shown in Table 2, the mutation sites are selected from combinations of mutation sites and / or mutants mutated at two or more positions among 64, 96, 106, 125, 127, 143, 166, 167, 185, 217, 236, and 386, and all obtain good relative thermal stability effects. Surprisingly, some even increase by 1732 times compared with the wild type, far higher than single mutations and their sums.

[0085] Example 6 Site-Directed Saturation Mutations at Sites with Improved Activity

[0086] Using the recombinant plasmid pET21a-MaGGP as a template, a pair of primers with mutation sites, and a high-fidelity enzyme for whole-plasmid PCR amplification to obtain a recombinant plasmid with the specified mutation sites. The amplification product was digested with DpnI enzyme at 37 °C for 2 h to degrade the initial template. The digested product was transformed into E. coli BL21 and spread on an LB agar plate containing 100 μg / mL ampicillin, and cultured overnight at 37 °C. 100 positive clones were screened for each site.

[0087] Analyze and determine the catalytic activity of the mutants. Sequence the mutants of glyceroglucoside phosphorylase with improved catalytic activity to analyze what amino acids the amino acid mutations at the corresponding positions are. The mutation sites and relative activities of the mutants with improved activity are shown in Table 3, and the relative activity of the wild type is 1.

[0088] The enzyme activity is defined as: the amount of enzyme required to generate 1 μmol of glyceroglucoside in 1 min is defined as 1 U. The enzyme activity assay system is 1 mL, containing 50 mM α-G1P, 50 mM glycerol, 50 μg / mL glyceroglucoside phosphorylase, 50 mM MES buffer (pH = 6.5). After reacting at 30 °C for 10 min, immediately terminate the reaction in a boiling water bath for 10 min and determine it using high-performance liquid chromatography. The high-performance liquid chromatography analysis was carried out under the following conditions: the instrument is Agilent high-performance liquid chromatograph 1200, the chromatographic column is Sugar-Pak column, the column temperature: 80 °C, the mobile phase: ddH2O, the flow rate: 0.4 mL / min, and the sample injection volume is 10 μL.

[0089] Table 3 Mutation sites and relative activities of mutants with improved activity

[0090]

[0091] The present invention provides mutation sites and / or mutants capable of enhancing the activity of glyceroglucoside phosphorylase. Through screening, it was found that mutations at sites 48, 50, 61, 119, 321, and 438 have a greater impact on the enzyme catalytic activity. The relative activities of mutants 48G, 50S, 61E, 119I, 321V, and 438F are 1.5, 1.3, 1.4, 4.8, 4.3, and 3.7 times that of the wild type. Among them, as shown in Table 3, for the 3 sites closely related to the activity, their total position numbers in the sequence are 119, 321, and 438. The mutation of the amino acid residue at position 321 has a more significant improvement in catalytic activity. 321V has increased by 4.8 times compared to the wild type. Therefore, on the basis of the obtained mutants with improved thermal stability, the mutation at site 321 is combined.

[0092] Example 7 Combinatorial mutation of sites with improved activity

[0093] The mutants with significantly improved relative stability and significantly improved activity were subjected to round-by-round combinatorial mutagenesis with other sites where the relative activity was increased in single-site saturation mutagenesis, and the activity was measured, and the fold increase compared to the wild type was calculated. The activities and mutation conditions of the combinatorial mutants with significantly improved relative activity are listed in Table 4, and the wild type is 1.

[0094] The enzyme activity was defined as: the amount of enzyme required to produce 1 μmol of glyceroglucoside in 1 min was defined as 1 U. The enzyme activity assay system was 1 mL, containing 50 mM α-G1P, 50 mM glycerol, 50 μg / mL glyceroglucoside phosphorylase, 50 mM MES buffer (pH = 6.5). After reacting at 30 °C for 10 min, the reaction was terminated immediately by boiling water bath for 10 min, and the determination was carried out by high performance liquid chromatography. The high performance liquid chromatography analysis was carried out under the following conditions: the instrument was Agilent high performance liquid chromatograph 1200, the chromatographic column was Sugar-Pak column, the column temperature: 80 °C, the mobile phase: ddH2O, the flow rate: 0.4 mL / min, and the sample injection volume was 10 μL.

[0095] Table 4 Examples of mutants with improved thermal stability and catalytic activity

[0096]

[0097]

[0098]

[0099] The present invention provides combinatorial mutation sites and / or mutants capable of enhancing the stability and activity of glyceroglucoside phosphorylase. Through a large number of screenings, it was found that the mutation sites and / or mutants mutated at one or more positions selected from 64, 96, 106, 125, 127, 143, 166, 167, 185, 217, 236, 386, and the combination with the mutation sites and / or mutants mutated at one or more positions selected from 119, 321, and 438, wherein, as shown in Table 4, the above combination not only improves the stability, but also significantly enhances the relative activity, even increasing by 20 times compared to the wild type.

[0100] Example 8. Synthesis of glyceroglucoside using glyceroglucoside phosphorylase mutant with sucrose as the substrate

[0101] Construct a combinatorial mutant of the above site, which can convert sucrose and glycerol into glucosylglycerol. The reaction system contains sucrose phosphorylase (EC 2.4.1.7) in addition to glucosylglycerol phosphorylase. In the said reaction system, the sucrose phosphorylase is derived from Bifidobacterium adolescentis, named BaSP, and its number on UniProt is A0ZZH6. This enzyme has the function of catalyzing the synthesis of α-G1P and fructose from sucrose and phosphate.

[0102] The above gene was synthesized by Nanjing Genscript Biotech Co., Ltd., ligated to the pET21a vector, transformed into competent Escherichia coli BL21, and a recombinant strain was obtained. The sucrose phosphorylase and glucosylglycerol phosphorylase were prepared according to the method described in the first item of Example 2. A reaction system was established based on the enzyme solution.

[0103] The reaction system is as follows: 1M sucrose, 1.2M glycerol, 50 mM phosphate buffer (pH = 6.5), 10 U / mL sucrose phosphorylase, 10 U / mL glucosylglycerol phosphorylase, react at 55 °C for 12 h. After the reaction, terminate the reaction by heating in a boiling water bath at 100 °C for 10 min, and determine it by high performance liquid chromatography. The high performance liquid chromatography analysis was carried out under the following conditions: the instrument was Agilent 1200 high performance liquid chromatograph, the chromatographic column was Sugar-Pak column, the column temperature: 80 °C, the mobile phase: ddH2O, the flow rate: 0.4 mL / min, and the sample injection volume was 10 μL.

[0104] Figure 1 As shown, the MaGGP mutant can use sucrose and glycerol as substrates to catalyze the formation of glucosylglycerol, and the peak time is consistent with that of the glucosylglycerol standard. Table 5 lists the experimental data of some mutants with higher conversion rates.

[0105]

[0106]

[0107] Using the glucosylglycerol phosphorylase mutant of the present application to synthesize glucosylglycerol has a high conversion rate. As shown in Table 5, some mutants with improved stability and significantly enhanced relative activity in the conversion of the substrate sucrose to synthesize glucosylglycerol have a conversion rate of over 90%, and the concentration of glucosylglycerol in the final reaction system exceeds 200 g / L.

[0108] Further establish a reaction system under high substrate concentration. The reaction system is as follows: 2 M sucrose, 2.4 M glycerol, 50 mM PBS buffer (pH = 6.5), 20 U / mL sucrose phosphorylase, 20 U / mL glyceroglucoside phosphorylase, react at 55 °C for 24 h, and the concentration of glyceroglucoside is 450 g / L.

[0109] Example 9. Synthesis of glyceroglucoside using a mutant of glyceroglucoside phosphorylase with maltodextrin as the substrate

[0110] Using the mutant of the present invention, maltodextrin and glycerol are converted to form glyceroglucoside. The reaction system further contains isoamylase (EC 3.2.1.68), dextran phosphorylase (EC 2.4.1.1), and 4-α-glucanotransferase (4GT, EC 2.4.1.25) in addition to glyceroglucoside phosphorylase. In the said reaction system, the isoamylase is derived from the hyperthermophilic archaeon Sulfurisphaera tokodaii, named StIA, and the gene number on UniProt is Q973H3. This enzyme catalyzes the cleavage of the branches linked by α-1,6 glycosidic bonds in maltodextrin to form linear glucan; the dextran phosphorylase is derived from Thermotoga maritima, named TmGP, and the gene number on KEGG is TM1168. This enzyme has the function of catalyzing the synthesis of α-G1P from linear glucan and phosphate group (PO 4 3- ) The 4-α-glucanotransferase is derived from Thermococcus litoralis, named TlGT, and the gene number on UniProt is O32462. This enzyme has the function of catalyzing the polymerization of maltose and maltotriose to form maltotetraose or oligosaccharides with higher degrees of polymerization.

[0111] The above genes were synthesized by Nanjing Genscript Biotech Co., Ltd., ligated to the pET21a vector, transformed into competent Escherichia coli BL21, and recombinant strains were obtained. The isoamylase, dextran phosphorylase, 4-α-glucanotransferase, and glyceroglucoside phosphorylase were prepared according to the method described in the first item of Example 2, and a reaction system was established based on the enzyme solution.

[0112] The reaction system is as follows: 100 g / L maltodextrin, 600 mM glycerol, 50 mM phosphate buffer (pH = 6.5), 10 U / mL isoamylase, 10 U / mL dextran phosphorylase, 10 U / mL dextran transferase, 10 U / mL glyceroglucoside phosphorylase, and react at 55 °C for 12 h. After the reaction, terminate the reaction by heating in a boiling water bath at 100 °C for 10 min, and perform the determination using high-performance liquid chromatography. The high-performance liquid chromatography analysis is carried out under the following conditions: the instrument is Agilent high-performance liquid chromatograph 1200, the chromatographic column is Sugar-Pak column, the column temperature: 80 °C, the mobile phase: ddH2O, the flow rate: 0.4 mL / min, and the sample injection volume is 10 μL. Figure 2 As shown in Figure 2 , the MaGGP mutant can use maltodextrin and glycerol as substrates to catalyze the production of glyceroglucoside, which has the same peak time as the standard product of glyceroglucoside, and the conversion efficiency can reach 88% - 95%. Table 6 lists the conversion rates of some mutants for converting maltodextrin to produce glyceroglucoside, and the conversion rates are maintained between 88% - 95%.

[0113] Table 6 Mutants used for converting maltodextrin to produce glyceroglucoside

[0114]

[0115]

[0116] The above describes the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention. SEQUENCE LISTING <110> Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences <120> Mutant of glyceroglucoside phosphorylase with improved thermal stability and catalytic activity and its application <130> CPCN21411161 <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 480 <212> PRT <213> Marinobacter adhaerens HP15 <400> 1 Met Leu Leu Lys Asn Ala Val Gln Leu Ile Cys Tyr Pro Asp Arg Ile 1 5 10 15 Gly Asn Asn Leu Lys Asp Leu Tyr Thr Val Val Asp Thr His Leu Ser 20 25 30 Glu Ala Ile Gly Gly Leu His Ile Leu Pro Phe Phe Pro Ser Asn Ala 35 40 45 Asp Gly Gly Phe Ser Pro Leu Thr His Lys Glu Val Asp Pro Lys Val 50 55 60 Gly Thr Trp Asp Asp Ile Glu Ala Phe Thr Ala Lys Tyr Asp Leu Cys 65 70 75 80 Val Asp Leu Thr Val Asn His Ile Ser Asp Glu Ser Pro Glu Phe Thr 85 90 95 Asp Phe Ile Ala Asn Gly Phe Asp Ser Glu Tyr Ala Asp Leu Phe Val 100 105 110 His Val Asp Lys Phe Gly Glu Ile Ser Pro Asp Asp Met Ala Lys Ile 115 120 125 His Ile Arg Lys Glu Lys Glu Pro Phe Arg Glu Val Thr Leu Ser Asp 130 135 140 Gly Thr Lys Thr Arg Val Trp Cys Thr Phe Thr Glu Gln Gln Ile Asp 145 150 155 160 Leu Asn Tyr Glu Ser Asp Leu Ala Tyr Gln Leu Met Glu Ser Tyr Ile 165 170 175 Gly Phe Leu Thr Ser Lys Gly Val Asn Leu Leu Arg Leu Asp Ala Phe 180 185 190 Gly Tyr Thr Thr Lys Arg Ile Gly Thr Ser Cys Phe Leu Val Glu Pro 195 200 205 Glu Val Tyr Gln Ile Leu Asp Trp Val Asn Gln Val Ala Leu Lys His 210 215 220 Gly Ala Glu Cys Leu Pro Glu Val His Asp His Thr Ser Tyr Gln Tyr 225 230 235 240 Ala Ile Ser Arg Arg Asn Met His Pro Tyr Gly Phe Ala Leu Pro Pro 245 250 255 Leu Leu Leu Tyr Ser Leu Leu Asp Ala Asn Ser Thr Tyr Leu Lys Asn 260 265 270 Trp Leu Arg Met Cys Pro Arg Asn Met Val Thr Val Leu Asp Thr His 275 280 285 Asp Gly Ile Cys Ile Pro Asp Val Glu Gly Val Leu Pro Asp Glu Lys 290 295 300 Ile Lys Val Leu Ile Asp Asn Ile Asp Ala Arg Ser Ala Asp Pro Ile 305 310 315 320 Methionine, Arginine, Arginine, Serine, Alanine, Alanine, Asparagine, Isoleucine, Histidine, Serine, Valine, Glycine, Alanine, Isoleucine, Tyrosine, Glutamine 325 330 335 Leucine, Threonine, Cysteine, Threonine, Phenylalanine, Tyrosine, Aspartic Acid, Alanine, Leucine, Methionine, Glutamine, Asparagine, Aspartic Acid, Aspartic Acid, Alanine, Tyrosine 340 345 350 Isoleucine, Alanine, Alanine, Arginine, Alanine, Isoleucine, Glutamine, Phenylalanine, Phenylalanine, Threonine, Proline, Glycine, Isoleucine, Proline, Glutamine, Valine 355 360 365 Tyrosine, Tyrosine, Valine, Glycine, Leucine, Leucine, Alanine, Glycine, Cysteine, Asparagine, Aspartic Acid, Histidine, Glutamic Acid, Leucine, Methionine, Glutamic Acid 370 375 380 Glutamine, Serine, Glycine, Glutamic Acid, Leucine, Arginine, Aspartic Acid, Isoleucine, Asparagine, Arginine, Histidine, Tyrosine, Tyrosine, Threonine, Leucine, Glutamic Acid 385 390 395 400 Glutamic Acid, Valine, Glutamic Acid, Glutamine, Aspartic Acid, Isoleucine, Glutamine, Lysine, Proline, Valine, Valine, Glutamine, Arginine, Leucine, Leucine, Serine 405 410 415 Leucine, Methionine, Lysine, Phenylalanine, Arginine, Serine, Asparagine, Tyrosine, Proline, Alanine, Phenylalanine, Aspartic Acid, Glycine, Histidine, Phenylalanine, Glutamic Acid 420 425 430 Leucine, Asparagine, Tyrosine, Serine, Asparagine, Asparagine, Serine, Serine, Valine, Alanine, Methionine, Alanine, Tryptophan, Arginine, Histidine, Glycine 435 440 445 Aspartic Acid, Tyrosine, Tyrosine, Cysteine, Histidine, Leucine, Phenylalanine, Valine, Aspartic Acid, Leucine, Asparagine, Phenylalanine, Lysine, Threonine, Valine, Lysine 450 455 460 Valine, Threonine, Tyrosine, Threonine, Aspartic Acid, Valine, Glutamic Acid, Threonine, Glycine, Glutamic Acid, Threonine, Arginine, Histidine, Leucine, Glutamic Acid, Cysteine 465 470 475 480 <210> 2 <211> 1440 <212> DNA <213> Marinobacter adhaerens <400> 2 atgctgctga aaaacgctgt tcagctgatc tgctacccgg accgtatcgg taacaacctg 60 aaagacctgt acaccgttgt tgacacccac ctgtctgaag ctatcggtgg tctgcacatc 120 ctgccgttct tcccgtctaa cgctgacggt ggtttctctc cgctgaccca caaagaagtt 180 gacccgaaag ttggtacctg ggacgacatc gaagctttca ccgctaaata cgacctgtgc 240 gttgacctga ccgttaacca catctctgac gaatctccgg aattcaccga cttcatcgct 300 aacggtttcg actctgaata cgctgacctg ttcgttcacg ttgacaaatt cggtgaaatc 360 tctccggacg acatggctaa aatccacatc cgtaaagaaa aagaaccgtt ccgtgaagtt 420 accctgtctg acggtaccaa aacccgtgtt tggtgcacct tcaccgaaca gcagatcgac 480 ctgaactacg aatctgacct ggcttaccag ctgatggaat cttacatcgg tttcctgacc 540 tctaaaggtg ttaacctgct gcgtctggac gctttcggtt acaccaccaa acgtatcggt 600 acctcttgct tcctggttga accggaagtt taccagatcc tggactgggt taaccaggtt 660 gctctgaaac acggtgctga atgcctgccg gaagttcacg accacacctc ttaccagtac 720 gctatctctc gtcgtaacat gcacccgtac ggtttcgctc tgccgccgct gctgctgtac 780 tctctgctgg acgctaactc tacctacctg aaaaactggc tgcgtatgtg cccgcgtaac 840 atggttaccg ttctggacac ccacgacggt atctgcatcc cggacgttga aggtgttctg 900 ccggacgaaa aaatcaaagt tctgatcgac aacatcgacg ctcgttctgc tgacccgatc 960 atgcgtcgtt ctgctgctaa catccactct gttggtgcta tctaccagct gacctgcacc 1020 ttctacgacg ctctgatgca gaacgacgac gcttacatcg ctgctcgtgc tatccagttc 1080 ttcaccccgg gtatcccgca ggtttactac gttggtctgc tggctggttg caacgaccac 1140 gaactgatgg aacagtctgg tgaactgcgt gacatcaacc gtcactacta caccctggaa 1200 gaagttgaac aggacatcca gaaaccggtt gttcagcgtc tgctgtctct gatgaaattc 1260 cgttctaact acccggcttt cgacggtcac ttcgaactga actactctaa caactcttct 1320 gttgctatgg cttggcgtca cggtgactac tactgccacc tgttcgttga cctgaacttc 1380 aaaaccgtta aagttaccta caccgacgtt gaaaccggtg aaacccgtca cctggaatgc 1440

Claims

1. An enzyme, which is a mutation of the amino acid sequence shown in SEQ ID NO: 1: ; ; ; ; ; ; ; ; ; ; The site is numbered corresponding to the amino acid sequence shown in SEQ ID NO:

1.

2. A method for catalyzing the production of glucosylglycerol, characterized in that the system contains the enzyme described in claim 1.

3. The method according to claim 2, characterized in that a system for preparing glucosylglycerol using sucrose and glycerol, or maltodextrin and glycerol as substrates.

4. The method according to claim 3, characterized in that when preparing the glucosylglycerol system using sucrose as a raw material, the reaction system further comprises: sucrose phosphorylase, phosphate buffer, sucrose and glycerol.

5. The method according to claim 4, characterized in that the sucrose phosphorylase is derived from Bifidobacterium adolescentis, named BaSP, with the accession number A0ZZH6 on UniProt, and its dosage in the reaction system is 1 - 1000 U / mL; wherein, the enzyme described in claim 1 has a dosage of 1 - 1000 U / mL in the reaction system; the concentration of the phosphate buffer is 1 - 100 mM; the sucrose concentration is 0.01 - 2 mol / L; the glycerol concentration is 1 - 2.4 mol / L.

6. The method according to claim 5, characterized in that the sucrose phosphorylase is derived from Bifidobacterium adolescentis, named BaSP, with the accession number A0ZZH6 on UniProt, and its dosage in the reaction system is 10 U / mL; wherein, the enzyme described in claim 1 has a dosage of 10 U / mL in the reaction system; the concentration of the phosphate buffer is 50 mM; the sucrose concentration is 1 mol / L; the glycerol concentration is 1.2 mol / L.

7. The method according to any one of claims 4 - 6, characterized in that the reaction temperature of the reaction system is 30 - 55 °C; the reaction time is 1 - 48 h.

8. The method according to claim 7, characterized in that the reaction temperature of the reaction system is 55 °C; the reaction time is 12 h.

9. The method according to claim 3, characterized in that when preparing the glucosylglycerol system using maltodextrin as a raw material, the reaction system further comprises: isoamylase, dextran phosphorylase, 4-α-glucanotransferase, phosphate buffer, sucrose and glycerol.

10. The method according to claim 9, characterized in that The isoamylase is derived from a hyperthermophilic archaeon ( Sulfurisphaera tokodaii ), named StIA, with the gene number Q973H3 on UniProt, and the dosage in the reaction system is 1-1000 U / mL; The dextran phosphorylase is derived from Thermotoga maritima , named TmGP, with the gene number of TM1168 on KEGG, and the dosage in the reaction system is 1-1000 U / mL; The 4-α-glucanotransferase is derived from Thermococcus litoralis , named TlGT, with the gene number of O32462 on UniProt, and the dosage in the reaction system is 1-1000 U / mL; wherein the enzyme described in claim 1 has a dosage of 1 - 1000 U / mL in the reaction system; the concentration of the phosphate buffer is 1 - 100 mM; the starch or maltodextrin concentration is 0.01 - 150 g / L; the glycerol concentration is 0.001 - 1 mol / L.

11. The method according to claim 10, characterized in that, The isoamylase is derived from hyperthermophilic archaea ( Sulfurisphaera tokodaii ), named StIA, with the gene number Q973H3 on UniProt, and the dosage in the reaction system is 0.5 U / mL; The dextran phosphorylase is derived from Thermotoga maritima , named TmGP, with the gene number on KEGG being TM1168, and the dosage in the reaction system being 10 U / mL; The 4-α-glucanotransferase is derived from Thermococcus litoralis , named TlGT, with the gene number O32462 on UniProt, and the dosage in the reaction system is 0.5 U / mL; wherein the dosage of the enzyme described in claim 1 in the reaction system is 10 U / mL; the concentration of the phosphate buffer solution is 20 mM; the concentration of the starch or maltodextrin is 100 g / L; the concentration of the glycerol is 0.6 mol / L.

12. The method according to claim 9, characterized in that, the reaction temperature of the reaction system is 30 - 55 °C; the reaction time is 1 - 48 h.

13. The method according to claim 12, characterized in that, the reaction temperature of the reaction system is 55 °C; the reaction time is 12 h.

14. Use of the enzyme described in claim 1 in the preparation of glucosyl glycerol.

15. The use according to claim 14, characterized in that, sucrose and glycerol are used as substrates, or maltodextrin and glycerol are used as substrates.

16. An expression vector and / or host cell comprising the enzyme described in claim 1, wherein the host cell is a non-plant cell.

17. A method for producing the enzyme described in claim 1, characterized in that, it includes site-directed mutagenesis and / or culturing the host cell described in claim 16 in a medium under suitable conditions to produce the enzyme.

Citation Information

Patent Citations

  • Heat-resisting phosphorylase and application thereof

    CN109576239A

  • Method for synthesizing glycosylglycerol through biocatalysis

    CN110438100A