Urine exosome tsRNA marker for identifying lupus nephritis and probe and application thereof

By detecting the urinary exosome tsRNA markers tRF3-Ile-AAT-1 and tiRNA5-Lys-CTT-1, the accuracy and invasiveness issues in the diagnosis of lupus nephritis have been resolved, enabling non-invasive and low-cost dynamic monitoring.

CN115851911BActive Publication Date: 2025-10-24NANJING DRUM TOWER HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211488205.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-25
Publication Date
2025-10-24
Estimated Expiration
2042-11-25

AI Technical Summary

Technical Problem

Current technologies for the diagnosis of lupus nephritis suffer from problems such as inaccurate timing, high invasiveness, and poor patient compliance, and lack effective biomarkers for early diagnosis and dynamic monitoring.

Method used

Using the urinary exosome tsRNA markers tRF3-Ile-AAT-1 and tiRNA5-Lys-CTT-1, specific probes were designed and diagnostic kits were prepared. The expression level of tsRNA in urine was detected by PCR reaction.

Benefits of technology

It improves the diagnostic sensitivity and specificity of lupus nephritis, simplifies the testing process, reduces costs, and enables non-invasive dynamic monitoring of urine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115851911B_ABST
    Figure CN115851911B_ABST
Patent Text Reader

Abstract

The application provides a urine exosome tsRNA marker and probe for identifying lupus nephritis and application thereof, and belongs to the field of molecular biology; the marker comprises any one or more of tRF3-Ile-AAT-1 and tiRNA5-Lys-CTT-1; the tsRNA screened in the application is significantly higher in expression in urine exosomes of patients with lupus nephritis than in patients without nephritis, and has very good correlation with clinical test indexes of lupus nephritis and disease activity score, so that the marker can be used for preparing a diagnostic kit, and is used for assisting a clinician in monitoring and treatment of whether a patient with SLE has kidney involvement.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology, and particularly relates to a urine exosome tsRNA marker for identifying lupus nephritis and a probe and application thereof. BACKGROUND

[0002] Lupus nephritis (LN) belongs to glomerulonephritis and is one of the most serious organ manifestations of systemic lupus erythematosus (SLE). According to different manifestations and severity of SLE kidney involvement, LN can be divided into six different histological types. About 65% of SLE patients will develop nephritis at some stage of the disease, and 25% of lupus nephritis patients with a disease duration of more than 10 years will develop end-stage kidney disease. The early diagnosis and timely intervention of LN are the key to preventing disease progression. The most commonly used method for diagnosing LN in clinical practice is urine routine, 24-hour urine protein quantification and renal biopsy. However, these methods have the disadvantages of inaccurate time, loss of part of the urine sample during the sample storage process, poor patient compliance for urine protein detection, and invasiveness of the renal biopsy process. Therefore, there is an urgent need to find new biomarkers to distinguish LN from SLE.

[0003] tsRNA is a new type of small non-coding RNA discovered in recent years, with a length of about 18-40 nt. According to the different ways of production, it is mainly divided into two types: tRNA halves and tRNA-derived RNA fragments (tRFs). tRNA is the most modified and widely distributed RNA in the body, especially the nuclear-encoded tRNA, with an average of 13 modifications per molecule of tRNA. tsRNA is derived from tRNA and contains abundant RNA modifications, with tissue and cell specificity. It participates in various biological functions of the body through mechanisms such as protein translation and transposon regulation, including stress response of cells and tissues, protein translation regulation, epigenetic regulation, etc., and has become a research hotspot. More importantly, the abundance of tsRNA in body fluids and exosomes may be superior to that of miRNA, and it itself has rich modifications and stable structure, with tissue specificity and time specificity, fully meeting the characteristics of an ideal clinical test marker. Unlike tissue or blood samples, urine collection is very convenient and belongs to the true sense of non-invasive, which is conducive to dynamic monitoring of the disease condition. Urine is physically close to the active site of kidney lesions and can directly reflect the true situation of the disease, so it has the potential and hope to become a specimen type for monitoring LN patients.

[0004] However, there is no report on the research of urine exosome tsRNA in the field of autoimmune diseases, especially lupus nephritis, at present, therefore, the urine exosome tsRNA has great development potential and broad application prospect in the differential and dynamic evaluation diagnosis of lupus nephritis liquid biopsy. SUMMARY

[0005] In order to solve the above problems, the application discloses a urine exosome tsRNA marker for identifying lupus nephritis, provides a probe of the marker and prepares a corresponding detection kit.

[0006] In order to achieve the above purpose, the technical scheme of the application is as follows:

[0007] The application provides a urine exosome tsRNA marker for identifying lupus nephritis, wherein the tsRNA marker comprises any one or more of the following sequences,

[0008] tRF3-Ile-AAT-1: SEQ ID NO. 1; CGCGGGTTCGATCCCCGTACGGGCCACCA;

[0009] tiRNA5-Lys-CTT-1: SEQ ID NO. 2; GCCCGGCTAGCTCAGTCGGTAGAGCATGGGACTCTT.

[0010] The application provides a probe which can specifically capture the urine exosome tsRNA marker related to lupus nephritis, and the probe is a tsRNA probe synthesized by GenScript Company, and the sequence of the probe is shown as SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6, wherein the SEQ ID NO. 3 and the SEQ ID NO. 5 can specifically capture tRF3-Ile-AAT-1 (SEQ ID NO. 1), and the SEQ ID NO. 4 and the SEQ ID NO. 6 can specifically capture tiRNA5-Lys-CTT-1 (SEQ ID NO. 2).

[0011] SEQ ID NO. 3 (DNA, artificial probe sequence)

[0012] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGTGG;

[0013] SEQ ID NO. 4 (DNA, artificial probe sequence)

[0014] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAGAGT;

[0015] SEQ ID NO. 5 (DNA, artificial probe sequence)

[0016] TTCGATCCCCGTACGGG;

[0017] SEQ ID NO. 6 (DNA, artificial probe sequence)

[0018] GCTCAGTCGGTAGAGCATGGG.

[0019] The present invention provides the above-mentioned urine exosome tsRNA marker for identifying lupus nephritis, and uses microRNA Design software to design probes corresponding to the marker.

[0020] Application of the above probe in the preparation of a lupus nephritis diagnostic kit.

[0021] The present invention also provides a lupus nephritis diagnostic kit, which is used to detect the expression level of any one or more of the above-mentioned urinary exosome tsRNA markers for identifying lupus nephritis in urine exosomes.

[0022] Furthermore, the kit includes the above-mentioned probe.

[0023] Furthermore, the kit also includes reagents and enzymes commonly used in PCR reactions.

[0024] Furthermore, the reagents and enzymes commonly used in PCR reactions in the kit include dNTP mix, AMV reverse transcriptase, buffer, DEPC water and Taq DNA polymerase.

[0025] Application of the above-mentioned urine exosome tsRNA marker for identifying lupus nephritis and the probe of the marker in the preparation of a lupus nephritis diagnostic kit.

[0026] The beneficial effects of the present invention are:

[0027] (1) Compared with traditional protein markers and miRNA, tsRNA encapsulated in urine exosomes has higher stability, which helps to resist degradation by RNA enzymes in urine, and has accurate quantitative detection, which helps to improve the sensitivity and specificity of disease diagnosis.

[0028] (2) Compared with clinical autoantibody markers, this detection marker is inexpensive. Compared with the 24-hour urine protein test, this method is easy to use and can be tested at any time.

[0029] (3) The present application first confirms a group of novel exosome tsRNA markers, namely tRF3-Ile-AAT-1 and tiRNA5-Lys-CTT-1, which are the first confirmed exosome tsRNA markers for the diagnosis of LN, and lay a foundation for the in-depth study of tsRNA in LN. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 The expression profile of tsRNAs in urine exosomes of the present application;

[0031] Figure 2 The preliminary verification of 10 high-expression tsRNAs of the LN group of the present application;

[0032] Figure 3 The ROC curve of 2 high-expression tsRNAs of the LN group of the present application and the correlation heat map with clinical indicators. DETAILED DESCRIPTION

[0033] The present application will be further illustrated in conjunction with the drawings and specific embodiments, and it should be understood that the following specific embodiments are only used to illustrate the present application and not to limit the scope of the present application.

[0034] Example 1

[0035] The present application first isolates the urine exosomes of gender and age matched lupus nephritis patients and systemic lupus erythematosus patients without nephritis, extracts RNA for high-throughput sequencing analysis of tsRNA, and obtains a group of exosome tsRNA markers related to lupus nephritis through small sample preliminary screening and large sample clinical verification. Based on this, a kit for clinical diagnosis of lupus nephritis can be developed, which can be used for the clinical auxiliary identification and dynamic evaluation of lupus nephritis.

[0036] The technical solution of the present application to solve the problem includes:

[0037] (1) Collect urine samples that meet the standard according to the standard procedure (SOP), and collect complete clinical medical record information of each sample;

[0038] (2) Screening and analysis of urine exosome tsRNA differential expression profile: screening of lupus nephritis patients, systemic lupus erythematosus patients without nephritis matched with gender and age, isolation of urine exosomes, high-throughput sequencing analysis of tsRNA expression profile in exosomes, screening of differentially expressed tsRNAs and multi-stage verification by clinical samples;

[0039] (3) Real-time fluorescent quantitative analysis (RT-qPCR) of the above screened tsRNA in exosomes to identify tsRNAs related to lupus nephritis;

[0040] (4) Based on the above screening of tsRNAs, a diagnostic kit for lupus nephritis is prepared.

[0041] Specific preparation of lupus nephritis diagnostic kit includes the following steps:

[0042] (1) According to the classification criteria for systemic lupus erythematosus formulated by the American Rheumatism Association in 1997, urine samples of patients diagnosed with systemic lupus erythematosus without nephritis (SLE-LN) and lupus nephritis (LN) were collected. In this study, 94 SLE samples without nephritis and 79 LN samples met the criteria;

[0043] (2) Use the precipitation kit to extract 200 μL of exosomes in the urine sample of step (1), and further extract the total RNA of the exosomes by Trizol (Invitrogen life technologies) method;

[0044] (3) RNA quality detection: The purity and concentration of the total RNA of the exosomes in step (2) were detected by agarose gel electrophoresis and qubit.

[0045] (4) High-throughput sequencing of tsRNA: The total RNA of the exosomes in step (2) was subjected to PAGE electrophoresis recovery; tsRNA contains a large number of epigenetic modifications, which can interfere with the construction of small RNA sequencing library. Before library construction, the RNA sample was treated with ALKB demethylase, and the sequencing was performed using a second-generation sequencing system (Illumina Hiseq Sequencer) and high-throughput gene expression database (Gene expression Omnibus) large data analysis to screen tsRNA; delete repeated, mismatched, and low-abundance sequences, select tsRNA with a difference of >10 and P <0.01 for differential analysis;

[0046] (5) RT-qPCR quantitative detection of tsRNA: Trizol method was used to extract total RNA of urine exosomes; tsRNA probe (2 μM) synthesized by GenScript Company was used for reverse transcription of RNA sample to cDNA (25 °C, 5 min; 50 °C, 15 min; 85 °C, 5 min), and the reagents used were 10x RT Mix 1 μL, HiScript Ⅱ enzyme 1 μL, RT mix 5 μL, RT-primer 0.5 μL and DEPC water 2.5 μL; tsRNA forward primer (10 μM) synthesized by GenScript Company was used for quantitative PCR of cDNA (95 °C, 5 min; 95 °C, 10 s, 60 °C, 30 s, 40 cycles), and the reagents used were SYBR mix 10 μL, MQ primer 0.4 μL, forward primer 0.4 μL, DEPC water 7.2 μL; the differences in the expression of tsRNA in urine exosome samples of patients with lupus nephritis and patients with systemic lupus erythematosus without nephritis were detected and compared;

[0047] (6) Preparation of lupus nephritis tsRNA diagnostic kit: 2 kinds of urine exosome tsRNAs screened by sequencing and RT-qPCR were used as differential markers; the kit contains reverse transcription (10 μM) and quantitative probe (2 μM) specific for the above 2 kinds of urine exosome tsRNAs, AMV reverse transcriptase (200 U), Taq DNA polymerase (250 U), dNTP mix (10 mM), 10x RT mix (200 μL), 2x qPCR mix (1 mL), DEPC water;

[0048] (7) Data processing and analysis: all data were statistically analyzed using Excel, Graphpad prism 8.0 and SPSS 24.0 software, and the values were represented as mean ± SEMs, P <0.05 was considered to be statistically significant; when the samples between groups met the normal distribution and equal variance, t test or one-way analysis of variance was used; when the samples between groups did not meet the normal distribution, U test or non-parametric test was used.

[0049] Example 2

[0050] First, high-throughput sequencing of small RNA was performed on 24 urine exosome samples of patients with systemic lupus erythematosus without nephritis and 33 urine exosome samples of patients with lupus nephritis, and the identified tsRNAs were mainly tRF5, tRF3, tiRNA5, tiRNA3 and tRF1; screening found that 446 tsRNAs in the urine exosome samples of patients with lupus nephritis had significant differences in changes, with a change fold > 10 and P < 0.01, and the reference Figure 1shown.

[0051] According to the sequencing results, the top 10 up-regulated tsRNAs in patients with lupus nephritis were selected for analysis Figures 1-2 As shown, two tsRNAs were selected and the corresponding probes were synthesized by GenScript for detection, including tRF3-Ile-AAT-1 and tiRNA5-Lys-CTT-1.

[0052] The above two tsRNAs were further verified in 20 cases of systemic lupus erythematosus without nephritis and 20 cases of lupus nephritis by absolute quantification method, as shown in Figure 2 As shown, the specific steps are as follows:

[0053] (1) Urinary exosome extraction: Exosome precipitation kit was used to extract exosomes from 200 μL of urine sample, and Trizol method was used to further extract total RNA from exosomes;

[0054] (2) Absolute quantitative analysis: Standard samples corresponding to tsRNAs were synthesized, standard curve was drawn, tsRNAs were detected by RT-qPCR, sample CT value was obtained, and absolute concentration of target tsRNAs was converted by standard curve, selected tsRNAs included: tRF3-Ile-AAT-1 and tiRNA5-Lys-CTT-1, sequences were shown in SEQ ID No. 1 and SEQ ID No. 2.

[0055] According to the above results, the above two tsRNAs were further detected and verified in the urine exosomes of another 54 cases of systemic lupus erythematosus without nephritis and 39 cases of lupus nephritis, and the results showed that tRF3-Ile-AAT-1 and tiRNA5-Lys-CTT-1 were significantly highly expressed in the lupus nephritis group compared with the SLE without nephritis group, as shown in Figure 3 As shown.

[0056] Further analysis of the receiver operating characteristic curve (ROC curve) of tRF3-Ile-AAT-1 and tiRNA5-Lys-CTT-1 on the diagnosis of lupus nephritis showed that both tsRNAs had good discrimination value for lupus nephritis, and the diagnostic AUC was 0.777 and 0.715, respectively, as shown in Figure 3 As shown.

[0057] Further analysis of the correlation between the above two kinds of tsRNA and the clinical diagnosis index of lupus nephritis showed that tRF3-Ile-AAT-1 and tiRNA5-Lys-CTT-1 had significant correlation with the activity index of lupus nephritis, such as proteinuria, 24h-proteinuria, ALB and SLEDAI, and the results are shown in Table 2. Figure 3

[0058] Further analysis of the above two kinds of tsRNA in the actual clinical identification ability showed that tRF3-Ile-AAT-1 and tiRNA5-Lys-CTT-1 could identify LN proteinuria weak positive and non-nephritis patients, and were positively correlated with SLE-DAI score, and the results are shown in Table 3. Figure 3

[0059] It should be noted that the above content only illustrates the technical idea of the present application and cannot limit the protection scope of the present application. For ordinary skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, which fall within the scope of protection of the claims of the present application.​​

Claims

1. Use of a probe in the manufacture of a diagnostic kit for lupus nephritis, characterized in that, The probe can specifically capture the urine exosome tsRNA marker of lupus nephritis, and the sequence is shown as SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6, wherein the SEQ ID NO. 3 and the SEQ ID NO. 5 can specifically capture tRF3-Ile-AAT-1, and the SEQ ID NO. 4 and the SEQ ID NO. 6 can specifically capture tiRNA5-Lys-CTT-1; the tsRNA marker comprises any one or more of tRF3-Ile-AAT-1 and tiRNA5-Lys-CTT-1, wherein the sequence of the tRF3-Ile-AAT-1 is shown as SEQ ID NO. 1, and the sequence of the tiRNA5-Lys-CTT-1 is shown as SEQ ID NO. 2.