Use of hilnc or signaling pathways comprising same as targets for modulating lipid metabolism

Abstract

The application provides application of Hilnc (Hedgehog signal-induced long-chain non-coding RNA) or a signal pathway containing the Hilnc as a target for regulating lipid metabolism. The Hilnc plays an important role in Hh-mediated lipid metabolism. The Hh signal pathway and lipid metabolism are associated with lncRNAs for the first time in the application, which is an important progress in Hh signal transduction, lncRNAs, cell metabolism and lipid metabolism research.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology and pharmaceuticals, and more particularly, the present application relates to the application of Hilnc or the signaling pathway comprising the same as a target for regulating lipid metabolism. BACKGROUND

[0002] As one of the most important morphogens in the development of multicellular animals, the evolutionarily highly conserved Hedgehog (Hh) signal plays an important role in controlling cell proliferation and differentiation, tissue and organ development, embryonic development, morphogenesis, wound repair and regeneration, etc. In the mammalian body, the classical Hh signal transduction pathway can be simply summarized as the Hh / Ptch / Smo / Gli signal axis. It is mainly composed of extracellular Hh ligand, 12 transmembrane protein receptor molecule Patched (Ptch) on the cell membrane surface, 7 transmembrane protein Smoothened (Smo), intracellular reverse control factor Sufu protein and nuclear transcription factor Gli family protein. Among them, Hh protein is divided into Sonic hedgehog, Indian hedgehog and Desert hedgehog, and Ci / Gli family protein is divided into Gli1, Gli2 and Gli3. Gli1 and Gli2 mainly play a transcriptional activation role, and Gli3 mainly plays an inhibitory role.

[0003] The activation of the Hh signaling pathway is initiated by the external Hh ligand morphogen. Without the binding of Hh ligand, Patched 1 (PTCH1) is at least partially located on the plasma membrane, and SMO is mainly located on the membrane inside the cell. Endogenous intracellular small molecules (as GPCRs usually do) as SMO agonists are transported to the outside of the cell by PTCH1, so it cannot bind to SMO. In these cases, different kinases phosphorylate GLI2 / 3, producing a repressor form of this transcription factor (GLIR). SUFU prevents the active form of GLI (GLIA) from transactivating Hh signaling pathway downstream genes. After binding to the Hh ligand, PTCH1 is inwardly folded and exhibits significant instability, so it cannot transport the endogenous agonist molecules outward again. This allows them to accumulate inside the cell and activate SMO, and SMO itself will move to the plasma membrane and concentrate on the cilia in some types of cells. SMO then activates the Hh signaling pathway, resulting in the appearance of the activated form of GLI, which then regulates the expression of Hh target genes. In the Hh signaling pathway, the Gli family protein is the most critical transcription factor located at the end of the Hh signal transduction pathway, and the up-regulation of its activity is one of the most important markers of Hh signaling pathway activation.

[0004] Regardless of the cause of Hh signaling activation, the signal is transduced to Gli and ultimately translated into a modulation of Gli activity. Chromatin immunoprecipitation studies in neural and limb cells revealed thousands of genomic binding sites for these proteins in cells that respond to SHH signaling. Most, but not all, contain the consensus sequence GACCACCCA, similar to that bound by Ci and Gli. As expected, Gli binding was observed around the genomic regions of genes encoding core targets of the pathway, such as PTC, in cells of each tissue analyzed. More strikingly, many targets that are regulated in only one tissue also bind Gli proteins in another tissue, suggesting that Gli binding alone cannot explain the specificity of regulation. Furthermore, functional tests in the neural tube determined that Gli-bound enhancer elements act as positive regulators of gene expression, requiring SHH signaling to activate them, while other Gli-bound elements act as inhibitors of gene expression, requiring removal of Gli repressor activity for gene induction. This is consistent with the differential sensitivity of genes to the ratio of repressive versus activating Ci and Gli proteins. It is also consistent with the observation that removal of Gli3, which provides most of the transcriptional repressor activity, can restore expression of certain target genes in mouse embryos lacking SHH. Thus, some SHH target genes require positive regulation from Gli transactivators to initiate transcription, while others are activated by removal of Gli repressor proteins from enhancers. The mechanisms that determine these different responses to Gli proteins remain to be investigated.

[0005] Long non-coding RNAs (LncRNAs) are non-coding RNA molecules that do not encode proteins themselves, with a length of more than 200 nt, which play an important role in physiological and pathological processes, as important cell signaling and gene expression regulatory factors in various cell types, according to its broadest definition. At present, it is generally believed that lncRNAs have regulatory effects on gene expression at the transcriptional and post-transcriptional levels in different cellular environments and biological processes. lncRNAs can regulate the integrity of nuclear structure and can regulate the expression of adjacent genes (acting in cis in the nucleus) or other genes in the cell (acting in trans in the nucleus or cytoplasm) by interacting with proteins, RNA and DNA.

[0006] Most annotated lncRNAs are Pol II-transcribed, so they can be capped, polyadenylated, and spliced, like mRNAs. These lncRNAs are either transcribed from intergenic regions of the genome (large intergenic noncoding RNAs (lincRNAs)) or from the opposite strand of a protein-coding gene (natural antisense transcripts (NATs)). LincRNAs are by far the most abundant class of lncRNAs, comprising over 10,000 species. One major difference between these lncRNAs and mRNAs is that lncRNAs have little potential for protein coding. lncRNAs can contain fewer exons than mRNAs and often have weak cryptic splicing and polyadenylation signals. While most lincRNAs look like mRNA transcripts, many lincRNAs form their 3' ends in unusual ways, such as long noncoding RNAs processed by ribonuclease P (RNase P) at the 3' end, long noncoding RNAs with polyA excised, enhancer RNAs (eRNAs), and promoter upstream transcripts (PROMPTs), while other lincRNAs are processed from long polyadenylated precursor transcripts, such as sno-lincRNAs, circular intronic RNAs, and circular RNAs generated by reverse splicing of exons.

[0007] Genome analysis using chromatin immunoprecipitation (ChIP) and gene expression profiling revealed many predicted targets of the Hh signaling pathway and Gli proteins, most of which have been extensively studied. However, the number of known functional LncRNAs associated with Hh signaling is small. Some LncRNAs associated with Hh signaling include H19 and LncRNA-cCSC1 have been shown to play a role in Hh signaling. For example, the Hh signaling pathway induces the occurrence of osteosarcoma by regulating Yap1 expression, followed by overexpressed Yap1 inducing H19 expression. LncRNA SNHG6 regulates the Hh signaling pathway by targeting miR-26b-5p, affecting the biological function of gallbladder cancer cells. LncRNA-Hh associated with Shh-GLI1 pathway is regulated by Twist transcription, directly targeting GAS1 to stimulate the activity of Hh signaling pathway, and further enhancing the generation of cancer stem cells in Twist-positive breast cancer, etc. SUMMARY

[0008] The present application aims to provide Hilnc or signaling pathways comprising the same as targets for regulating lipid metabolism and applications thereof.

[0009] In a first aspect of the present application, there is provided a use of a Hilnc, a Gli-Hilnc-Igf2bp2-PPAR signaling pathway comprising the same, or a down-regulator thereof, for: (a) a target for modulating lipid metabolism, or for preparing a composition for modulating lipid metabolism; or (b) a target for analyzing (e.g. detecting, prognosticating, susceptibility analyzing) lipid metabolism, or for preparing a reagent for analyzing lipid metabolism; wherein the Hilnc is selected from the group consisting of: (1) an IncRNA having a nucleotide sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3; (2) a functionally equivalent IncRNA having 80% or more (e.g. 82% or more, 85% or more, 88% or more, 90% or more, 92% or more, 95% or more, 98% or more, 99% or more) sequence identity to the IncRNA of (1); or (3) an IncRNA complementary to the nucleotide sequence of the IncRNA of (1) or (2).

[0010] In one or more embodiments, the target for modulating lipid metabolism comprises a screening target for screening a substance for modulating lipid metabolism (e.g. a substance for inhibiting Hilnc, a substance for inhibiting Gli-Hilnc-Igf2bp2-PPAR signaling pathway).

[0011] In one or more embodiments, the target for analyzing lipid metabolism comprises a design target for preparing a detection reagent for analyzing lipid metabolism.

[0012] In one or more embodiments, the Hilnc further comprises a truncated or fragmented IncRNA of the nucleotide sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a functionally equivalent IncRNA having 80% or more sequence identity thereto, which has the same function as the nucleotide sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0013] In one or more embodiments, the Gli comprises Gli1, Gli2, and Gli3; preferably Gli1 and Gli2.

[0014] In one or more embodiments, the Gli is a member of Hh signaling pathway.

[0015] In one or more embodiments, the PPAR comprises PPARy.

[0016] In one or more embodiments, the modulating lipid metabolism comprises (but is not limited to) slowing down liver steatosis, resisting obesity and fatty liver, reducing de novo lipogenesis, or reducing deposition (accumulation) of fat in tissues.

[0017] In one or more embodiments, the modulating lipid metabolism is modulating lipid metabolism under high-fat environment (high-fat induction).

[0018] In one or more embodiments, the fatty liver is non-alcoholic fatty liver.

[0019] In one or more embodiments, the down-regulator of Gli-Hilnc-Igf2bp2-PPAR signaling pathway comprises: a down-regulator of Gli or a down-regulator of Hilnc; or, a down-regulator that down-regulates the interaction of Gli and Hilnc, down-regulates the interaction of Hilnc and Igf2bp2, or down-regulates the interaction of Igf2bp2 and PPAR.

[0020] In one or more embodiments, the down-regulator of Hilnc comprises: an agent that knocks out or silences Hilnc, an agent that inhibits the activity of Hilnc; preferably, comprises: an interfering molecule that specifically interferes with the expression of the coding gene of Hilnc, a CRISPR gene editing agent, a homologous recombination agent or a site-directed mutagenesis agent against Hilnc, which functionally mutates Hilnc.

[0021] In one or more embodiments, the down-regulator comprises: a down-regulator that targets the Gli binding site of the Hilnc promoter region, prevents Gli from binding thereto, preferably the Gli binding site of the Hilnc promoter region comprises (but not limited to): Hilnc promoter-660~ -652, more preferably the down-regulator is sgRNA for CRISPR gene editing agent, the nucleotide sequence is shown in SEQ ID NO: 1, 2 or 3.

[0022] In one or more embodiments, the down-regulator comprises: sgRNA for CRISPR gene editing agent targeting upstream of Hilnc, the nucleotide sequence is shown in SEQ ID NO: 5, 6 and / or 7;

[0023] In one or more embodiments, the down-regulator comprises: shRNA agent targeting Hilnc, the nucleotide sequence is shown in SEQ ID NO: 8.

[0024] In one or more embodiments, the down-regulator comprises: siRNA agent targeting Hilnc, the nucleotide sequence is shown in SEQ ID NO: 11 and / or SEQ ID NO: 12 (for mouse Hilnc); SEQ ID NO: 14 and / or SEQ ID NO: 15 (for human Hilnc).

[0025] In one or more embodiments, the Gli downregulator or Igf2bp2 downregulator includes, but is not limited to, a substance that downregulates the activity of Gli or Igf2bp2 or a substance that downregulates the expression, stability or reduces the effective action time of Gli or Igf2bp2.

[0026] In one or more embodiments, the downregulator includes, but is not limited to, a knockout or silencing agent of Gli or Igf2bp2; a binding molecule (such as an antibody or a ligand) that specifically binds to Gli or Igf2bp2; a chemical small molecule antagonist or inhibitor against Gli or Igf2bp2; or an agent that interferes with the interaction of Gli or Igf2bp2 and an effector molecule.

[0027] In one or more embodiments, the knockout or silencing agent of Gli or Igf2bp2 includes, but is not limited to, a CRISPR gene editing agent against Gli or Igf2bp2, an interfering molecule that specifically interferes with the expression of the coding gene of Gli or Igf2bp2, a homologous recombination agent or a site-directed mutation agent against Gli or Igf2bp2, which performs a loss-of-function mutation on Gli or Igf2bp2.

[0028] In one or more embodiments, the downregulator includes an shRNA agent targeting Igf2bp2, the nucleotide sequence of which is shown as SEQ ID NO: 9; an shRNA agent targeting Pparγ, the nucleotide sequence of which is shown as SEQ ID NO: 10.

[0029] In one or more embodiments, the interfering molecule includes siRNA, shRNA, miRNA, antisense nucleic acid, etc., or a construct capable of forming the siRNA, shRNA, miRNA, antisense nucleic acid, etc.

[0030] In one or more embodiments, the downregulation includes weakening, weakening, reducing or inhibiting, which generally means significant downregulation, weakening, weakening, reducing or inhibition, such as 20%, 40%, 60%, 80%, 90% or less downregulation, weakening, weakening, reducing or inhibition.

[0031] In one or more embodiments, Hilnc interacts with Igf2bp2 at positions 535-650.

[0032] In another aspect of the present application, there is provided an isolated lncRNA, which is a Hilnc selected from the group consisting of: (1) an lncRNA having a nucleotide sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3; or, (2) an lncRNA complementary to the nucleotide sequence of the lncRNA of (1); optionally, the lncRNA includes a promoter region thereof.

[0033] In one or more embodiments, the SEQ ID NO: 1 is derived from a mouse.

[0034] In one or more embodiments, the SEQ ID NO: 2 is derived from a mouse.

[0035] In one or more embodiments, the SEQ ID NO: 3 is derived from a human.

[0036] In one or more embodiments, the isolated lncRNA further includes a homolog of the sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3; preferably, an lncRNA sequence having the same function and / or having sequence identity with the nucleotide sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, which is derived from a species other than mouse or human in mouse or human.

[0037] In one or more embodiments, the promoter region of the lncRNA is a region upstream -1 to -3000 base pairs (bp / nt) thereof; for example, but not limited to, a region upstream -1 to -2500, a region upstream -1 to -2000, a region upstream -1 to -1500, a region upstream -1 to -1000, a region upstream -1 to -800, a region upstream -1 to -600, a region upstream -1 to -500, a region upstream -1 to -300, etc.

[0038] In another aspect of the present application, there is provided an expression vector or a host cell containing the same, which contains the isolated lncRNA.

[0039] In another aspect of the present application, there is provided a use of a reagent specifically recognizing or amplifying Hilnc for preparing a reagent or a kit for analyzing (e.g., detecting, prognosing, susceptibility analyzing) lipid metabolism; preferably, the reagent includes (but not limited to) a primer specifically amplifying Hilnc; a probe specifically recognizing Hilnc; or, a chip specifically recognizing Hilnc; wherein the Hilnc is selected from the group consisting of: (1) an IncRNA having a nucleotide sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3; or (2) an IncRNA complementary to the nucleotide sequence of the IncRNA of (1).

[0040] In another aspect of the present application, there is provided a composition or a kit for regulating lipid metabolism, comprising: a down-regulator of Gli-Hilnc-Igf2bp2-PPAR signaling pathway and / or a down-regulator of Hilnc.

[0041] In another aspect of the present application, there is provided a method for screening a substance (including a potential substance) for regulating lipid metabolism, comprising: (1) adding a candidate substance to a system expressing Hilnc; (2) detecting the system, observing the expression of Hilnc therein, and if the expression is inhibited, indicating that the candidate substance is a substance for regulating lipid metabolism, preferably, resisting obesity and fatty liver, reducing de novo lipogenesis, or reducing the deposition (accumulation) of fat in tissues.

[0042] In another aspect of the present application, there is provided a method for screening a substance (including a potential substance) for regulating lipid metabolism, comprising: (i) adding a candidate substance to a system expressing Gli-Hilnc-Igf2bp2-PPAR signaling pathway; (ii) detecting the system, observing the expression or activity of Gli-Hilnc-Igf2bp2-PPAR signaling pathway proteins therein, and if the expression or activity of Gli, Igf2bp2 or PPAR is inhibited, or the interaction of Gli with Hilnc, the interaction of Hilnc with Igf2bp2, or the interaction of Igf2bp2 with PPAR is down-regulated, indicating that the candidate substance is a substance for regulating lipid metabolism, preferably, resisting obesity and fatty liver, reducing de novo lipogenesis, or reducing the deposition (accumulation) of fat in tissues.

[0043] In one or more embodiments, further comprising setting a control group, so as to clearly distinguish the difference of Hilnc expression in the test group from that of the control group, or clearly distinguish the difference of Gli, Igf2bp2 or PPAR expression or activity in the test group from that of the control group.

[0044] In one or more embodiments, the low expression or low activity, the expression or activity is inhibited, refers to statistically significant reduction of expression or activity compared to the average expression or activity of the corresponding gene / protein in the same kind or species of organism.

[0045] In one or more embodiments, the candidate substance includes (but not limited to): regulatory molecules (such as up-regulators, small molecule compound gene editing constructs) designed for Hilnc, or for Gli, Igf2bp2 or PPAR protein or its encoding gene or their upstream or downstream proteins or genes, etc., and also can be randomly database / synthetic compound library etc. source

[0046] In one or more embodiments, the system is selected from: cell system (such as cells or cell culture expressing Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathway), subcellular (culture) system, solution system, tissue system, organ system or animal system.

[0047] In one or more embodiments, the cell includes but not limited to: murine cell such as NIH-3T3 cell, human cell such as HL7702, etc.

[0048] In one or more embodiments, the method further comprises: performing further cell experiment and / or animal experiment on the obtained potential substance, to further select and determine the substance useful for regulating lipid metabolism from the candidate substance.

[0049] Other aspects of the present application will be apparent to those skilled in the art from consideration of the disclosure herein. BRIEF DESCRIPTION OF DRAWINGS

[0050] Figure 1 lncRNAs up-regulated in SAG and SHH treated NIH-3T3 cells.

[0051] A, Volcano plot showing differentially expressed (DE) lncRNAs in NIH-3T3 cells after 24 hours of SAG (200 nM, left) and SHH (1 pg / ml, right) treatment, as discovered by RNA sequencing analysis.

[0052] B, Venn diagram showing commonly up-regulated lncRNAs in NIH-3T3 cells after SAG and SHH treatment.

[0053] C, Heatmap showing 29 lncRNAs that are co-upregulated by at least 2-fold in NIH-3T3 cells after SAG and SHH treatment. The arrow in the figure indicates GM16364 (Hilnc). This heatmap is plotted based on the normalized expression values of these lncRNAs in the figure.

[0054] Figure 2 , Characterization of Hilnc.

[0055] A, Rapid amplification of cDNA ends (3'- and 5'-RACE) experiments show that the two isoforms of Hilnc share one transcription start site (primer using 5' cap), but have two different transcription stop sites (primer using 3'). The upper panel shows the two isoforms of Hilnc.

[0056] B, Real-time quantitative PCR using primers specific for the two isoforms of Hilnc shows that Hilnc is mainly in the form of isoform 1 in NIH-3T3 cells.

[0057] C, This schematic shows the specific location of Hilnc on the mouse genome (chr10:39432067-39489678).

[0058] D, Nucleo-cytoplasmic fractionation experiments followed by immunoblotting and real-time quantitative PCR experiments in NIH-3T3 cells show that most of the Hilnc transcripts are located in the cytoplasm. For the immunoblotting experiment, β-tubulin was used as a cytoplasmic control, and histone H3 as a nucleolar control. For the quantitative PCR experiment, Gapdh was used as a cytoplasmic control, and U6 as a nucleolar control.

[0059] Figure 3 , Hh signaling pathway regulates the expression level of Hilnc through Gli.

[0060] A, Relative expression levels of Hilnc and Gli1 in NIH-3T3 cells after SAG and SHH treatment. Their relative expression levels were normalized to the expression level of 18sRNA.

[0061] B, RNA-FISH experiment for Hilnc in NIH-3T3 cells shows that Hilnc is mainly present in the cytoplasm, and SAG treatment upregulates the expression of Hilnc in NIH-3T3 cells. The sense full-length Hilnc transcript labeled with digoxigenin was used as the RNA probe, and the antisense Hilnc transcript labeled with digoxigenin was used as the control. The RNA signal is shown in red, and the DAPI staining is shown in blue.

[0062] C, Relative expression of Hilnc and Gli1 in NIH-3T3 cells treated with SAG, GANT61 (10 μΜ) or SAG and GANT61 together.

[0063] Figure 4 , Gli regulates the expression level of Hilnc through Gli binding sites in the Hilnc promoter region.

[0064] A, A schematic diagram introducing Hilnc promoter region containing wild type Gli binding sites (WT), randomly mutated Gli binding sites (Mut) and deleted Gli binding sites (Del).

[0065] B, pGL3 reporter plasmids containing different types of Hilnc promoter region in A were co-transfected with Gli1, Gli2 and Gli3 expression plasmids, and luciferase activity was measured. The results showed that overexpression of Gli1 or Gli2 significantly increased luciferase activity in reporter plasmids with wild type Gli binding sites, but failed to induce luciferase activity in reporter plasmids with mutated or deleted Gli binding sites.

[0066] C, pGL3 reporter plasmids containing different types of Hilnc promoter region in A were co-transfected with different concentrations of Gli1 expression plasmids, and luciferase activity was measured. The results showed that Gli1 could increase luciferase activity in reporter plasmids with wild type Gli binding sites in a dose-dependent manner.

[0067] D, After transfecting NIH-3T3 cells with Flag-Gli1 and Flag-Gli2 for 24 hours, protein-bound chromatin was immunoprecipitated with anti-Flag antibody, and IgG was used as a control. The immunoprecipitated DNA was analyzed by real-time PCR using specific primers against the Hilnc promoter. Finally, chromatin immunoprecipitation (ChIP) results showed that Gli1 / Gli2 was enriched in the promoter region of Hilnc.

[0068] E, Real-time PCR experiment showed the relative expression of Hilnc and Gli1 in 3T3-BM (Gli binding site mutation) cells after SAG treatment. In 3T3-BM cells, SAG can induce the expression of Gli1, but failed to induce Hilnc expression.

[0069] Figure 5 , Expression of Hilnc in different mouse tissues under normal diet and high-fat diet.

[0070] A, Relative expression of the two Hilnc isoforms in different mouse tissues was determined by quantitative PCR experiments. Expression levels were normalized to 18s RNA levels. Their relative expression levels were normalized to the expression level of 18s RNA.

[0071] B, Relative expression of Hilnc, Gli1 and Ptchl in the liver of 22-week-old wild-type mice fed with normal diet or high-fat diet for 16 weeks was determined by quantitative PCR experiments.

[0072] C, Relative expression of Hilnc, Gli1 and Ptchl in the muscle tissue of 22-week-old wild-type mice fed with normal diet or high-fat diet for 16 weeks was determined by quantitative PCR experiments.

[0073] D, Relative expression of Hilnc, Gli1 and Ptchl in the white adipose tissue of 22-week-old wild-type mice fed with normal diet or high-fat diet for 16 weeks was determined by quantitative PCR experiments.

[0074] E, Relative expression of Hilnc, Gli1 and Ptchl in the brown adipose tissue of 22-week-old wild-type mice fed with normal diet or high-fat diet for 16 weeks was determined by quantitative PCR experiments.

[0075] Figure 6 Hilnc - / - and Hilnc BM / BM Construction of transgenic mice.

[0076] A, Schematic representation of the construction of Hilnc - / - and Hilnc BM / BM transgenic mice.

[0077] B, Genotype of Hilnc - / - and Hilnc BM / BM transgenic mice was confirmed by PCR experiments using specific primers for these transgenic mice.

[0078] C, Relative expression of Hilnc and Gli1 in the embryonic fibroblasts of Hilnc - / - and Hilnc BM / BM transgenic mice was determined by quantitative PCR experiments.

[0079] D, Relative expression of Hilnc and Gli1 in the liver tissue of Hilnc - / - and Hilnc BM / BM transgenic mice was determined by quantitative PCR experiments.

[0080] E. Quantitative real-time PCR was used to determine the levels of Hilnc in 22-week-old infants fed a normal or high-fat diet for 16 weeks. BM / BM The relative expression levels of Hilnc, Gli1, and Ptch1 in mouse liver tissue.

[0081] Figure 7 Hilnc - / - and Hilnc BM / BM Characterization of transgenic mice.

[0082] A. Representative images of 8-week-old WT, Hilnc- / -, or HilncBM / BM male mice.

[0083] B. 8-week-old WT, Hilnc - / - or Hilnc BM / BM Body weight of male mice. No significant differences were observed.

[0084] C. Representative images of 22-week-old male WT and HilncBM / BM mice on a high-fat diet for 16 weeks.

[0085] D. Growth curves of wild-type and HilncBM / BM mice under normal and high-fat diets, respectively. There was no difference in body weight between wild-type and HilncBM / BM mice on a normal diet at any age. Wild-type and HilncBM / BM mice were fed HFD (indicated by arrows) from 6 weeks of age. Initially, there was no difference in body weight, but from 12 weeks of age onwards, the body weight of wild-type mice increased significantly (n=5).

[0086] E. Representative images of 22-week-old WT and Hilnc- / - male mice on a high-fat diet for 16 weeks.

[0087] Growth curves of F, wild-type, and Hilnc- / - mice under normal and high-fat diets, respectively. There was no difference in body weight between wild-type and Hilnc- / - mice on a normal diet at any age. Wild-type and Hilnc- / - mice were fed HFD (indicated by arrows) from 6 weeks of age. Initially, there was no difference in body weight, but from 10 weeks of age onwards, the body weight of wild-type mice increased significantly (n=5).

[0088] Figure 8 Wild type and Hilnc BM / BM Glucose tolerance and insulin tolerance tests in mice.

[0089] A. Glucose tolerance test. After fasting for 14 hours, 10-week-old wild-type and HilncBM / BM male mice on a normal diet were intraperitoneally injected with 1 g / kg glucose (n=4).

[0090] B. Insulin Tolerance Test. After a 5-hour fast, 10-week-old wild-type and Hilnc-type infants on a normal diet... BM / BM Male mice were intraperitoneally injected with 0.4 U / kg insulin (n=4).

[0091] C. Glucose tolerance test. After fasting for 14 hours, 12-week-old wild-type and HilncBM / BM male mice that had been on a high-fat diet for 6 weeks were intraperitoneally injected with 1 g / kg glucose (n=6).

[0092] D. Insulin tolerance test. After fasting for 5 hours, 12-week-old wild-type and Hilnc-type infants on a high-fat diet for 6 weeks were... BM / BM Male mice were injected intraperitoneally with 0.4 U / kg insulin (n=6).

[0093] Figure 9 Wild type and Hilnc BM / BM The study included the mice's food intake, fecal fat content, activity level, respiratory exchange rate, and energy expenditure.

[0094] A. Food intake of 14-week-old wild-type and HilncBM / BM male mice on a normal diet (left, n=4) and a high-fat diet (right, n=6).

[0095] B. Fecal weight of 14-week-old wild-type and HilncBM / BM male mice on a high-fat diet (n=6).

[0096] C. Triglyceride content in feces of 14-week-old wild-type and HilncBM / BM male mice on a high-fat diet (n=6).

[0097] D. Activity levels of 14-week-old wild-type and HilncBM / BM male mice on a normal diet (left, n=4) and a high-fat diet (right, n=6).

[0098] E. Respiratory exchange rate of 14-week-old wild-type and HilncBM / BM male mice on normal diet (left, n=4) and high-fat diet (right, n=6).

[0099] F. Energy expenditure of 14-week-old wild-type and HilncBM / BM male mice on normal diet (left, n=4) and high-fat diet (right, n=6).

[0100] Figure 10 Hilnc BM / BM and Hilnc - / - Mice were resistant to high-fat-induced obesity and fatty liver.

[0101] A. Representative image of white abdominal fat in 22-week-old wild-type and HilncBM / BM mice fed a high-fat diet for 16 weeks.

[0102] B. H&E staining images of white abdominal fat in 22-week-old wild-type and HilncBM / BM mice on a normal diet (left) and a high-fat diet (right) at 16 weeks; scale bar, 50 μm.

[0103] C. Representative images (left) and liver weight (right, n=5) of 22-week-old wild-type and HilncBM / BM mice fed a high-fat diet for 16 weeks.

[0104] D. Images of liver sections from 22-week-old wild-type and HilncBM / BM mice on a normal diet, stained with H&E and Oil Red O; scale bar, 50 μm.

[0105] E. Images of liver sections from 22-week-old wild-type and HilncBM / BM mice on a high-fat diet for 16 weeks, stained with H&E and Oil Red O; scale bar, 50 μm.

[0106] F. Determination of triglyceride levels in the livers of 22-week-old wild-type and HilncBM / BM mice on normal and high-fat diets for 16 weeks (n=6).

[0107] G. Representative images of abdominal white fat and liver in 22-week-old wild-type and Hilnc- / - mice fed a high-fat diet for 16 weeks.

[0108] H, H&E staining and Oil Red O staining images of the livers of 22-week-old wild-type and Hilnc- / - mice fed a high-fat diet for 16 weeks; scale bar, 50 μm.

[0109] I. Determination of liver fat synthesis capacity in wild-type and HilncBM / BM mice.

[0110] Figure 11 The absence of Hilnc reduces lipid accumulation in primary hepatocytes.

[0111] A. Oil Red O staining images of primary hepatocytes isolated from wild-type and HilncBM / BM mice after treatment with 0.5 mM oleic acid (OA) for 24 hours; scale bar, 100 μm (top), 50 μm (bottom).

[0112] B. Determination of intracellular triglyceride levels in primary hepatocytes isolated from wild-type and HilncBM / BM mice after treatment with 0.5 mM oleic acid (OA) for 24 hours.

[0113] C. Body weight of 12-week-old wild-type and HilncBM / BM male mice fed with MCD for one month (n=5).

[0114] D. Images of liver sections from 12-week-old wild-type and HilncBM / BM mice fed with MCD for one month, stained with H&E and Oil Red O; scale bar, 50 μm.

[0115] Determination of triglyceride levels in the livers of 12-week-old wild-type and HilncBM / BM mice fed with E and MCD for one month.

[0116] Figure 12 The absence of Hilnc can resist high-fat-induced hepatic steatosis.

[0117] A. Six-week-old male WT mice were injected with adenovirus sh-Control or sh-Hilnc via the tail vein, followed by a high-fat diet for 10 weeks. The mice were then treated and tested.

[0118] B. Quantitative real-time PCR experiments showed successful inhibition of endogenous Hilnc expression in mouse liver.

[0119] C. Body weight of control mice and Hilnc gene-suppressed mice under a high-fat diet for 10 weeks (n=5).

[0120] D. Energy expenditure measurement of control group and Hilnc gene-suppressed mice under high-fat diet for 10 weeks (n=5).

[0121] E. Determination of glucose tolerance in control mice and Hilnc gene-suppressed mice on a high-fat diet for 10 weeks (n=5).

[0122] F. Immunofluorescence (ZsGreen), H&E, and Oil Red O staining images of liver sections from control mice on a high-fat diet and Hilnc gene-suppressed mice; scale bar, 100 μm (top), 50 μm (middle and bottom).

[0123] G. Determination of triglyceride content in the liver of control mice on a high-fat diet and Hilnc gene-suppressed mice.

[0124] H. Oil Red O staining images of primary hepatocytes isolated from control and Hilnc gene-suppressed mice after treatment with 0.5 mM oleic acid (OA) for 24 hours; scale bar, 100 μm (top), 50 μm (bottom).

[0125] I. Determination of intracellular triglyceride content in primary hepatocytes isolated from control group and Hilnc gene-suppressed mice after treatment with 0.5 mM oleic acid (OA) for 24 hours.

[0126] Figure 13 Hilnc - / - Overexpression of Hilnc in mouse liver can increase hepatic lipid accumulation.

[0127] A. Injecting via tail vein into 6-week-old Hilnc - / - Male mice were injected with adenovirus AAV-Control or O / E-Hilnc, followed by a high-fat diet for 12 weeks, and then the mice were treated for testing.

[0128] B. Quantitative real-time PCR experiments showed that Hilnc - / - Successful overexpression of endogenous Hilnc in mouse liver.

[0129] C. Wild-type mice fed a high-fat diet for 12 weeks, Hilnc - / - Immunofluorescence (ZsGreen) staining, H&E staining, and Oil Red O staining images of liver sections from control mice and Hilnc gene overexpressing mice; scale bar, 100 μm (top), 50 μm (middle and bottom).

[0130] D. Hilnc on a high-fat diet for 10 weeks - / - Body weight of control mice and Hilnc gene overexpression mice (n=5).

[0131] E. Hilnc under a high-fat diet for 10 weeks - / - Energy expenditure was measured in control mice and mice overexpressing the Hilnc gene (n=5).

[0132] F. Hilnc under a high-fat diet for 10 weeks - / - Glucose tolerance was measured in control mice and Hilnc gene overexpression mice (n=5).

[0133] G. Wild-type mice on a high-fat diet for 12 weeks, Hilnc - / - Triglyceride content in the liver of control mice and Hilnc gene overexpression mice was measured (n=5).

[0134] H, Hilnc under a high-fat diet for 12 weeks - / - Representative images (top) and liver weight (bottom, n=5) of the livers of control mice and Hilnc gene overexpression mice.

[0135] I, from Hilnc - / - Oil Red O staining images and intracellular triglyceride content determination of primary hepatocytes isolated from control mice and Hilnc gene overexpression mice after treatment with 0.5 mM oleic acid (OA) for 24 hours.

[0136] Figure 14 Wild-type and Hilnc under normal or high-fat diets BM / BM Gene expression levels in mouse liver.

[0137] A. Based on data obtained from RNA-seq experiments, volcano plots show gene changes in the livers of 22-week-old HilncBM / BM mice fed a high-fat diet for 16 weeks compared to wild-type mice.

[0138] B. Based on data obtained from RNA-seq experiments, volcano plots show gene changes in the livers of 22-week-old HilncBM / BM mice on a normal diet and wild-type mice.

[0139] C. The figure shows the results of KEGG signaling pathway enrichment analysis of the genes that changed in the livers of 22-week-old HilncBM / BM mice and wild-type mice under normal diet.

[0140] D. The figure shows the results of KEGG signaling pathway enrichment analysis of significantly upregulated genes in the livers of 22-week-old HilncBM / BM mice fed a high-fat diet for 16 weeks.

[0141] E. The figure shows the results of KEGG signaling pathway enrichment analysis of genes that were significantly downregulated in the livers of 22-week-old HilncBM / BM mice fed a high-fat diet for 16 weeks.

[0142] Figure 15 The absence of Hilnc can affect the PPAR signaling pathway in the liver.

[0143] A. The heatmap shows the gene changes in the livers of wild-type mice and HilncBM / BM mice on a high-fat diet enriched in the downregulated KEGG signaling pathway.

[0144] B. Quantitative real-time PCR experiments revealed a series of downregulated PPAR signaling pathway-related genes in the livers of HilncBM / BM mice on a high-fat diet compared to wild-type mice on a high-fat diet.

[0145] C. Immunoblotting experiments confirmed that, compared with wild-type mice on a high-fat diet, the levels of key genes and proteins in the PPAR signaling pathway were downregulated in the livers of a series of high-fat HilncBM / BM mice.

[0146] D. Immunoblotting experiments showed the protein levels of the Pparγ gene in the livers of wild-type mice and HilncBM / BM mice under normal diets.

[0147] E. Quantitative real-time PCR experiments showed that overexpression of Hilnc in Hilnc- / - liver restored the expression of Pparγ and other genes related to the PPAR signaling pathway.

[0148] Figure 16 The absence of Pparγ can resist high-fat-induced hepatic steatosis.

[0149] A. Six-week-old male WT mice were injected with adenovirus sh-Control or sh-Pparγ via the tail vein, followed by a high-fat diet for 10 weeks. The mice were then treated and tested.

[0150] B. Quantitative real-time PCR experiments showed successful inhibition of endogenous Pparγ expression in mouse liver.

[0151] C. Immunofluorescence (ZsGreen), H&E, and Oil Red O staining images of liver sections from control mice and Pparγ gene-inhibited mice on a high-fat diet; scale bar, 100 μm (top), 50 μm (middle and bottom).

[0152] D. Determination of triglyceride content in the liver of control mice and Pparγ gene-suppressed mice under high-fat diet (n=5).

[0153] E. Quantitative real-time PCR experiments showed the mRNA levels of Pparγ and Fapp1 in AML12 cells with siRNA-mediated Hilnc expression inhibition after treatment with 0.5 mM oleic acid and in the control group.

[0154] Figure 17 Hilnc can bind directly to Igf2bp2.

[0155] A. The location of Hilnc (red) and its nearby coding genes (blue) Traf3ip2 and Fyn on mouse chromosome 10.

[0156] B. mRNA (left) and protein levels (right) of Traf3ip2 and Fyn in the livers of wild-type mice and Hilnc- / - mice.

[0157] C. mRNA (left) and protein levels (right) of Traf3ip2 and Fyn in the livers of wild-type mice and HilncBM / BM mice.

[0158] D. Igf2bp2 is a protein that can interact with Hilnc. Biotin-labeled positive Hilnc transcripts, a blank control, an intron control (Ctr-1), and an antisense Hilnc transcript (Ctr-2) were co-incubated with lysates of AML12 cells, and the enriched products were eluted and separated by SDS-PAGE and silver staining. Differentially expressed protein bands in the positive Hilnc transcripts were analyzed by mass spectrometry. Arrows indicate the location of Igf2bp2.

[0159] E. RNA Pulldown and Western blotting experiments showed that Hilnc interacts with Igf2bp2. Biotin-labeled sense Hilnc transcripts and controls (including intron controls (Ctr-1) and antisense Hilnc (Ctr-2)) were added to AML12 cell lysates, and RNA Pulldown and Western blotting experiments were performed.

[0160] F. RNA immunoprecipitation assays showed that Igf2bp2 could enrich Hilnc in AML12 cell lysis products. Igf2 mRNA served as a positive control, and Actb mRNA served as a negative control.

[0161] G and RNA immunoprecipitation experiments showed that the 525–650 nt region of Hilnc is very important for its interaction with Igf2bp2.

[0162] Figure 18 Hilnc can function through Igf2bp2.

[0163] A. Six-week-old male WT mice were injected with adenovirus sh-Control or sh-Igf2bp2 via the tail vein, followed by a high-fat diet for 10 weeks. The mice were then treated and tested.

[0164] B. Immunofluorescence (ZsGreen) staining, H&E staining, and Oil Red O staining images of liver sections from control mice on a high-fat diet and Igf2bp2 gene-suppressed mice; scale bar, 100 μm (top), 50 μm (middle and bottom).

[0165] C. Determination of triglyceride content in the liver of control mice and Igf2bp2 gene-suppressed mice under high-fat diet (n=5).

[0166] D. Quantitative real-time PCR experiments showed the mRNA levels of Igf2bp2, Hilnc, Pparγ, and the downstream gene Fabp1 of Pparγ in the livers of control group and Igf2bp2 knockout mice.

[0167] E. Immunoblotting experiments showed the protein levels of Igf2bp2, Pparγ, and the downstream gene Fabp1 of Pparγ in the livers of control and Igf2bp2 knockout mice.

[0168] F. Oil Red O staining images of primary hepatocytes isolated from the livers of oleic acid-treated control mice or mice with inhibited Igf2bp2 expression after transfection with empty plasmid (NC), siRNA-Hilnc (KD-Hilnc), pcDNA4.1-Hilnc (O / E-Hilnc), or pcDNA4.1-Flag-Pparγ (O / E-Pparγ); scale bar, 100 μm (top) and 50 μm (bottom).

[0169] G. Measurement of intracellular triglyceride levels in primary hepatocytes isolated from the livers of control and Igf2bp2 expression-inhibited mice after transfection with the corresponding plasmid and treatment with oleic acid.

[0170] H. Quantitative real-time PCR experiments verified the transfection efficiency of plasmids isolated from the livers of control and Igf2bp2 gene-inhibited mice.

[0171] I. RNA immunoprecipitation assays showed mRNA enriched from IgG control and IGF2BP2 antibody immunoprecipitation samples from liver lysates of wild-type mice, Hilnc- / - mice, and Hilnc- / - (O / E-Hilnc) mice.

[0172] Figure 19 The location of Hilnc in the mouse genome and the corresponding human genome.

[0173] A. The location of Hilnc on chromosome 10 of the mouse genome.

[0174] B. The relative position of Hilnc in the human genome.

[0175] Figure 20 The discovery of ENST0000417084.1(h-Hilnc).

[0176] A. GO enrichment analysis of genes in LO2 cells after oleic acid treatment.

[0177] B. Volcano diagrams show the altered genes in LO2 cells treated with oleic acid.

[0178] C. The heatmap shows 20 lncRNAs upregulated in LO2 cells treated with oleic acid, with predicted Gli binding sites near their TSS. This heatmap was drawn based on the normalized expression levels of these lncRNAs in the figure.

[0179] D. Quantitative real-time PCR experiments showed upregulation of 14 lncRNAs and PPARγ, PLIN2 and GLI1 in LO2 cells treated with oleic acid.

[0180] E. Oil Red O staining experiments showed that inhibiting the expression of ENST0000450804.3 and ENST0000417084.1 reduced lipid accumulation in oleic acid-treated LO2 cells; scale bar, 100 μm (top), 50 μm (bottom).

[0181] F. By measuring intracellular triglyceride content, inhibiting the expression of ENST0000450804.3 and ENST0000417084.1 can reduce the triglyceride content in LO2 cells treated with oleic acid.

[0182] G. Quantitative real-time PCR experiments showed the knockout efficiency of ENST0000450804.3 and ENST0000417084.1 and the relative expression level of PPARγ based on them.

[0183] Figure 21 Features and functions of ENST0000417084.1(h-Hilnc).

[0184] A. Rapid amplification of cDNA ends (3'- and 5'-RACE) experiments showed that a transcription start site ENST0000417084.1 (h-Hilnc) was identified using 5'RACE primers, and a transcription termination site was identified using 3'RACE primers.

[0185] B. This figure shows the location of ENST0000417084.1(h-Hilnc) in the human genome.

[0186] C. This figure shows the full-length sequence of ENST0000417084.1(h-Hilnc).

[0187] D. RNA immunoprecipitation assays showed that h-Hilnc was enriched in the IGF2BP2 antibody immunoprecipitation complex in LO2 cell lysis products. IGF2 mRNA served as a positive control, and FASN mRNA served as a negative control.

[0188] E. RNA immunoprecipitation experiments showed that inhibiting the expression of h-Hilnc could reduce the binding of IGF2BP2 to PPARγ mRNA, while inhibiting the expression of ENST0000450804.3 could not.

[0189] F and GANT61 can reduce the expression of h-Hilnc and GLI1 in LO2 cells treated with oleic acid.

[0190] G. Luciferase activity reporter analysis showed that overexpression of GLI1 significantly increased luciferase activity in the pGL3 reporter plasmid containing the h-Hilnc promoter region of the wild-type Gli binding site, but could not induce enhanced luciferase activity in reporter plasmids with mutations in the Gli binding site.

[0191] H. Chromatin immunoprecipitation (ChIP) results showed that GLI was enriched in the promoter region of h-Hilnc. Twenty-four hours after transfecting LO2 cells with Flag-GLI1, chromatin was immunoprecipitated using anti-Flag antibody, with IgG as a control. Immunoprecipitated DNA was analyzed by quantitative real-time PCR using primers targeting the PTCH1 promoter (containing a Gli binding site), the h-Hilnc promoter (containing a Gli binding site), and the h-Hilnc promoter Ctr (lacking a Gli binding site). Detailed Implementation

[0192] In this field, no LncRNAs directly regulated by the Hh signaling pathway have been reported, their functions and modes of action remain unclear, and there is a lack of research involving both Hh and LncRNAs in relation to obesity and lipid metabolism. This invention, for the first time, reveals a novel long non-coding RNA (LncRNA) Hilnc (Hedgehog-inducible long noncoding RNA), and discloses the Gli-Hilnc-Igf2bp2-PPAR signaling pathway containing Hilnc and its application in lipid regulation.

[0193] Hilnc

[0194] In this study, a novel lncRNA directly regulated by the Hh signaling pathway and regulated through the Gli binding site in the promoter region was obtained, exhibiting significant biological functions in obesity and lipid metabolism. This invention combines high-fat-induced animal models, transgenic animals, and methods from molecular biology, cell biology, bioinformatics, and chemical biology to elucidate the molecular regulatory mechanism and biological function of the Hh signaling pathway-directly induced lncRNA (Hilnc) in lipid metabolism, providing new theoretical support for revealing the mechanisms of lipid metabolism in key metabolic tissues. Simultaneously, this invention also identified a human Hilnc, which is functionally conserved with the mouse Hilnc, further confirming its influence on lipid metabolism. These findings provide a theoretical basis for the treatment of lipid metabolism (e.g., obesity and non-alcoholic fatty liver disease) and the discovery of new potential drug targets.

[0195] As used in this invention, "isolated" means that a substance has been separated from its original environment (or, if the substance is native, the native environment is the natural environment). For example, polynucleotides and polypeptides in their native state within living cells are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances present in their native state.

[0196] As used in this invention, "non-coding RNAs" refers to RNA that does not encode proteins. The human genome is predominantly composed of non-coding RNAs, which are functional RNA molecules that cannot be translated into proteins. These non-coding RNAs are widely involved in human physiological and pathological activities and are closely related to many tumors. Based on their size, non-coding RNAs with regulatory functions are mainly divided into two categories: short non-coding RNAs (including siRNA, miRNA, and piRNA) and long non-coding RNAs (LncRNAs).

[0197] As used in this invention, "lncRNA" refers to long non-coding RNAs (lncRNAs), a class of RNAs longer than 200 nucleotides that do not encode proteins. The terms "lncRNA," "long non-coding RNA," and "long non-coding RNA" are used interchangeably. Many lncRNAs appear only at specific developmental stages, exhibiting tissue or cell specificity. lncRNAs can regulate associated protein-coding genes at different levels through various mechanisms, participating in the induction of diseases.

[0198] As used in this invention, a "promoter" or "promoter region" refers to a nucleic acid sequence that is typically located upstream (5' end) of the coding sequence of a target gene and is capable of guiding the transcription of the nucleic acid sequence into mRNA. Generally, a promoter or promoter region provides recognition sites for RNA polymerase and other factors necessary for proper transcription initiation. In this invention, the promoter or promoter region includes isofunctional variants of the promoter (e.g., isofunctional variants formed by mutating the non-Gli binding site of the Hilnc promoter described in this invention), which are obtained through insertion or deletion of regulatory regions, random or site-directed mutagenesis, etc.

[0199] As used in this invention, unless otherwise specified, Hilnc refers to an LncRNA having the sequence SEQ ID NO:1, 2 or 3, and also includes sequence variants having the same function as Hilnc, fragments or truncated versions thereof, and homologs thereof in other species.

[0200] Hybridization of polynucleotides is a technique well known to those skilled in the art, and the hybridization characteristics of a specific pair of nucleic acids indicate their similarity or identity. Therefore, this invention also relates to polynucleotides that hybridize with the aforementioned specified nucleotide sequences (such as SEQ ID NO: 1, 2, or 3) and have at least 60%, preferably at least 70%, more preferably at least 80% (e.g., 85%, 90%, 95%, or 99%) identity between the two sequences. This invention particularly relates to polynucleotides that hybridize with the polynucleotides described herein (such as SEQ ID NO: 1, 2, or 3) under stringent conditions.

[0201] The present invention also includes nucleic acids having 60% or more (preferably 70% or more, 80% or more, more preferably 90% or more, most preferably 95% or more, such as 98% or 99%) identity with the Hilnc (including h-Hilnc) sequence (such as SEQ ID NO: 1, 2 or 3) of the present invention, said nucleic acid also having the same function as Hilnc demonstrated in the embodiments of the present invention. "Identity" refers to the level of similarity (i.e., sequence homology, similarity or identity) between two or more nucleic acids according to the percentage of positions they are in.

[0202] The lncRNA of the present invention may contain a promoter, for example, the promoter region of the lncRNA is a region upstream of it ranging from -1 to -3000 bases (bp / nt). The promoter typically has the following characteristics: (a) it is isolated upstream of the lncRNA; (b) it has a base length of 200-3000; and (c) it has the necessary sites for initiating transcription and a transcription start site.

[0203] It should be understood that although the examples of this invention provide the LncRNA derived from mice or humans and its function, LncRNAs derived from other similar species that have certain similarities (conservation) with the LncRNA are also included within the scope of this invention, provided that a person skilled in the art can isolate the LncRNA from other organisms based on the information provided in this application after reading it. That is, in this invention, "Hilnc" also includes its homologs.

[0204] Vectors containing the LncRNA described in this invention, and host cells genetically engineered using said vectors, are also included in this invention. Methods well known to those skilled in the art can be used to construct suitable expression vectors.

[0205] Gli-Hilnc-Igf2bp2-PPAR signaling pathway

[0206] As one of the most important morphogens in the development of multicellular animals, the highly conserved Hedgehog (Hh) signaling pathway plays a crucial role in controlling cell proliferation and differentiation, embryogenesis, morphogenesis, and tissue and organ development. In mammals, the classic Hh signaling pathway can be concisely summarized as the Hh / Ptch / Smo / Sufu / Gli signaling axis. It mainly consists of extracellular Hh ligands, the 12-transmembrane protein receptor molecule Patched (Ptch) and the 7-transmembrane protein Smoothened (Smo) on the cell membrane surface, the intracellular inverse regulatory factor Sufu protein, and the nuclear transcription factor Gli family proteins. Meanwhile, studies have shown that several non-classical Hh signaling pathways exist in addition to the classic pathway. These mainly include: signal transduction that depends on the function of Hh ligands and receptor Ptch but not on Smo; signal transduction that does not depend on Smo but depends on Gli, and so on. In the Hh signaling pathway, Gli family proteins are key transcription factors located at the terminal end of the pathway, and their upregulation is one of the most important markers of Hh signaling pathway activation. Regardless of the cause, Hh signaling pathway activation will transduce to Gli, ultimately resulting in the regulation of Gli activity. Gli family members include Gli1, Gli2, and Gli3. All three Gli proteins contain highly conserved DNA-binding regions. From a biological function perspective, the Hh signaling pathway regulates cell proliferation, apoptosis, migration, and differentiation. However, the mechanism by which the Hedgehog (Hh) signaling pathway regulates hepatic lipid metabolism remains unclear.

[0207] To date, few Hh signaling-related long non-coding RNAs (lncRNAs) have been functionally annotated. Here, however, this invention reveals an undefined lncRNA (Hilnc, a Hedgehog signaling-induced long non-coding RNA) directly regulated by the Hh signaling pathway and closely related to lipid metabolism. The invention utilizes a loss-of-function mutation at the Gli binding site in the Hilnc promoter region. BM / BM The expression of Hilnc was significantly reduced both in vitro and in vivo. BM / BM and Hilnc - / - The animals exhibited resistance to diet-induced obesity and fatty liver. Furthermore, hepatocyte-specific knockout of Hilnc ameliorated oleic acid-induced lipid accumulation in primary hepatocytes or diet-induced hepatic steatosis. Mechanistic studies revealed that Hilnc plays a crucial role in lipid metabolism by interacting with IGF2BP2 and subsequently modulating the PPAR signaling pathway in the liver.

[0208] As used in this invention, the term "(signaling) pathway" refers to a signaling system formed by the mutual regulation or interaction of a series of proteins or genes (such as LncRNA in this invention), which generally leads to the occurrence of certain cellular events. The Gli-Hilnc-Igf2bp2-PPAR signaling pathway includes (but is not limited to): the Hilnc gene, Gli (which is a member of the Hh signaling pathway), Igf2bp2, and PPAR (including PPARγ).

[0209] As used in this invention, the terms “Gli-Hilnc-Igf2bp2-PPAR signal path” and “Gli / Hilnc / Igf2bp2 / PPAR signal path” are used interchangeably.

[0210] The amino acid sequence of Gli1 is shown, for example, in GenBank accession number 14632.

[0211] The amino acid sequence of Gli2 is shown, for example, in GenBank accession number 14633.

[0212] The amino acid sequence of Gli3 is shown, for example, in GenBank accession number 14634.

[0213] The amino acid sequence of Igf2bp2 is shown, for example, in GenBank accession number 319765.

[0214] The amino acid sequence of the PPARγ is shown, for example, in GenBank accession number 19016.

[0215] In contrast, in the Gli-Hilnc-Igf2bp2-PPAR signal path, Gli is located upstream of the signal path, and PPAR is located downstream of the signal path.

[0216] In the aforementioned signaling pathway, Gli, as a member of the Hh signaling pathway, regulates Hilnc. Gli1 and Gli2 activate Hilnc transcription by directly binding to the Gli binding site in the Hilnc promoter region. Hilnc is a lncRNA directly regulated by the Hh signaling pathway and Gli. Gli1 regulates the basic or inducible expression level of Hilnc by binding to the Gli binding site in the Hilnc promoter region.

[0217] Furthermore, in the aforementioned signaling pathway, Hilnc can bind to Igf2bp2 and participate in the post-transcriptional regulation of certain metabolic genes in the liver (such as Pparγ) mediated by Igf2bp2.

[0218] Therefore, downregulating the expression or activity of Gli, Hilnc and / or Igf2bp2 in the aforementioned signaling pathway can reduce the activation of this signal, thereby regulating lipid metabolism, slowing down hepatic steatosis, resisting obesity and fatty liver, reducing the formation of new fat or reducing the deposition (accumulation) of fat in tissues.

[0219] When used as targets for artificial regulation or in the creation of screening systems, the above-mentioned lncRNAs and other signaling pathway proteins (or encoding genes) can be naturally occurring, such as those purified and isolated from mammals; or they can be recombinantly prepared, for example, recombinant proteins can be produced using conventional gene recombination techniques. Furthermore, any variants that do not affect the biological activity of these proteins are acceptable, such as derivatives or variants whose function remains unchanged.

[0220] application

[0221] In this invention, it was discovered that the Hh signaling pathway can directly regulate a previously undefined long non-coding RNA (Hilnc) that plays a crucial role in lipid metabolism, thereby participating in lipid metabolism-related regulation. The inventors found that mutating the Gli binding site in the Hilnc promoter region both in vivo and in vitro significantly reduced Hilnc expression. Hilnc expression is directly regulated by the Hh signaling pathway and its downstream transcription factor Gli1. To further investigate the function of Hilnc, a mutation was constructed in the Gli binding site of the Hilnc promoter region (Hilnc... BM / BM ) and Hilnc gene knockout (Hilnc - / - Animals fed a high-fat diet. HilncBM / BM and Hilnc - / - Genotyped animals are resistant to diet-induced obesity and hepatic steatosis. Screening a series of genes related to lipid metabolism revealed that the absence of Hilnc significantly attenuates the expression of genes related to the PPAR signaling pathway in the liver of animals. This invention demonstrates that Hilnc directly interacts with IGF2BP2, and that Hilnc can regulate the stability of Pparγ mRNA through IGF2BP2, thereby affecting the PPAR signaling pathway. Furthermore, the inventors also discovered a functional homolog of Hilnc in the human genome, h-Hilnc. h-Hilnc has similar functions to Hilnc in lipid metabolism; it can bind to IGF2BP2 to regulate Pparγ and is also regulated by the Hh signaling pathway.

[0222] Based on the above, these new findings of the present invention reveal the conserved and important role of the novel regulatory mechanism Hh-Hilnc-IGF2BP2 in lipid metabolism and provide potential therapeutic targets for diseases related to diet-induced hepatic steatosis.

[0223] Based on the new findings of this invention, this invention provides the use of Hilnc, the Gli-Hilnc-Igf2bp2-PPAR signaling pathway comprising Hilnc, or downregulators thereof, for: (a) as a target for regulating lipid metabolism, or for preparing compositions for regulating lipid metabolism; or (b) as a target for analyzing (e.g., detection, prognosis, susceptibility analysis) lipid metabolism, or for preparing reagents for analyzing lipid metabolism.

[0224] As used herein, "inhibition," "downregulation," "weakening," or "reduction," etc., refer to statistically significant inhibition, downregulation, weakening, or reduction. This includes, for example, a significant inhibition, downregulation, weakening, or reduction compared to the control group; more specifically, an inhibition or downregulation of more than 20%, better than 50%, or even better than 80%.

[0225] As used herein, the term "downregulator" includes inhibitors, antagonists, blockers, and other similar terms, which are used interchangeably.

[0226] It should be understood that, after understanding the function / operating mechanism of Hilnc and the Gli-Hilnc-Igf2bp2-PPAR signaling pathway containing Hilnc, various methods well known to those skilled in the art can be used to regulate the expression of Hilnc or the Gli-Hilnc-Igf2bp2-PPAR signaling pathway. For example, various methods well known to those skilled in the art can be used to reduce or eliminate Hilnc expression. Alternatively, methods well known to those skilled in the art can be used to inhibit Gli and / or Igf2bp2, weakening the operation of the signaling pathway.

[0227] In this invention, the downregulator of Hilnc protein or its encoding gene refers to any substance that can reduce the activity of Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathway proteins, reduce the stability of Hilnc or other signaling pathway proteins or their encoding genes, downregulate the expression of Hilnc or other signaling pathway proteins, reduce the effective duration of Hilnc or other signaling pathway proteins, or inhibit the transcription and translation of Hilnc or other signaling pathway genes. These substances can all be used in this invention as useful for downregulating Hilnc. They can be compounds, small chemical molecules, or biomolecules. The biomolecules can be at the nucleic acid level (including DNA and RNA) or at the protein level. For example, the downregulator is: an interfering RNA molecule or antisense nucleotide that specifically interferes with the expression of Hilnc or other signaling pathway genes; or a gene editing reagent that specifically edits Hilnc, etc.

[0228] The present invention also provides a method for downregulating the Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathway, including targeted mutation, gene editing or gene recombination of the Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathway genes, thereby achieving downregulation.

[0229] In a preferred embodiment of the present invention, the downregulator can be a gene-specific interfering RNA molecule (such as siRNA, shRNA, miRNA, etc.) of the Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathway. Those skilled in the art will understand that such interfering RNA molecules can be prepared using the sequence information of the Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathway genes provided in this invention. There are no particular limitations on the preparation method of the interfering RNA molecule, including but not limited to: chemical synthesis, in vitro transcription, etc. The interfering RNA can be delivered into cells using appropriate transfection reagents, or it can be delivered into cells using various techniques known in the art.

[0230] In a preferred embodiment of the invention, RNA is used to inhibit genes in the Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathways. RNAi is an evolutionarily conserved cellular defense mechanism used to control the expression of exogenous genes in most eukaryotes, including humans. RNAi is typically triggered by double-stranded RNA (dsRNA) and induces sequence-specific mRNA degradation of single-stranded target RNA. The mediators of mRNA degradation are small interfering RNA duplexes (siRNAs), typically produced by enzymatic cleavage of long dsRNA within the cell. siRNAs are typically about 21 nucleotides long (e.g., 21-23 nucleotides). After the small RNA or RNAi is introduced into the cell, the sequence is believed to be delivered to an enzyme complex called the RISC (RNA-induced silencing complex). The RISC recognizes the target and cleaves it with a nuclease. Notably, if a larger RNA sequence is delivered to the cell, the RNase III enzyme (Dicer) converts the longer dsRNA into 21-23 nt ds-siRNA fragments. Preferred siRNA reagents targeting preferred repressive target sites are provided in embodiments of the invention.

[0231] In a preferred embodiment of the invention, shRNA technology is used to interfere with genes in the Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathways. shRNA is an RNA sequence that can rotate a tight hairpin, which can be used to silence gene expression via RNA interference. shRNA is introduced into cells using a vector and utilizes a promoter (such as U6) to ensure that shRNA is consistently expressed. This vector is typically delivered to daughter cells, allowing gene silencing to be inherited. The shRNA hairpin structure is cleaved into siRNA by cellular mechanisms and then binds to an RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs that match the bound siRNA. shRNA is transcribed by RNA polymerase III. In embodiments of the invention, preferred shRNA reagents are provided that target preferred repressive sites.

[0232] In a preferred embodiment of the present invention, antisense nucleic acids that specifically hybridize with one or more nucleic acids of the Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathway genes are used to regulate the expression of the Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathway genes. The specific hybridization of the oligomer with its target nucleic acid interferes with the normal function of the nucleic acid.

[0233] As a preferred embodiment of the present invention, a CRISPR / Cas (e.g., Cas9) system can be used for targeted gene editing to knock out Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathway genes in the targeted disease region. Common knockout methods include co-transferring sgRNA or nucleic acids capable of forming said sgRNA, Cas9 mRNA or nucleic acids capable of forming said Cas9 mRNA to the target region or target cells. After identifying the target site, known methods can be used to introduce sgRNA and Cas9 into the cells. The nucleic acid capable of forming said sgRNA is a nucleic acid construct or expression vector, or the nucleic acid capable of forming said Cas9 mRNA is a nucleic acid construct or expression vector. These expression vectors are introduced into the cells, thereby forming active sgRNA and Cas9 mRNA within the cells. In embodiments of the present invention, a preferred sgRNA reagent is provided, which targets a preferred knockout target site.

[0234] As an optional approach of this invention, homologous recombination can be used to specifically target the Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathway genes, causing expression defects or deletions. Alternatively, Cre and loxp methods can be used to selectively knock out, reduce, or inactivate related genes in the genome of animals or cells.

[0235] The above are some representative ways to downregulate Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathway genes. It should be understood that the present invention provides a novel target. After those skilled in the art understand the overall scheme of the present invention, other methods known in the art or methods under development can also be used to regulate Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathway genes. These methods are also included in the present invention.

[0236] Targeted screening

[0237] Having learned about the functions of the Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathway, this new discovery can be used to screen for substances that regulate lipid metabolism by modulating this mechanism. These regulatory substances can be potential regulatory agents.

[0238] The present invention provides a method for screening substances that regulate lipid metabolism, comprising: (1) adding a candidate substance to a system expressing Hilnc; (2) detecting the system and observing the expression of Hilnc therein. If its expression is inhibited, it indicates that the candidate substance is a substance that can be used to regulate lipid metabolism, better resist obesity and fatty liver, reduce the formation of new fat or reduce the deposition (accumulation) of fat in tissues.

[0239] The present invention also provides another method for screening substances that regulate lipid metabolism, comprising: (i) adding a candidate substance to a system expressing the Gli-Hilnc-Igf2bp2-PPAR signaling pathway; (ii) detecting the system and observing the expression or activity of the Gli-Hilnc-Igf2bp2-PPAR signaling pathway protein therein. If the expression or activity of Gli, Igf2bp2 or PPAR is inhibited, or the interaction between Gli and Hilnc, the interaction between Hilnc and Igf2bp2, or the interaction between Igf2bp2 and PPAR is downregulated, it indicates that the candidate substance is a substance that can be used to regulate lipid metabolism, better resist obesity and fatty liver, reduce the formation of new fat, or reduce the deposition (accumulation) of fat in tissues.

[0240] Methods for screening substances that act on proteins or genes or specific regions thereof as targets are well known to those skilled in the art, and these methods can all be used in this invention. The candidate substances can be selected from: peptides, polymeric peptides, peptide-like substances, non-peptide compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, small organic molecules, small inorganic molecules, and nucleic acid sequences, etc. Depending on the type of substance to be screened, those skilled in the art will understand how to select an appropriate screening method.

[0241] Through large-scale screening, a class of substances that specifically act on the Hilnc or Gli-Hilnc-Igf2bp2-PPAR signaling pathway and have effects on lipid regulation can be obtained. Furthermore, in-depth cell / animal experiments can be conducted to pinpoint truly usable drugs from these substances.

[0242] In summary, the main advantages of this invention are:

[0243] 1. A novel lncRNA (Hilnc) was revealed, which is directly regulated by Hh signaling. Mutations at the GLI binding site in the Hilnc promoter region significantly reduced both constitutive and inducible expression of Hilnc.

[0244] 2. Demonstrating that Hilnc plays a crucial role in Hh-mediated lipid metabolism. In vivo, Hilnc deletion by mutating the Gli binding site in the Hilnc promoter region confers resistance to diet-induced obesity and fatty liver. Furthermore, hepatocyte-specific knockout of Hilnc reduces lipid accumulation in oleic acid-treated hepatocytes and improves hepatic steatosis in animals fed a high-fat diet.

[0245] 3. Demonstrating that Hilnc functions as a protein chaperone for IGF2BP2. IGF2BP2 is an important regulator of lipid metabolism, and Hilnc can interact with IGF2BP2 and promote the binding of IGF2BP2 to its downstream target genes (such as PPARγ). Therefore, the newly discovered regulatory mechanism of Hh-Hilnc-IGF2BP2-Pparγ is crucial for lipid metabolism and the progression of non-alcoholic fatty liver disease.

[0246] 4. A potential functional homolog of Hilnc in the human genome, h-Hilnc, was identified. The regulation of Hilnc by Hh and Gli and its role in lipid metabolism in human hepatocytes were demonstrated.

[0247] 5. This study not only revealed a novel lncRNA regulating lipid metabolism but also provided new insights into how signaling pathways regulate lncRNAs. This is the first study to link the Hh signaling pathway and lipid metabolism with lncRNAs. This invention may also have broad implications for diet-induced obesity and non-alcoholic fatty liver disease.

[0248] The above-mentioned research conclusions of this invention represent an important advancement in the study of Hh signal transduction, lncRNAs, cell metabolism, and non-alcoholic fatty liver disease.

[0249] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, or according to the manufacturer's recommendations.

[0250] Materials and Methods

[0251] 1. RNA sequencing and biological analysis

[0252] (1) Library construction and sequencing process

[0253] 1) RNA is extracted from tissues or cells, followed by rigorous quality control of the RNA samples. The quality control standards mainly include the following three aspects: analyzing the integrity of the RNA sample and the presence of DNA contamination; detecting RNA concentration and purity (OD).260 / 280 and OD 260 / 230 ); accurately detect RNA integrity.

[0254] 2) Library Construction. First, ribosomal RNA was removed from total RNA. Then, RNase R was used to fragment the RNA into 250–300 bp fragments. Using the fragmented RNA as a template and random oligonucleotides as primers, the first strand of cDNA was synthesized. Subsequently, RNase H was used to degrade the RNA strand, and the second strand of cDNA was synthesized using dNTPs (dUTP, dATP, dGTP, and dCTP) in a DNA polymerase I system. The purified double-stranded cDNA underwent end repair, A-tailing, and ligation with sequencing adapters. CDNA fragments of approximately 350–400 bp were screened using AMPure XP beads. The U-containing second strand of cDNA was degraded using USER enzyme, and finally, PCR amplification was performed to obtain the library. Strand-specific libraries offer many advantages, such as obtaining more effective information with the same amount of data; and providing more accurate gene quantification, localization, and annotation information.

[0255] 3) Library testing. Initial quantification was performed using Qubit, diluting the library to 1 ng / ul. Then, the insert size was determined using an Agilent 2100 Bioanalyzer, with the insert size ranging from approximately 250 to 300 bp, meeting expectations. After confirming the insert size met expectations, the effective concentration of the library was accurately quantified using qPCR. The effective concentration was >2 nM, ensuring the quality of the sample library.

[0256] 4) Sequencing. After the library passes inspection, pooling is performed according to the effective concentration of the library and data output requirements, followed by Illumina PE150 sequencing. PE150 (Pair end 150bp) refers to high-throughput paired-end sequencing, with 150bp sequenced from each end. In the constructed small fragment library, the inserted cDNA, i.e., the insert fragment, is the unit for direct sequencing. Paired-end sequencing is a method of sequencing both ends of each insert fragment. Since the length distribution of the insert fragment is known, paired-end sequencing can obtain not only the sequences at both ends of the fragment but also the length between these two sequences, thus facilitating subsequent assembly and alignment. The basic principle of sequencing is sequencing by synthesis. Four fluorescently labeled dNTPs, DNA polymerase, and adapter primers are added to the sequencing flow cell for amplification. When each sequencing cluster extends its complementary strand, each added fluorescently labeled dNTP releases corresponding fluorescence. The sequencer captures the fluorescence signal and converts the light signal into sequencing peaks using computer software, thereby obtaining the sequence information of the fragment to be sequenced.

[0257] (2) Biological analysis process

[0258] Sequencing data quality assessment: This mainly involves statistically analyzing sequencing error rate, data volume, alignment rate, etc., to assess whether the library construction and sequencing have met the standards. If they meet the standards, further analysis can be performed; otherwise, the library needs to be reconstructed or additional sequencing needs to be performed.

[0259] Information mining and analysis: The standard RNA-seq analysis process includes quality control, alignment, splicing, screening, quantification, differential significance analysis, and functional enrichment, as well as analyses related to transcript structural variations such as alternative splicing and variant sites. GOseq software was used for GO enrichment analysis; KOBAS (2.0) was used for pathway enrichment analysis. GO (Gene Ontology) is a comprehensive database describing gene function, which can be divided into three parts: molecular function, biological process, and cellular component. KEGG (Kyoto Encyclopedia of Genes and Genomes) is a comprehensive database integrating genomic, chemical, and systemic functional information.

[0260] 2. Rapid amplification of cDNA ends (RACE) technology

[0261] RNA from NIH-3T3 and LO2 cells was subjected to 5' and 3' RACE using the FirstChoice RLM-RACE kit (Ambion), and the cloned products were obtained using the TOPO TA cloning kit (Invitrogen). Specific primer sequences are shown in Table 1.

[0262] The experimental samples for 3' RACE include total RNA, poly(A)+ RNA, etc. First, reverse transcription primers are designed based on the naturally occurring poly(A) tail at the 3' end of mRNA to obtain the first cDNA strand. Gene-specific primers (GSPs) are then designed based on the known cDNA sequence to synthesize the second cDNA strand. Subsequently, the obtained cDNA strand is amplified by PCR using the gene-specific primer (GSP) and the 3' end primer of the positive strand as a primer pair, thus obtaining the 3' end sequence of the cDNA (gene-specific primer → 3' end). 5' RACE involves designing gene-specific primers (GSPs) based on the known cDNA sequence for reverse transcription to obtain the first cDNA strand, while simultaneously adding a poly(C) tail to the 3' end of the cDNA using terminal deoxynucleotidyl transferase (TdT). Specific primers are then designed based on the poly(C) tail to synthesize the second cDNA strand. Finally, double-stranded cDNA is synthesized using gene-specific primers, with the second cDNA strand serving as a template. Finally, PCR amplification was performed using a gene-specific primer (GSP) and an antisense 3′ end primer as a pair of primers to obtain the 5′ end sequence of cDNA (gene-specific primer → 5′ end).

[0263] 3. Construction of plasmids, stable cell lines, and transgenic haploid mouse embryonic stem cells

[0264] Hilnc and Flag-tagged Gli1, Gli2, and Pparγ were cloned into the vector pcDNA3.1. The pGL3-Hilnc and pGL2-h-Hilnc promoters were cloned by inserting the Hilnc promoter (approximately 1000 bp upstream of the Hilnc TSS) and the h-Hilnc promoter into the pGL3-baisc vector (Promega). Deletion and random mutations of the Gli binding sites in the promoter regions were constructed using the KOD Plus Mutation Kit (TOYOBO). Primer sequences are shown in Table 1.

[0265] To generate NIH-3T3 cell lines with Hilnc promoter mutations and haploid mouse embryonic stem cells, an sgRNA (sgRNA-1) targeting the Gli binding site in the Hilnc promoter region was designed and inserted into the CRISPR / Cas9 vector px330-mCherry. Homologous arm sequences of the donor plasmid (chr11:39613549-39614780) were amplified from the genomic DNA of NIH-3T3 cells. The Gli binding site (GACCACCCA) in the homologous arm was then randomly mutated to GTATGCATG, which does not generate any known transcription factor binding sites.

[0266] To generate Hilnc-KO haploid mouse embryonic stem cells, three sgRNAs (sgRNA-2-1, sgRNA-2-2, and sgRNA-3) were designed (two targeting upstream and one targeting downstream of Hilnc exons 2 and 3) and inserted into the CRISPR / Cas9 vector px330-mCherry.

[0267] sgRNA-1: CCATTATGGTAGTACCCTTCTGG (SEQ ID NO: 4);

[0268] sgRNA-2-1: GCTTCGTAAGTGATAGACACTGG (SEQ ID NO: 5);

[0269] sgRNA-2-2: AGGTTTATTGCTCAGGCGTGTGG (SEQ ID NO: 6);

[0270] sgRNA-3: TTCCACTCTCTGGTACCCGCAGG (SEQ ID NO: 7).

[0271] 4. Hilnc knockout (Hilnc - / - ) mice and Hilnc promoter region mutations (Hilnc BM / BM Construction of mice

[0272] Detailed protocols for transgenic mice can be found in the reference (Yang, H. et al., Generating genetically modified mice using CRISPR / Cas-mediated genome engineering. Nat Protoc, 2014.9(8): p. 1956-68). In short, transgenic haploid embryonic stem cells are injected into mid-stage II oocytes, and SrCl2 stimulation is activated. The embryos are then transferred into the uterus of pseudopregnant mice to produce full-term pups (called semi-cloned mice). Figure 2 As shown in Figure A, F1 offspring carrying the mutant allele were identified by PCR. (Hilnc) - / - The PCR primer sequences for mice are as follows: Primer 1 (P1), 5'-TTGCAAATTTCCCTGGAGGGT-3' (SEQ ID NO:123); Primer 2 (P2), 5'-ATTCACAGCTAGCCATTGG-3' (SEQ ID NO:124); Primer 3 (P3), 5'-CTTAAAGTCCATGAGTCGCTTG-3' (SEQ ID NO:125). For wild-type mouse alleles (P1 and P2), the expected PCR product is 880 bp; for transgenic mouse alleles (P1 and P3), the expected PCR product is 770 bp. BM / BM The PCR primer sequences for mice are as follows: Primer 4 (P4), 5'-GAGAGAACATGGATTGG-3' (SEQ ID NO:126); Primer 5 (P5), 5'-CAAGTTTAGACACCACCATGG-3' (SEQ ID NO:127); Primer 6 (P6), 5'-CAAGTTTAGGATGCATGTTAGG-3' (SEQ ID NO:128). The PCR products of the wild-type alleles (P4 and P5) are expected to be 375 bp. BM / BM The expected PCR products of the mouse alleles (P4 and P6) are 375 bp.

[0273] During the experiment, the mice were usually treated between 12:00 pm and 3:00 pm.

[0274] 5. Intracorporeal injection of adenovirus

[0275] Six-week-old male wild-type mice were injected with recombinant adenoviruses of sh-Hilnc, sh-Igf2bp2, sh-Pparγ, or sh-Control. Six-week-old male Hilnc mice were injected with... - / -Mice were injected with either AAV8-Hilnc (O / E-Hilnc) or AAV8-GFP (AAV control) recombinant adenovirus. The recombinant adenovirus (2 × 10⁹ pfu) was administered to mice via tail vein injection. All adenoviruses were manufactured by Hanheng (Shanghai, China).

[0276] sh-Hilnc: 5′-CCUAAACUGGCGCCACAUUTT-3′ (SEQ ID NO: 8);

[0277] sh-Igf2bp2: 5′-GGGUAAAGUGGAAUUGCAUTT-3′ (SEQ ID NO: 9);

[0278] sh-Pparγ: 5′-GAAGUUCAAUGCACUGGAATT-3′ (SEQ ID NO: 10).

[0279] 6. Mouse metabolic cage experiment

[0280] To analyze mouse body weight and food intake, mice were maintained at a normal ambient temperature of 23±1℃ with free access to water and food. Energy expenditure was measured using a custom-designed indirect calorimetric system (Columbus×Oxymax / CLAMS). Age- and sex-matched controls and Hilnc mice were included. BM / BM Mice were housed individually in metabolic cages, introduced 3 days prior to acclimatization. Total oxygen consumption (VO2) and carbon dioxide production (VCO2) were continuously measured using indirect calorimetry. Respiratory exchange rate and energy expenditure were recorded for each cage every 30 minutes and converted using CLAMS software. Activity levels were measured concurrently with CLAMS data collection. Food intake was continuously recorded over 24 hours, during which mice had free access to food. Consecutive breaks in the infrared beam on the x-axis or z-axis were recorded as activity counts, with data recorded every 10 minutes.

[0281] 7. Cell Culture

[0282] All cells were cultured in a humidified incubator (Thermo, Waltham, MA) at 37°C and 5% CO2. NIH-3T3 cells were cultured in DMEM (Invitrogen, Carlsbad, CA) medium containing 10% fetal bovine serum and 1% antibiotics. HEK293T cells were cultured in DMEM medium supplemented with 10% fetal bovine serum. AML12 cells were cultured in DMEM / F12 medium (Sigma) supplemented with 10% fetal bovine serum, 1% liquid culture medium supplement (Sigma), and 40 ng / ml dexamethasone. All cells were obtained from the Shanghai Institutes for Biological Sciences Cell Bank (Shanghai, China). Multiple samples were cryopreserved within 10 days of purchase for future use.

[0283] Primary mouse hepatocytes were obtained from the previously mentioned male wild-type C57BL / 6J mice and Hilnc. BM / BM Mice, Hilnc - / - (AAV-Control) mice, Hilnc - / - Hepatocytes were isolated from the livers of (O / E-Hilnc) mice and Igf2bp2 gene-inhibited mice (8 weeks old) (Li, WC et al., Isolation and culture of adult mouse hepatocytes. Methods Mol Biol, 2010, 633: p. 185-96). In short, hepatocytes were isolated by injecting 0.5 mg / mL type IV collagenase (Sigma) into the inferior vena cava after mouse anesthesia, and cell viability (70% or higher) was detected using trypan blue staining. Primary hepatocytes were then cultured in Williams E medium (Sigma) containing 1% (v / v) penicillin / streptomycin (10000 U / μg / ml), 0.5% (v / v) gentamicin (10 mg / ml), 0.04% (v / v) amphotericin B (250 μg / ml), 1% (v / v) 200 mM L-glutamine (Sigma), and 1% (v / v) non-essential amino acids (Gibco). Primary hepatocytes isolated from Igf2bp2 gene-repressed mice were transfected with empty plasmid, siRNA-Hilnc, pcDNA3.1-Hilnc, and pcDNA3.1-Flag-Pparγ for 24 hours, and then cultured for another 24 hours in fresh medium containing 0.5 mM oleic acid (OA). Cells were then collected for further analysis.

[0284] 8. Nucleus-cytoplasm separation experiment

[0285] Nuclear-cytoplasmic separation was performed using PARIS TMThe nucleoplasmic-nucleic acid (NCNA) separation kit (ambion) was used. First, the entire cell was washed with ice-cold PBS, then resuspended in ice-cold cell separation buffer. The cytoplasmic and nucleic fractions were separated by centrifugation. Proteins and RNA were isolated from each fraction and analyzed by Western blotting and quantitative real-time PCR.

[0286] 9. Immunoblotting

[0287] Cells were lysed in cell lysis buffer (CellSignaling Technology) containing a mixture of intact protease inhibitors (Roche), and the lysates were then sonicated and centrifuged to obtain a clear cell lysis supernatant. Tissues were extracted using a tissue lysator (Qiagene) in ice-cold lysis buffer (10 mM Tris-HCl (pH 8.0), 140 mM KCl, 1 mM MgCl2, 0.1 mNaF, 0.1% NP-40) containing the mixture of intact protease inhibitors. Tissue or cell lysates were electrophoresed on 4–12% SDS-polyacrylamide gels (Invitrogen) and transferred to PVDF membranes by electroporation. Proteins were detected using chemiluminescence (ECL kit, Thermo-Scientific). These images were taken using a chemiluminescence / fluorescence imaging and analysis system (SNSITECH). All antibodies used are listed in Table 2.

[0288] 10. RNA Fluorescence In Situ Hybridization (FISH) Experiment

[0289] Digoxigenin-labeled positive and negative Hilnc probes were synthesized using the Roche Digoxigenin-Labeled RNA Kit. For RNA-FISH experiments, cells were seeded on multi-chamber culture slides (BD-Falcon), fixed, and infiltrated. The slides were then hybridized with the digoxigenin-labeled RNA probes, followed by digestion and four washes of excess RNA probe. Finally, detection was performed using the Roche HNPP fluorescence detection kit.

[0290] 11. RNA Immunoprecipitation

[0291] AML2 and LO2 cells were collected and lysed using Cell Signaling Technology lysis buffer (Roche) containing a mixture of 1 U / μl ribonuclease inhibitor and intact protease inhibitor. Mouse livers were harvested and lysed using a tissue lyser (Qiagene) in ice-cold Cell Signaling Technology lysis buffer (Roche) containing a mixture of 1 U / μl ribonuclease inhibitor and intact protease inhibitor, followed by incubation on ice for 15 min. The cells were then centrifuged at 14,000 rpm for 10 min, and the supernatant was transferred to fresh 1.5 mL tubes. Total protein was determined using the Bradford method, and the supernatant containing 2 mg of protein was immunoprecipitated.

[0292] IGF2BP2 antibody (Proteintech) and normal rabbit IgG were added to clear cell lysate and hybridized at 4°C for 4 hours (or overnight). Then, 50 μl of protein A magnetic beads (NEB) were added to the sample and hybridized at 4°C for 2 hours. After washing five times with NT2(+) buffer (50 mM Tris-HCl pH 7.0, 150 mM NaCl, 1 mM MgCl2, 0.05% NP-40, 1 mM MPMSF), RNA and protein on the beads were separated using the TRIzol method. The RNA fraction was analyzed by quantitative real-time PCR.

[0293] 12. RNA PullDown Experiment

[0294] For in vitro transcription, biotin-labeled positive and negative sense RNA were synthesized using the DIG RNA Labeling Kit (Roche) and the RNA Biotin Labeling Mixture (Roche). 3 μg of isolated biotin-labeled RNA was heated to 90°C for 2 minutes to disrupt the original secondary structure and then placed on ice for 2 minutes to allow for the formation of the appropriate secondary structure. 2 × 10⁻⁶ 7Cells were lysed in a cell lysis buffer containing a mixture of 1 U / μl ribonuclease inhibitor and intact protease inhibitor (Roche), and clear cell lysates were obtained by sonication and centrifugation. 50 μl of streptavidin-conjugated beads (Thermo Fisher) were then added to the lysis buffer, and the mixture was incubated at 4°C for 30 min to pre-wash the lysis buffer. Biotin-labeled RNA was then added to the pre-washed cell lysis buffer and incubated at room temperature for 1 h. 100 μl of washed streptavidin-conjugated beads were added to the reaction mixture, and the mixture was incubated at 4°C for 4 h, followed by four washes with NT2(+) buffer containing 1 mM PMSF and 10 mM ribonucleoside complex. Proteins on the beads were separated by SDS-PAGE, followed by silver staining and mass spectrometry identification.

[0295] 13. Quantitative Real-Time PCR

[0296] Cells or tissues were lysed in TRIzol (Invitrogen), and total RNA was extracted using the standard TRIzol method. For qPCR, reverse transcription was performed using 0.5 μg of RNA with the ReverTra Ace qPCR RT kit (TOYOBO, FSQ-301) containing gDNA removal agent. Real-time quantitative PCR was performed using the Green Real-time Quantitative PCR Mixture (TOYOBO, QPK-201). Two [units / items] were used for quantitative PCR. -ΔΔCt The calculations were performed using the method described. The primers used in the experiment are listed in Table 1.

[0297] 14. Luciferase activity assay

[0298] For the dual-luciferase activity assay, the PcDNA3.1-Flag-Gli1 / Gli2 plasmid, along with the pGL3-Hilnc / pGL3-h-Hilnc reporter gene and the Renilla luciferase plasmid, was transfected into 293T cells. After 48 hours, cell lysates were collected, and dual-luciferase activity was measured according to the manufacturer’s standard experimental procedure (Promega).

[0299] 15. Gene expression inhibition experiment

[0300] 10 nM siRNA was transfected into the designated cells using RNA-iMAX reagent (Thermo Fisher). The mouse Hilnc-specific sequence (designed and synthesized by Genepharma), 5'-CCUAACUGCGCCACAUU-3', was used for siRNA-1 (SEQ ID NO:11), and 5'-GGUCUACCACAUGAG-3' was used for siRNA-2 (SEQ ID NO:12). The non-target gene sequence, 5'-UUCUCUCGCAACGUGUCACAU-3' (SEQ ID NO:13), was used as a negative control. The human gene sequences 5'-CAGGAUCAUAAUATT-3' (SEQ ID NO:14) and 5'-CAGGAGAUAAUTT-3' (SEQ ID NO:15) were used for siRNA-ENST0000417084.1; 5'-GAGCUCUGAGCAUATT-3' (SEQ ID NO:16) and 5'-GGUGCAUCAUUGUGUATT-3' (SEQ ID NO:17) were used for siRNA-ENST0000450804.3.

[0301] 16. Chromatin Immunoprecipitation (ChIP) Assay

[0302] Chip experiments were performed in NIH-3T3 and LO2 cells. Cell lysates transfected with PcDNA3.1-Flag-Gli1 / Gli2 or PcDNA3.1-Flag-Gli1 were sonicated for 40 minutes (30s on / 30s off), resulting in chromatin fragmentation into segments primarily 100-300 bp in length. Immunoprecipitation was then performed using antibodies against the Flag-tag, with IgG protein as a control. Immunoprecipitated DNA was collected using a QIAQIUCK PCR purification kit. The purified DNA was analyzed using Chip-PCR. Primers used in the experiments are listed in Table 1.

[0303] 17. Glucose and insulin tolerance test

[0304] For the glucose tolerance test, mice fed a high-fat diet were fasted overnight. A 20% glucose solution (1 g / kg) was administered intraperitoneally. Blood was collected via the tail vein at 0, 20, 40, 60, and 120 minutes after administration, and blood glucose levels were measured using a Roche glucometer. For the insulin tolerance test, mice fed a high-fat diet were fasted for 5 hours. Human insulin (Yeasen) (0.4 U / kg) was administered intraperitoneally. Blood was collected via the tail vein at 0, 20, 40, 60, and 90 minutes after injection, and blood glucose levels were measured as described above.

[0305] 18. Histological analysis, lipid staining, and immunofluorescence staining

[0306] Freshly dissected mouse livers and white adipose tissue were removed, fixed with 4% paraformaldehyde, and embedded in paraffin. Paraffin sections (4 μm) were obtained. The tissue sections were then stained with H&E according to standard experimental procedures.

[0307] For lipid staining, cells were washed twice with PBS and fixed with 10% formaldehyde for 30 minutes. After washing twice in PBS, cells were stained with freshly diluted Oil Red O solution for 15 minutes. The culture dishes were then rinsed with water and counterstained with hematoxylin for 10 seconds. Freshly dissected mouse livers were fixed in 4% paraformaldehyde at 4°C for 1 hour. After fixation, the tissues were washed three times with PBS, dehydrated overnight in 30% sucrose at 4°C, embedded in OCT, and frozen sections (10 μm) were obtained and air-dried at room temperature. The liver sections were then stained with Oil Red O for 10 minutes, washed with 60% isopropanol, and counterstained with hematoxylin for 20 seconds. Representative photographs were taken using a microscope at 100x or 200x magnification.

[0308] For immunofluorescence staining, dried sections were washed in PBS and then blocked for 30 minutes at room temperature with PBS containing 1% BSA and 0.1% Triton X-100. Sections were incubated overnight at 4°C with rabbit anti-ZsGreen (Clontech, 632474, 1:1000), followed by incubation at room temperature for 2 hours with fluorescent secondary antibody (Alexa Fluor 488; Invitrogen). Sections were then stained with DAPI (4,6-diamino-2-phenylindole) and mounted with Aqua-Poly / mount (Polysciences). Immunostaining images were acquired using an Olympus fluorescence microscope (BX53) and a Leica TCS SP8 confocal microscope. The acquired images were analyzed using ImageJ software.

[0309] 19. Assay for Lipogenesis Capacity

[0310] The ability to generate new fat is achieved by […] 14 The determination was made by incorporating C]acetate into lipids.

[0311] A portion of liver tissue was extracted from anesthetized mice. The liver tissue was cultured using Dulbecco's modified Eagle's medium (Invitrogen) and [ 14C]acetate composition (final concentrations of 29.6 MBq / mmol and 2.11 GBq / mmol; GE Healthcare Bio Sciences Corp.) was prepared and aerated with a gas mixture of 5% CO2 and 95% O2 for at least 20 minutes before use. Liver blocks (approximately 20 to 25 mg) were incubated with the culture medium at 37°C for 90 minutes. After incubation, the liver blocks were heated with ethanolified KOH at 70°C for 1 hour, and unsaponifiable lipids were removed with petroleum ether. Aqueous solutions obtained from liver sections or hepatocytes were acidified and then lipids were extracted with petroleum ether. Radioactivity was measured using a liquid scintillation counter (Tri-Carb 2500; Perkin-Elmer).

[0312] 20. Statistical Analysis

[0313] All data are expressed as mean ± SEM. One-way or two-way ANOVA was used to analyze the results, followed by the Tukey test for minimum significance; p < 0.05 was considered statistically significant. GraphPad Prism (v.8) and Sangerbox (http: / / www.sangerbox.com / tool) were used for statistical calculations and graphing. "n" in the study represents the number of biological replicates and is noted in the text.

[0314] 21. Sequence Information

[0315] >Hilnc,isoform1,long non-coding RNA(SEQ ID NO:1):

[0316] gaactcactgcgtactttgatttcttgatggctgactatgagtactgaaaactccaacccggcagcgtgtagtgctgtgtgcctctccttatagagttaaactcag ccaggcctgcccgagagaaaccctaaactggcgccacattcctgctggaactctgtcacagtctcagctcaaactggcctccagatggacaaggtgaagagacagaggtcatacccatgaggaagaggctcttggcagacatggaatctactgtcaccttattcttggattcttaagcctcgtaaacactgagtgagtccagct ggacctgtcaatcacctcgcctggagactacccctcaggaaaactgattcacctgaagatgttacagagatgggggaaataattattctcttaatgagataacatgtgtgtacctccctgagaagtccctccctcagtccagctgtttgcagatctttcctactaagacagcctgctttccccagttctaactccaaaactgtaacttctcctttccccttgtctcatctttggctaaaggccaaaacctcctcctgcttccaacctctgtacactctctttctttaaccccctccaagccccagttacttggcgcccttccttgcagaacctgccaactctcctgaaacctacctcggaaggcatgtcatgctctcctctccagctcccctttccaggcagcagttgaggtttgtagcttcctg accttgtggtttactcctgagcgccaataaaagagtccacaagcttccaaaaaaaaaaaaaaaaaa

[0317] >Hilnc,isoform2,long non-coding RNA(SEQ ID NO:2)

[0318] gaactcactgcgtactttgatttcttgatggctgactatgagtactgaaaactccaacccggcagcgtgtagtgctgtgtgcctctccttatagagttaaactcag ccaggcctgcccgagagaaaccctaaactggcgccacattcctgctggaactctgtcacagtctcagctcaaactggcctccagatggacaaggtgaagagacagaggtcatacccatgaggaagaggctcttggcagacatggaatctactgtcaccttattcttggattcttaagcctcgtaaacactggtactctctccag acctcccaaagtccagggaatatatgaacaattctacgcactggctgaaacagacacataccaacggcagctttgtcaaaagagtagacactgcaactgactgagtgacgagtgcaacagaatagctgtcttccaaccaaccaaaggccagaacacacgtgggtgggcggccctgcaaacctgccacttctgcagtga acctttgcaatggtcaagatgttctggctcagcaaggactcagaacaaccaggaggtttggagagccactccatggatcagagtacaaatgtggagcagagggatactgaccagagggtacagatggagatgaaggactgaccctgagaagacaataattactagttttgtttactgttagccccctcaccagtcacctggg gcagcagtttttattaaaaccgctgtattaataaaatcagaaatgctggttgggagagctgcggcacacaaagccacgtcagccaagagaaaccttgcaggggaggagacagcattccgagctctctgaaggaacacagtgtactgcagtgctttggccctggggcccatgggctgcggaggcagaggacccatcatgcactgctaagagtctactgtgggcagacactgctgggaatcagaacatggaagatgccccgttcctctcaaggaaggcagagctgccgggagttccagacagaggcaggcagagagacctctgtgaggttgatgtcagcttggtctacatagccacttctcggctaacccagtgagatgctgtcatagacaaattccttgggg tgtccaagatgtaaagggagagagacagcagagacacccgaagtcaagtcttcccctcacactgctcactgcacacacgttaggagaacactcacacctacaatacacagctacacctaaggctccggacactgcaaagaggaggcagaaagactctaagagccaggggaccagcattctgtgaggttttgtctccta gtaacatcagaagctacgcctgtaaagtctcaccagcatcactgcctaaacatgacctgacgaaggaggacaccaatggttatgtcaactgaatggaaaaaaagcccaatgagacctgaaccctacacaaaaactattggcaactgagtgaagctggagcgagaggtggccctccccagggaaaagcacaccaactcgtcatctagtgtggaatggtgacacaagcaaccctgtatggacttagcaggctgtatttagaaatatatatgcatgtgtatacagacacatctatgcatgcaat atcaactgatgaaaaaagaggctatgagtttgaaagagtgtgtggggaggggtaactaggaaggtttagaaggaggaaaggccaaggagaaacattgtaacgagaatacaagctcaaaactaaaccccaacaaaaagagtaaaaagcatgcttgcttacaaccccacaagccaccagtcatcgctccaggcctctggctccctggctccttggctccctgcaggtggcacagtgcccctagacacccacctggcccaaggctagctcctatcagagttatagtcagcgagcacctcttagtgacttccactgtcaccatctcctaaccacattcctcttttgctccactcaatgctactagccagggtgagtgtagtttgttggtttgtattgcctatattcttcaaga aaaaaaaaacgttcctgagggcaggaactctcgtgttacttcactgctataatccttgggtctggaaaagcactcaatgcataacaggcattcaataaatatttgtggacttgt

[0319] >ENST00000417084.1(h-Hilnc),long non-coding RNA(SEQ ID NO:3):

[0320] ttcttgtgattagcaatcaaggacagtttctcagctaatcagtacaggaagaagagcctatggtaacagacaataaaggaacagcttgcagacggcctatc gtgagactttgccttgtgatcatattacaagactgaataagatagacatgacctccttcctcctggacctgacaattgttccttcaaatcacttccacacatgcattgcctggggactggggactggggtctggatcccatggccagaccaaaccccaaaggaagctattggagaatacacaccttcgaaatgcggagaaatata agaaaaggaagacaagagttcaagaagccaggcatccaacaataataactaaagaggcaaggtaattctcaggatgatgtaacagaaagtccagactggtgaatgacaatgaagaactacaagaggtttgtactctgaaaagaagaaggaaaaaagtggaactcacagtttgtctaaagtttttgaccatgtttcaagg aagtatatggttctgtgcaaagttagcaaaaggtacattaaaaaaatgagaaaacaacaaaatcaggcaattaccaactaaaagtataaagaatttggtacaaaaaaggaaattaataatacactacatgctaacttgttaacaatttttacatagtaccaatacaataaatacaatgttaatttcaaactgcaattaattatgctg gaaggatgtgggagtgttaagagagttaaattaaaatcttcataacaggaagtcaacagataatacctactgaatatttctactttttggagggatgttgggttggggaactactgtttcatttccttaaagtactatttggctttttaaattgcctgtacacatgcatatgcatacatagtctaaagttaaatttttaaaacca

[0321] The primer sequences involved in the present invention are shown in Table 1.

[0322] Table 1. Primer Sequences

[0323]

[0324]

[0325]

[0326]

[0327] The antibodies involved in this invention are shown in Table 2.

[0328] Table 2. Antibody List

[0329] Primary antibody Dilution Source Catalogue number Histone H3 1 / 5000 Abcam ab1791 β-Tubulin 1 / 5000 DSHB E7 PPARγ 1 / 1000 CST 2435T GAPDH 1 / 5000 CST 2118S FABP1 1 / 1000 BBI D261799 SCD1 1 / 1000 Abcam ab236868 PLIN2 1 / 1000 BBI D161460 IGF2BP2 1 / 1000 Proteintec 11601 FYN 1 / 1000 Abclonal A0086 TRAF3IP2 1 / 1000 Abclonal A6776 Flag 1 / 5000 sigma F7425 Anti-Digoxigenin-AP, Fab fragments 1 / 500 Roche 11093274910

[0330] Example 1: Discovery and identification of a novel LncRNA, GM16364 (Hilnc), regulated by the Hh signaling pathway.

[0331] To identify lncRNAs regulated by Hh signaling, mouse embryonic fibroblast cell line NIH-3T3 cells were treated with SAG (an agonist of SMO) and SHH (Sonic Hedgehog, an Hh ligand) to activate the Hh signaling pathway. Deep RNA sequencing analysis was then performed on SAG / SHH-treated and untreated NIH-3T3 cells, identifying lncRNAs annotated on GENCODE (www.gencodegenes.org) and Ensembl (asia.ensembl.org), as well as some previously unannotated lncRNAs. LncRNAs with very low basal expression levels in NIH-3T3 cells were excluded; the focus was on differentially expressed lncRNAs, particularly those upregulated in SAG and SHH-treated NIH-3T3 cells. Figure 1 A). The results identified 29 lncRNAs that were stably expressed in NIH-3T3 cells and upregulated more than twofold in NIH-3T3 cells treated with SAG and SHH. Figure 1 B and Figure 1 C). To further identify novel lncRNAs directly regulating the Hh signaling pathway, conserved Gli binding sites (GACCACCCA, located at -660 to -652 in the promoter region) were searched near the transcription start sites (±1.5 kb) of upregulated lncRNAs. Among these transcripts, a novel lncRNA, Gm16364, was noted, whose promoter region contains a conserved Gli binding site (C). Figure 1 C). This lncRNA was named Hedgehog signal-induced long non-coding RNA. Hedgehog signaling- i nduced l ong n on c oding RNA, Hilnc, mouse-derived.

[0332] LncRNAs are a novel class of RNAs, and whether they exist as non-coding transcripts in genome annotation requires independent verification. The inventors determined the precise transcript of Hilnc using rapid amplification of cDNA ends (3'- and 5'-RACE) experiments. Figure 2 A). Hilnc was found to be a 779-nucleotide transcript containing three exons (isotype 1), consistent with RNA-seq analysis performed in NIH-3T3 cells. A longer Hilnc isotype (2133 nt, isotype 2) was also detected. Primers targeting these two different isotypes were subsequently designed, and real-time quantitative PCR (qPCR) experiments confirmed that isotype 2 constituted only a small fraction of the total transcripts in NIH-3T3 cells. Figure 2 B). This indicates that in NIH-3T3 cells, Hilnc mainly exists in isoform 1. Hilnc is located at chr10:39432067-39489678 in the mouse genome. Figure 2 C), the full sequences of its two different isoforms are described in the "Sequence Information" section below. Nuclear-cytoplasmic separation experiments were performed in NIH-3T3 cells to separate the nuclear and cytoplasmic components. Histone H3 protein and U6 gene were specifically expressed in the nuclear component, while β-Tubulin protein and GAPDH gene were specifically expressed in the cytoplasmic component. Immunoblotting and real-time quantitative PCR experiments verified the expression of these proteins and genes in each component, thus proving the success of the nuclear-cytoplasmic separation experiment. Based on this, it was found that most Hilnc transcripts are located in the cytoplasm (…). Figure 2(D) Then, the protein coding potential of Hilnc was analyzed using two algorithms for predicting lncRNA coding capacity: Coding Potential Calculator (CPC) and Coding Potential Assessment Tool (CPAT). CPC calculations showed that the protein coding capacities of the two Hilnc isoforms were -1.13484 and -1.07993, while CPAT calculations showed that the protein coding capacities of the two Hilnc isoforms were 0.0105 and -0.0111. Both algorithms indicate that Hilnc lacks any coding capacity. Furthermore, the predicted short open reading frames (ORFs) in Hilnc do not match any known protein or functional protein motifs in the current proteome database, further suggesting that Hilnc is a non-coding transcript.

[0333] To verify the regulatory role of the Hh signaling pathway on Hilnc, NIH-3T3 cells were treated with two different Hh signaling pathway activators (SAG and SHH). Real-time quantitative PCR and RNA fluorescence in situ hybridization (FISH) experiments showed that both SAG and SHH upregulated Hilnc expression in NIH-3T3 cells, and Hilnc was mainly distributed in the cytoplasm (Figures 3A and 3B). To investigate whether the Hh signaling pathway regulates Hilnc through its downstream transcription factor Gli, NIH-3T3 cells were treated with a combination of SAG and GANT61. GANT61 is known to directly inhibit the binding of Gli to DNA and Gli-mediated transcriptional regulation (Lauth, M. et al., Inhibition of Gli-mediated transcription and tumor cell growth by small-molecule antagonists. Proceedings of the National Academy of Sciences, 2007, 104(20): p. 8455). Treatment of NIH-3T3 cells with GANT61 significantly inhibited Hilnc expression, even under conditions of SAG activation. Figure 3 C), which indicates that the Hh signaling pathway can regulate Hilnc through Gli.

[0334] To analyze whether the Gli binding site in the Hilnc promoter region is involved in Gli-mediated regulation of Hilnc expression, pGL3 reporter plasmids containing the Hilnc promoter region were constructed in wild-type (WT), randomly mutant (Mut), and deleted (Del) forms, and luciferase activity was measured. To determine whether Gli1, Gli2, and Gli3 play a major role in regulating Hilnc promoter activity, pGL3 reporter plasmids containing the Hilnc promoter region were co-transfected with Gli1, Gli2, and Gli3 expression plasmids, and luciferase activity was measured. Luciferase activity reporter analysis showed that overexpression of Gli1 or Gli2 significantly increased luciferase activity in reporter plasmids with wild-type Gli binding sites, but failed to induce luciferase activity in reporter plasmids with mutated or deleted Gli binding sites. Figure 4 A and 4B). It was also found that Gli1 can increase luciferase activity in reporter plasmids with wild-type Gli binding sites in a dose-dependent manner. Figure 4 C). This suggests that Hilnc expression is directly regulated by Gli. To further investigate whether Gli1 and Gli2 are directly involved in the transcriptional regulation of Hilnc, Flag-labeled Gli1 or Gli2 was overexpressed in NIH-3T3 cells, and chromatin immunoprecipitation assay (ChIP) was performed using anti-Flag antibodies. Real-time quantitative PCR was then performed, and enrichment of Gli1 and Gli2 proteins was found in the promoter region of Hilnc. Figure 4 D). Furthermore, a transgenic NIH-3T3 cell line was constructed using the CRISPR-Cas9 system, in which the Gli binding site in the Hilnc promoter region was randomly mutated and replaced (3T3-BM, binding site mutant cell line). For example... Figure 4 As shown in Figure E, SAG can induce Gli1 expression in 3T3-BM cells, but failed to induce Hilnc expression. These data indicate that Gli1 and Gli2 activate Hilnc transcription by directly binding to the Gli binding site in the Hilnc promoter region. Hilnc is a lncRNA directly regulated by the Hh signaling pathway and Gli.

[0335] Example 2: Gli1 can directly regulate Hilnc expression in vivo.

[0336] To determine the biological function of Hilnc, its expression in different mouse tissues was examined. Results from real-time quantitative PCR experiments showed that Hilnc was primarily present in isoform 1. Figure 5A), which is consistent with the findings found in NIH-3T3 cells. Figure 2 B). Interestingly, Hilnc is highly expressed in key metabolic organs, such as muscle, adipose tissue, and liver (5A), suggesting its involvement in systemic metabolic processes. The inventors hypothesized that Hilnc might be induced to be upregulated during metabolism. To further investigate this possibility, a high-fat diet (HFD) model was established in mice. Upregulation of Gli1 and Ptch1 expression levels was observed in the liver and white adipose tissue (WAT) of the high-fat-induced mice, demonstrating activation of the Hh signaling pathway in these tissues. However, activation of the Hh signaling pathway was not observed in brown adipose tissue (BAT) and muscle. Figure 5 B-5E). Furthermore, upregulation of Hilnc was also detected in the corresponding tissues activated by the Hh signal (B-5E). Figure 5 (B-5E). This synchronous change suggests that Hilnc is involved in the regulation of metabolic homeostasis by the Hh signaling pathway.

[0337] To further investigate the biological functions of Hilnc and the regulatory mechanism of the Hh signaling pathway on Hilnc in vivo, Hilnc knockout mice were created using the CRISPR-Cas9 system and artificial sperm cell-mediated semi-cloning technology. - / - Hilnc mutant mice (Hilnc) and mice with random mutations at the Gli binding site in the Hilnc promoter region. BM / BM ()( Figure 6 A and 6B). The genotype of these transgenic mice can be identified using primers specific to these transgenic mice. Figure 6 B). Compared to wild-type mice, Hilnc - / - Hilnc expression was completely eliminated in mouse embryonic fibroblasts (MEF) and mouse tissues (such as the liver). BM / BM Hilnc expression was significantly reduced in mice. Figure 6 C and 6D), while Hilnc - / - and Hilnc BM / BM There was no significant difference in Gli1 expression levels between mouse embryonic fibroblasts and mouse tissues between mice and wild-type mice. This finding indicates that the binding of Gli1 to the Hilnc promoter region is crucial for maintaining Hilnc homeostasis. Furthermore, in high-fat induced Hilnc... BM / BM Upregulation of Hilnc expression could not be observed in mouse liver. Figure 6E), and upregulation of Gli1 and Ptch1 expression was observed. These findings suggest that, under both physiological and pathological conditions, Gli1 can regulate the basic or inducible expression level of Hilnc by binding to the Gli binding site in the Hilnc promoter region.

[0338] Example 3, Hilnc BM / BM and Hilnc - / - Mice can resist high-fat induced obesity and fatty liver.

[0339] To investigate the effects of Hilnc on the mouse body, particularly the metabolic system, the effects of Hilnc on the mouse were first examined under a normal diet (NCD). BM / BM and Hilnc - / - The mice were assessed for body weight and various physiological indicators, and their organs were dissected. BM / BM and Hilnc - / - The mice were born at the expected Mendelian ratio, exhibited normal behavior after birth, had no difficulty surviving, and had a weight similar to that of wild-type mice. Figure 7 A and 7B). Under normal diet (NCD) conditions, Hilnc BM / BM and Hilnc - / - The mice gained the same amount of weight as their littermates, including wild-type mice. Figure 7 C and 7D). However, high-fat induced Hilnc BM / BM The weight gain of the mice was significantly delayed compared to that of their littermate wild-type mice. Figure 7 C). In Hilnc - / - The same trend was observed in mice. Figure 7 E and 7F). Therefore, Hilnc BM / BM and Hilnc - / - Mice exhibited some resistance to high-fat-induced obesity. These results suggest that Hilnc plays an important role in regulating high-fat-induced obesity. However, no Hilnc was observed in the mice. BM / BM and Hilnc - / - There were significant differences among mice, and Hilnc BM / BM This approach better reflects the regulatory effect of the Hh signaling pathway on Hilnc, therefore Hilnc is primarily used. BM / BM The mice were then used in the next experiment.

[0340] To further investigate the role of Hilnc in high-fat induced obesity, 12-week-old wild-type and Hilnc-treated animals were subjected to normal diet and high-fat diet treatments for 6 weeks. BM / BM Mice were injected intraperitoneally with glucose or insulin to perform glucose tolerance tests or insulin tolerance tests. Under normal dietary conditions, wild-type mice and Hilnc...BM / BM No significant differences were observed among mice. Figure 8 A and Figure 8 B). Under conditions of a high-fat diet, after intraperitoneal injection of glucose or insulin, Hilnc... BM / BM The mice consistently had lower blood glucose levels than wild-type mice. Figure 8 C and Figure 8 D). These data indicate that Hilnc BM / BM The mice were resistant to high-fat-induced obesity and exhibited glucose tolerance and insulin sensitivity.

[0341] Next, the inventors will study Hilnc under a high-fat diet. BM / BM The reason for the significant reduction in fat deposition in mice. Measurements were taken in 14-week-old wild-type mice and Hilnc mice on normal and high-fat diets, respectively. BM / BM Food intake of mice, WT and Hilnc BM / BM There was no significant difference in food intake among the mice. Figure 9 A). Fecal weight and fecal triglyceride (TG) content were further measured in 14-week-old mice on a high-fat diet, in wild-type and Hilnc mice. BM / BM There were no significant differences among mice. Figure 9 B and 9C). Therefore, wild-type mice and Hilnc under a high-fat diet BM / BM The differential fat accumulation among mice was not caused by their food intake or fat absorption capacity. Subsequently, metabolic cage tests were conducted on wild-type mice on normal and high-fat diets compared to Hilnc mice. BM / BM Activity levels in mice were estimated using indirect calorimetry between wild-type mice on normal and high-fat diets and Hilnc mice. BM / BM The respiratory exchange rate and energy expenditure of mice were studied. The results showed that both genotypes of mice exhibited similar activity levels per unit time, regardless of whether they were on a normal or high-fat diet. Figure 9 D), oxygen consumption and carbon dioxide production ( Figure 9 E). Similarly, wild-type mice on a normal diet and Hilnc BM / BM There was no significant difference in energy expenditure among mice. Figure 9 F). However, under a high-fat diet, indirect calorimetry analysis showed that Hilnc BM / BM The energy expenditure of mice increased. Figure 9 F). These findings suggest that Hilnc BM / BM Resistance to high-fat-induced obesity in mice is associated with increased energy expenditure.

[0342] Then, morphological observation and histological staining were performed on tissues that play an important role in the regulation of nutritional metabolism. At the histological level, high-fat induced wild-type mice and Hilnc... BM / BM There were no significant differences in skeletal muscle and pancreas in mice. Compared with wild-type mice, high-fat induced Hilnc BM / BM Mice have less white fat in their groin area. Figure 10 A). H&E staining of white adipose tissue shows Hilnc under a normal diet. BM / BM There was no difference in fat cell size between mice and wild-type mice. Figure 10 B, left figure), but under high-fat diet conditions, Hilnc BM / BM The adipocytes in the white adipose tissue of mice are smaller in size compared to wild-type mice. Figure 10 B). In high-fat induced wild-type mice and Hilnc BM / BM The most significant histological differences among the various tissues of mice were found in the liver. Figure 10 C). Despite the normal diet, wild-type mice and Hilnc BM / BM The weight of the livers in mice did not differ significantly. Figure 10 C), but wild-type mice on a high-fat diet and Hilnc BM / BM Compared to mice, the liver weight was significantly increased. Figure 10 C). Furthermore, H&E staining, Oil Red O staining, and measurements of total triglycerides (TG) in liver tissue showed that although there were no significant differences between the two genotypes of mice under normal diets, Hilnc mice fed a high-fat diet showed higher levels of triglycerides compared to wild-type mice. BM / BM Fat deposition in the liver of mice was significantly reduced. Figure 10 D-10F). As expected, compared to wild-type mice, Hilnc mice showed improved performance in high-fat induced Hilnc mice. - / - Reduced fat deposition was also observed in the white adipose tissue and liver tissue of mice. Figure 10 G and 10H). Then, it was examined whether the deficiency of Hilnc affected the liver's ability to produce dendritic liver oil (DNL). Figure 10 As shown in I, Hilnc BM / BM The activity of hepatic adipogenesis in Hilnc mice was lower than that in wild-type mice. These data indicate that Hilnc... BM / BM and Hilnc - / - Mice were resistant to high-fat-induced non-alcoholic fatty liver disease, suggesting that Hilnc plays an important role in high-fat-induced hepatic steatosis.

[0343] Example 4: Hilnc regulates lipid accumulation in primary hepatocytes and lipid-lowering-induced hepatic steatosis.

[0344] Since the liver is the core organ of energy metabolism, the Hh signaling pathway plays a crucial role in liver metabolism. Therefore, this study primarily investigates the function of Hilnc in the liver. Oil Red O staining and total triglyceride assays showed that, compared to primary hepatocytes isolated from wild-type mice, Hilnc... BM / BM Primary hepatocytes isolated from mice showed lower lipid accumulation after treatment with 0.5 mM oleic acid (OA). Figure 11 (A and 11B). The methionine and choline-deficient L-amino acid diet (MCD) is another diet, besides a high-fat diet, that can directly induce hepatic steatosis. Hilnc was fed a methionine and choline-deficient diet for one month. BM / BM The mice weighed similarly to wild-type mice. Figure 11 C), but the liver contains less fat ( Figure 11 D and Figure 11 E).

[0345] Adeno-associated virus 8 (AAV-8) has a high affinity for hepatocytes, and can transfect up to 90-95% of hepatocytes in mouse livers after tail vein injection. To investigate the role of Hilnc in high-fat-induced hepatic steatosis, sh-Hilnc-AAV-8 virus, which specifically targets Hilnc, was injected into wild-type mice, followed by a 10-week high-fat diet to produce hepatocyte-specific Hilnc knockout mice. Figure 12 A). ZsGreen fluorescent staining and real-time quantitative PCR experiments showed high transfection efficiency of sh-Hilnc-AAV-8 virus in the liver and successful knockout of endogenous Hilnc in the liver. Figure 12 B and Figure 12 F). Between Hilnc knockout mice fed a high-fat diet for 10 weeks and wild-type mice, there were no significant differences in body weight, glucose tolerance, or energy expenditure (Figs. 12C-12E). However, H&E staining, Oil Red O staining, and liver triglyceride assays showed that Hilnc knockdown in the liver prevented high-fat-induced hepatic steatosis. Figure 12 F and Figure 12 G). Furthermore, compared to primary hepatocytes isolated from wild-type mice, primary hepatocytes isolated from liver Hilnc knockout mice also showed reduced lipid accumulation after oleic acid treatment. Figure 12 H and Figure 12 These results indicate that Hilnc in the liver can affect lipid accumulation in hepatocytes and diet-induced hepatic steatosis.

[0346] To further determine the function and significance of Hilnc in fatty liver disease in vivo, an AAV8 virus capable of overexpressing Hilnc (O / E-Hilnc) was injected into Hilnc via the tail vein. - / - In mice, the mice were then fed HFD for 12 weeks to achieve overexpression of Hilnc in the liver. Figure 13 A). ZsGreen staining and real-time quantitative PCR experiments confirmed the high transfection efficiency of viruses overexpressing Hilnc and the overexpression of Hilnc in the liver. Figure 13 B and Figure 13 C). Hilnc fed a high-fat diet for 10 weeks - / - (AAV-Control) mice and Hilnc - / - No significant differences were observed in (O / E-Hilnc) mice in terms of body weight, glucose tolerance, and energy expenditure. Figure 13 D- Figure 13 F). However, under a high-fat diet, Hilnc expression was restored in the liver. - / - Mice showed better Hilnc than those injected with the control virus (AAV-Control). - / - Mice had higher liver weight and higher levels of total liver triglycerides. Figure 13 (G and 13H). Consistent with this, H&E staining and Oil Red O staining of liver sections showed that, with Hilnc - / - Compared to (AAV-Control) mice, wild-type mice and Hilnc mice - / - The livers of (O / E-Hilnc) mice contain a large number of fat droplets. Figure 13 C), implying Hilnc - / - Overexpression of Hilnc in mouse liver can restore hepatic lipid accumulation. Furthermore, Oil Red O staining and cellular triglyceride assays also showed that Hilnc... - / - Primary hepatocytes isolated from (O / E-Hilnc) mice showed higher levels of oleic acid treatment compared to those from Hilnc mice. - / - Primary hepatocytes isolated from (AAV control) mice showed greater lipid accumulation (Fig. 13I).

[0347] These data confirm the function and significance of Hilnc in the liver in hyperlipidemia-induced hepatic steatosis.

[0348] Example 5: The absence of Hilnc affects the PPAR signaling pathway in the liver.

[0349] To investigate the molecular mechanisms by which Hilnc regulates hepatic steatosis, wild-type mice on normal or high-fat diets and Hilnc-treated mice were subjected to [a study / initiative]. BM / BMGene expression profiling was performed on mouse livers. RNA-seq analysis showed that, under a high-fat diet, Hilnc deficiency led to significant transcriptional reprogramming in the liver compared to wild-type mice. BM / BM In the livers of mice, 702 genes were upregulated and 524 genes were downregulated. Figure 14 A). Under normal dietary conditions, compared to wild-type mice, Hilnc BM / BM Only a small subset of genes showed differential expression in the liver of mice. Figure 14 B and 14C).

[0350] Hilnc under high-fat diet conditions BM / BM KEGG signaling pathway analysis of altered genes in mouse liver revealed that most of these upregulated genes are involved in cytokine-cytokine-receptor interaction signaling pathways, the Jak-STAT signaling pathway, and protein digestion and absorption signaling pathways. Figure 14 D), and the downregulated genes are mainly enriched in multiple signaling pathways related to lipid metabolism, including metabolism-related signaling pathways, fatty acid degradation, exogenous substance metabolism pathways involving cytochrome P450, and the PPAR signaling pathway. Figure 14 E).

[0351] Hilnc under high-fat diet conditions BM / BM Enrichment analysis of downregulated genes in mouse liver showed that these downregulated genes were significantly enriched in the PPAR signaling pathway. Figure 14 E). The PPAR signaling pathway includes many mitochondrial and peroxisome fatty acid oxidation genes (E). Figure 15 A) It can regulate lipid metabolism and adipogenesis, and maintain metabolic homeostasis in many organs. Real-time quantitative PCR and Western blotting experiments confirmed that some PPAR pathway genes play a role in high-lipid-induced Hilnc... BM / BM Downregulation in mouse liver, including Pparγ, Fapp1, Plin2, and Scd1. Figure 15 B and 15C). The inventors also tested wild-type mice and Hilnc mice on a normal diet. BM / BM No significant difference was observed in PPARγ expression in mice. Figure 15 D). Furthermore, Hilnc in Hilnc - / - Overexpression of Hilnc in mouse liver can restore Hilnc - / - Downregulation of PPAR pathway-related genes in mice Figure 15 These results indicate that Hilnc is involved in the regulation of the PPAR signaling pathway under high-fat induction conditions.

[0352] PPAR protein is a lipid sensor that can regulate metabolic processes in response to nutrient input via transcription (Venteclef, N. et al., Metabolic nuclear receptor signaling and the inflammatory acute phase response. Trends Endocrinol Metab, 2011. 22(8): p. 333-43). The inventors observed that high-fat induced wild-type and Hilnc... BM / BM Significant differences were observed in the expression levels of Pparγ in the liver of mice. Figure 15 B and Figure 15 C). Generally, Pparγ expression in human and mouse liver is low, at 10-30% of its expression level in adipose tissue (Semple, RK et al., PPAR gamma and human metabolic disease. J Clin Invest, 2006, 116(3): p.581-9). To verify the function of Pparγ in fatty liver in vivo, the adenovirus sh-Pparγ, which targets Pparγ expression, was injected into wild-type mice via the tail vein to inhibit Pparγ expression in the mouse liver. Figure 16 A). The knockdown efficiency of Pparγ was verified by real-time quantitative PCR (Figure 16B). H&E staining and Oil Red O staining of liver sections showed that Pparγ knockout significantly improved hepatic steatosis. Figure 16 (C and 16D). This indicates that the PPAR signaling pathway is involved in diet-induced hepatic steatosis, and downregulation of the Pparγ gene in hepatocytes can prevent lipid accumulation.

[0353] Subsequently, the possibility of Hilnc affecting the PPAR signaling pathway was tested in vitro. Hilnc was knocked out in oleic acid-treated AML12 mouse hepatocytes by transfecting them with siRNA targeting Hilnc. Real-time quantitative PCR experiments showed that inhibition of Hilnc expression levels reduced the mRNA levels of Pparγ and Fabp1. Figure 16 E). These data indicate a close relationship between Hilnc and Pparγ, and that Hilnc can regulate the mRNA level of Pparγ, thereby affecting the PPAR signaling pathway.

[0354] Example 6: Hilnc can directly bind to Igf2bp2 and can regulate Pparγ through Igf2bp2.

[0355] LncRNAs can regulate gene expression in either cis or trans. Knocking out Hilnc (Hilnc...) - / -) or mutate the Gli binding site in the Hilnc promoter region (Hilnc BM / BM Neither of these studies affected the mRNA expression levels of Fyn and Traf3ip2, genes adjacent to Hilnc, in the liver. Figure 17 A and 17B) and protein levels ( Figure 17 C), suggesting that Hilnc lacks cis-regulatory function. Given that lncRNAs can act as protein recruiters to regulate protein stability and function, an RNA pulldown assay was subsequently performed on whole-cell lysates of AML12 cells using biotin-labeled full-length Hilnc (Hilnc) to identify proteins that can interact with Hilnc. A Hilnc antisense transcript (Ctr-1) and a 760 bp intron transcript (Ctr-2) were used as negative controls. Hilnc-related proteins were then separated by agarose gel electrophoresis and identified by mass spectrometry (MS). Figure 17 D). Among them, insulin-like growth factor 2 mRNA-binding protein 2 (Igf2bp2) was identified as the binding protein of Hilnc. Igf2bp2 is a cytoplasmic mRNA-binding protein (mRBP) that regulates the life cycle of many mRNAs by influencing RNA stability, localization, and translation. RNA pulldown and immunoblotting experiments further confirmed the binding between Hilnc and Igf2bp2 (Figure 17E). RNA immunoprecipitation (RIP) experiments using an Igf2bp2-specific antibody showed that Hilnc was highly enriched in the immunoprecipitation complex of the Igf2bp2 antibody compared to immunoprecipitated samples using immunoglobulin G (IgG) (Figure 17F). To further investigate the specific binding regions in Hilnc that facilitate the interaction between Hilnc and Igf2bp2, Hilnc was divided into different fragments of 1-300bp, 300-535bp, 535-650bp, and 650-779bp based on its predicted spatial structure. RNA pulldown experiments using biotin-labeled Hilnc fragments showed that Hilnc 535-650 bp binds tightly to Igf2bp2. Figure 17 G).

[0356] Next, we determined whether Igf2bp2 is functionally involved in diet-induced hepatic steatosis and Hilnc-mediated regulation of the PPAR signaling pathway. Adenovirus sh-Igf2bp2, which targets Igf2bp2 expression, was injected into wild-type mice via the tail vein to reduce endogenous Igf2bp2 expression in the mouse liver. Figure 18A). The transfection efficiency of the virus and the knockdown efficiency of IgF2bp2 were verified by ZsGreen fluorescent staining and real-time quantitative PCR experiments on liver sections. Figure 18 B and Figure 18 D). H&E staining, Oil Red O staining, and triglyceride measurement of liver sections showed that knockout of Igf2bp2 in the liver significantly improved lipid-lowering-induced hepatic steatosis. Figure 18 (B and Figure 18C), which is consistent with the findings in liver Hilnc or Pparγ knockout mice ( Figure 12 and Figure 16 Real-time quantitative PCR and Western blot experiments showed that knockout of Igf2bp2 also reduced the mRNA and protein levels of Pparγ and Fabp1, but did not affect the expression level of Hilnc. Figure 18 D and Figure 18 E), which means that Igf2bp2 does not participate in regulating Hilnc stability, but may affect the stability of genes related to the PPAR signaling pathway. Oil Red O staining and intracellular triglyceride analysis of primary liver cells showed that, compared with wild-type mice, primary hepatocytes isolated from liver Igf2bp2 knockout mice exhibited reduced lipid accumulation after treatment with 0.5 mM oleic acid. Figure 18 F and Figure 18 More importantly, in primary hepatocytes with Igf2bp2 gene knockout, further knockout or overexpression of Hilnc had no effect on lipid accumulation, while overexpression of Pparγ increased lipid accumulation. Figure 18 F- Figure 18 This indicates that Hilnc can regulate the Ppar signaling pathway and subsequent lipid accumulation in hepatocytes through interaction with Igf2bp2. Photoactively enhanced ribonucleoside crosslinking and immunoprecipitation (PAR-CLIP) sequencing in human embryonic kidney-293 cells showed that IGF2BP2 can bind to thousands of mRNAs, indicating a broad range of gene targets for Igf2bp2. Recent reports have shown that Pparγ is also an Igf2bp2-targeted mRNA in mouse liver. Therefore, Hilnc may be involved in Igf2bp2-mediated posttranscriptional regulation of target mRNAs (e.g., Pparγ). To test this possibility, Hilnc was used in the study of WT cells. - / - or Hilnc overexpression mice (Hilnc) - / -Igf2bp2 antibody immunoprecipitation was performed on liver samples from patients with O / E-Hilnc liver disease. The results showed that Pparγ mRNA, Igf2 mRNA, and Ddx3x mRNA (used as a positive control) were significantly enriched in the Igf2bp2 immunoprecipitated samples, while Fap1 mRNA and Fasn mRNA (used as a negative control) were not enriched in these samples. Figure 18 I). It was also found that the lack of Hilnc reduced the binding of Igf2bp2 to Pparγ mRNA and Igf2 mRNA, while Hilnc... - / - Overexpression of Igf2bp2 in mouse liver can restore the binding of Igf2bp2 to Pparγ mRNA and Igf2 mRNA. Figure 18 The presence or absence of Hilnc does not affect the binding of Igf2bp2 to Ddx3x mRNA. This indicates that Hilnc can bind to Igf2bp2 and participate in the post-transcriptional regulation of certain metabolic genes in the liver (such as Pparγ) mediated by Igf2bp2.

[0357] Example 7: Identification of potential functional homologs of Hilnc in the human genome

[0358] Compared to protein-coding sequences, which are highly conserved throughout vertebrates, lncRNA sequences evolve very rapidly. Only 20% of lncRNAs are preserved between humans and mice, and only 5% between humans and fish. To investigate homologs of Hilnc in the human genome, the inventors performed a detailed analysis of potential transcripts in the human genome that are located relative to Hilnc in the mouse genome (chr6:111605457-111670597), but were unable to identify any transcripts (…). Figure 19 A and Figure 19 B). The sequence of Hilnc was also compared on the NONCODE website (www.NONCODE.org), but no similar sequence was found in human transcripts. The inventors then conducted a more extensive genome screening to determine if Hilnc had potential functional homologs.

[0359] The inventors selected a human hepatocyte cell line (LO2) for screening, which showed significant lipid accumulation after oleic acid treatment. Based on the previously discovered important role of Hilnc in lipid metabolism, RNA-seq was performed on LO2 cells before and after oleic acid treatment to identify upregulated lncRNAs that could respond to lipid accumulation in LO2 cells. The results showed that oleic acid treatment of LO2 cells induced a large number of genes related to lipid metabolism (Figure 20A), including PPARγ and PLIN2. 158 upregulated lncRNAs (Fold Change > 1.5) and 180 downregulated lncRNAs (Fold Change > 1.5) were identified in oleic acid-treated LO2 cells. Figure 20 B). Among the top 100 upregulated lncRNAs, 20 lncRNAs were found to have at least one predicted Gli binding site near their TSS (±3kb) and this site had a high JASPAR score. Figure 20 C). Then, real-time quantitative PCR experiments confirmed that 14 of these 20 lncRNAs were upregulated in oleic acid-treated LO2 cells. Figure 20 D). Next, siRNAs targeting these 14 lncRNAs were synthesized, and the knockout of these lncRNAs was tested to see if they affected lipid accumulation. Among these 14 lncRNAs, knocking out two new lncRNAs, ENST0000450804.3 and ENST0000417084.1, reduced lipid accumulation in oleic acid-treated LO2 cells. Figure 20 E and 20F). Interestingly, knockout of ENST0000417084.1 reduced PPARγ mRNA levels, while knockout of ENST0000450804.3 had no effect on PPARγ mRNA levels. Figure 20 G), which means that ENST0000450804.3 and ENST0000417084.1 may affect lipid accumulation through different mechanisms, and the mechanism of action of ENST0000417084.1 is closer to Hilnc. Therefore, we will pay further attention to ENST0000417084.1 and name it the human Hh signaling pathway-induced long non-coding RNA (h-Hilnc).

[0360] RACE experiments verified the exact sequence of h-Hilnc, revealing it to be a 917-nucleotide transcript containing four exons. Figure 21 A). h-Hilnc is located at chr1:207249067-207309121 in the human genome. Figure 21B), it lacks coding potential and has no predicted mouse homologs. The entire sequence of h-Hilnc is as follows: Figure 21 As shown in C. Similar to Hilnc, RIP experiments show that h-Hilnc can bind to IGF2BP2 ( Figure 21 D), knockout of h-Hilnc also reduces the binding of IGF2BP2 to PPARγ mRNA, while knockout of ENST0000450804.3 does not affect the binding of IGF2BP2 to PPARγ. Figure 21 E). Interestingly, the inventors noted that oleic acid treatment also upregulated the expression of the GLI1 gene in LO2 cells (E). Figure 20 D), which is consistent with the results obtained in mouse liver ( Figure 5 B). This suggests that GLI1 regulates the expression of h-Hilnc.

[0361] To verify this, LO2 cells were treated with a combination of oleic acid and GANT61. It was found that GANT61 significantly inhibited the upregulation of h-Hilnc in oleic acid-treated LO2 cells. Figure 21 This suggests that h-Hilnc is directly regulated by the Hh signaling pathway and GLI1. h-Hilnc has a predicted Gli binding site in its promoter region. The inventors investigated whether the Hh signaling pathway can regulate h-Hilnc expression through the Gli binding site in the h-Hilnc promoter region. Luciferase activity reporter assays showed that GLI1 overexpression significantly increased luciferase activity in the pGL3 reporter plasmid containing the wild-type Gli binding site in the h-Hilnc promoter region. However, when the Gli binding site was mutated, GLI1 overexpression did not induce an increase in luciferase activity in the reporter plasmid. Figure 21 G). To further investigate whether GLI1 directly participates in the transcriptional regulation of h-Hilnc, Flag-labeled GLI1 was overexpressed in LO2 cells, and chromatin immunoprecipitation was performed using an anti-Flag antibody. Real-time quantitative PCR analysis revealed GLI1 protein enrichment in the promoter region of h-Hilnc. Figure 21 These data indicate that h-Hilnc is regulated by the Hh signaling pathway and GLI1, and can affect lipid accumulation by modulating the binding strength of IGF2BP2-PPARγ, suggesting that h-Hilnc is a human functional homologue of Hilnc.

[0362] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims. sequence list <110> Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences <120> Application of Hilnc or its signaling pathways as targets for regulating lipid metabolism <130> 216706 <160> 128 <170> SIPOSequenceListing 1.0 <210> 1 <211> 801 <212> DNA <213> Mouse (Mus musculus) <400> 1 gaactcactg cgtactttga tttcttgatg gctgactatg agtactgaaa actccaaccc 60 ggcagcgtgt agtgctgtgt gcctctcctt atagagttaa actcagccag gcctgcccga 120 gagaaaccct aaactggcgc cacattcctg ctggaactct gtcacagtct cagctcaaac 180 tggcctccag atggacaagg tgaagagaca gaggtcatac ccatgaggaa gaggctcttg 240 gcagacatgg aatctactgt caccttattc ttggattctt aagcctcgta aacactgagt 300 gagtccagct ggacctgtca atcacctcgc ctggagacta cccctcagga aaactgattc 360 acctgaagat gttacagaga tgggggaaat aattattctc ttaatgagat aacatgtgtg 420 tacctccctg agaagtccct ccctcagtcc agctgtttgc agatctttcc tactaagaca 480 gcctgctttc cccagttcta actccaaaac tgtaacttct cctttcccct tgtctcatct 540 ttggctaaag gccaaaacct cctcctgctt ccaacctctg tacactctct ttctttaacc 600 ccctccaagc cccagttact tggcgccctt ccttgcagaa cctgccaact ctcctgaaac 660 ctacctcgga aggcatgtca tgctctcctc tccagctccc ctttccaggc agcagttgag 720 gtttgtagct tcctgacctt gtggtttact cctgagcgcc aataaaagag tccacaagct 780 tccaaaaaaa aaaaaaaaaa a 801 <210> 2 <211> 2133 <212> DNA <213> Mouse (Mus musculus) <400> 2 gaactcactg cgtactttga tttcttgatg gctgactatg agtactgaaa actccaaccc 60 ggcagcgtgt agtgctgtgt gcctctcctt atagagttaa actcagccag gcctgcccga 120 gagaaaccct aaactggcgc cacattcctg ctggaactct gtcacagtct cagctcaaac 180 tggcctccag atggacaagg tgaagagaca gaggtcatac ccatgaggaa gaggctcttg 240 gcagacatgg aatctactgt caccttattc ttggattctt aagcctcgta aacactggta 300 ctctctccag acctcccaaa gtccagggaa tatatgaaca attctacgca ctggctgaaa 360 420 agtgcaacag aatagctgtc ttccaaccaa ccaaaggcca gaacacacgt gggtgggcgg 480 ccctgcaaac ctgccacttc tgcagtgaac ctttgcaatg gtcaagatgt tctggctcag 540 caaggactca gaacaaccag gaggtttgga gagccactcc atggatcaga gtacaaatgt 600 ggagcagagg gatactgacc agagggtaca gatggagatg areactgac cctgaagaga 660 caataattac tagttttgtt tactgttagc cccctcacca gtcacctggg gcagcagttt 720 ttataaaac cgctgtatta ataaatcag aaatgctggt tgggagagct gcggcacaca 780 aagccacgtc agccaaga aaccttgcag gggaggagac agcattccga gctctctgaa 840 ggaacacagt gtactgcagt gctttggccc tggggcccat gggctggga ggcagaggac 900 ccatcatgca ctgctaagag tctactgtgg gcagacactg ctgggaatca gaatggaa 960 gatgccccgt tcctctcaag gaggcagag ctgccgggag tccagacag gaggcagggag 1020 agagaccctct gtgaggttga tgtcagcttg gtctacatag ccactctcg gctaacccag 1080 tgagatgctg tcatagacaa attccttggg gtgtccaaga tgtaaggga gagagacagc 1140 agagacaccc gaagtcaagt cttcccctca cactgctcac tgcacacacg ttaggagaac 1200 actcacacct acatacaca gctacaccta aggctccgga cactgcaag aggaggcaga 1260 aagactctaa gagccagggg accagcattc tgtgaggttt tgtctcctag taacatcaga 1320 agctacgcct gtaaagtctc accagcatca ctgcctaaac atgacctgac gaaggaggac 1380 accaatggtt atgtcaactg aatggaaaaa aagcccaatg agacctgaac cctacacaa 1440 aactattggc aactgagtga agctggagcg agaggtggcc ctcccaggg aaagcacac 1500 siactcgtca tctagtgtgg aatgtgaca caagcaaccc tgtaggact tagcaggctg 1560 tattagaaa tatatatgca tgtgtataca gandacatcta tgcatgcaat atcaatgat 1620 gaaaaagag gctatgagtt tgaaagagtg tgtggggagg ggtaactagg aaggtttaga 1680 aggaggaag gccaaggaga aacattgtaa cgagaataca agctcaaac taaaccccaa 1740 caaaagagt aaaaagcatg cttgctca acccacaag cccaccagtca tcgctccagg 1800 cctctggctc cctggctcct tggctccctg caggtggcac agtgccccta gacccacc 1860 tggcccagg ctagctccta tcagttat agtcagcgag cacctcttag tgactccac 1920 tgtcaccatc tcctaccac attccttt tgctccactc atgctacta gccagggtga 1980 gtgtagtttg ttggtttgta ttgcctatat tctcaagaa aaaaaaaacg ttcctgaggg 2040 caggaactct cgtgttactt cactgctata atccttgggt ctggaaaagc actcaatgca 2100 glasses tcataaata ttgtgatt tgt 2133 <210> 3 <211> 917 <212> DNA <213> Homo sapiens <400> 3 ttcttgtgat tagcaatca ggacagttc tcagctaatc agtacaggaa gagagccta 60 tggtaacaga caataaagga acagcttgca gacggcctat cgtgagactt tgccttgtga 120 tcatattaca agactgaata agatagacat gacctccttc ctcctggacc tgacaattgt 180 tccttcaaat cacttccaca catgcattgc ctggggactg gggactgggg tctggatccc 240 atggccagac caaccccaa aggaagctat tggaatac acaccttcga atgcggaga 300 atatagaa aaggagaca agagttcaag aaagccaggca tccacaata ataactaag 360 aggcaggta attctcagga tgatgtaca gaagtccag actggtgaat gatatgaag 420 aactacaaga gtttgtact ctgaaaagaa gaaggaaaaa agtggaactc acagtttgtc 480 taaagttttt gaccatgttt caggaaggta tattggttctg tgcaagtta gcaaaggta 540 cattaaaaaa atgagaaac aaaaaatca ggcaattacc aactaaagt ataagaatt 600 tggtacaaaa aaggaaatta atatacact acatgctaac ttgttaacaa tttttacata 660 gtaccaatac aaaataca atgttaattt caaactgcaa ttaattatgc tggaaggatg 720 tgggagtgtt aagagagtta aattaaaatc ttcatacag gaagtcaca gataatacct 780 actgaatatt tctactttt ggagggatt tggttgggg aactactgtt tcattcctt 840 aaagtactat ttggtttt aaattgcctg tacacatgca tatgcataca tagtctaaag 900 ttaaattttt aaaacca 917 <210> 4 <211> twenty three <212> DNA <213> Artificial Sequence <400> 4 ccattatggt agtacccttc tgg 23 <210> 5 <211> twenty three <212> DNA <213> Artificial Sequence <400> 5 gcttcgtaag tgatagacac tgg 23 <210> 6 <211> twenty three <212> DNA <213> Artificial Sequence <400> 6 aggtttattg ctcaggcgtg tgg 23 <210> 7 <211> twenty three <212> DNA <213> Artificial Sequence <400> 7 ttccactctc tggtacccgc agg 23 <210> 8 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 8 ccuaaacugg cgccacauut t 21 <210> 9 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 9 ggguaaagug gaauugcaut t 21 <210> 10 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 10 gaaguucaau gcacuggaat t 21 <210> 11 <211> 17 <212> DNA / RNA <213> Artificial Sequence <400> 11 ccuaacugcg ccacauu 17 <210> 12 <211> 15 <212> DNA / RNA <213> Artificial Sequence <400> 12 ggucuaccac augag 15 <210> 13 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 13 uucucucgca acgugucaca u 21 <210> 14 <211> 15 <212> DNA / RNA <213> Artificial Sequence <400> 14 caggaucaua auatt 15 <210> 15 <211> 13 <212> DNA / RNA <213> Artificial Sequence <400> 15 caggagauaa utt 13 <210> 16 <211> 16 <212> DNA / RNA <213> Artificial Sequence <400> 16 gagcucugag cauatt 16 <210> 17 <211> 18 <212> DNA / RNA <213> Artificial Sequence <400> 17 ggugcaucau uguguatt 18 <210> 18 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 18 ggcagacatg gaatctactg tc 22 <210> 19 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 19 ttcttgtgat tagcaatcaa 20 <210> 20 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 20 cttaaagtcc atgagtcgct tg 22 <210> twenty one <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> twenty one ttgtcattca ccagtctgga 20 <210> twenty two <211> twenty three <212> DNA / RNA <213> Artificial Sequence <400> twenty two cagatggaca aggtgaagag aca 23 <210> twenty three <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> twenty three aggtgattga caggtccagc 20 <210> twenty four <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> twenty four ctggacctgt caatcacctc g 21 <210> 25 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 25 gggacttctc agggaggtac a 21 <210> 26 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 26 tggaagagtg ggagttgctg 20 <210> 27 <211> twenty four <212> DNA / RNA <213> Artificial Sequence <400> 27 gagaaacctg ccaagtatga tgac 24 <210> 28 <211> 19 <212> DNA / RNA <213> Artificial Sequence <400> 28 ccgccgccat gtctctagt 19 <210> 29 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 29 ctttcctcaa caccacatga gc 22 <210> 30 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 30 gggccatgct aatcttctct g 21 <210> 31 <211> 18 <212> DNA / RNA <213> Artificial Sequence <400> 31 tcgcttcggc agcacata 18 <210> 32 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 32 gggccatgct aatcttctct g 21 <210> 33 <211> twenty three <212> DNA / RNA <213> Artificial Sequence <400> 33 aaggtgaaga gcatcataac cct 23 <210> 34 <211> twenty three <212> DNA / RNA <213> Artificial Sequence <400> 34 tcacgccttt cataacacat tcc 23 <210> 35 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 35 ggaggtggtg atagccggta t 21 <210> 36 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 36 tgggtaatcc atagagccca g 21 <210> 37 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 37 tcgctgatgc actgcctatg 20 <210> 38 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 38 gagaggtcca cagagctgat t 21 <210> 39 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 39 gaccttgtgt cctccgctta t 21 <210> 40 <211> 19 <212> DNA / RNA <213> Artificial Sequence <400> 40 caaccgcaat ttgtggctc 19 <210> 41 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 41 atgaacttct ccggcaagta cc 22 <210> 42 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 42 ctgacacccc cttgatgtcc 20 <210> 43 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 43 gtggaaagta gaccggaacg a 21 <210> 44 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 44 ccatcctgtg tgattgtcag tt 22 <210> 45 <211> twenty three <212> DNA / RNA <213> Artificial Sequence <400> 45 tttagcccta caaggtactt gga 23 <210> 46 <211> 19 <212> DNA / RNA <213> Artificial Sequence <400> 46 gcagccactg ccttcgtaa 19 <210> 47 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 47 gcttgcaact gtcagcacat 20 <210> 48 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 48 gccttgctgt agccaagaac 20 <210> 49 <211> twenty three <212> DNA / RNA <213> Artificial Sequence <400> 49 aaagcctcta ggtttctttg cca 23 <210> 50 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 50 cctcaggatc aaagtgaggc g 21 <210> 51 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 51 ctgtacggga tcatactggt tc 22 <210> 52 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 52 gccgtgcctt gtaagttctg 20 <210> 53 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 53 caagatgaag cctgcgaatg a 21 <210> 54 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 54 acctggcgta attgtgtcca c 21 <210> 55 <211> 19 <212> DNA / RNA <213> Artificial Sequence <400> 55 gtgctgcatc gctgcttac 19 <210> 56 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 56 cggtccgaac agacaaactg 20 <210> 57 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 57 tgttcctctt aatcctgccc a 21 <210> 58 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 58 ccaacctgca caagttccct t 21 <210> 59 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 59 tcccgtggag gttgatgaat c 21 <210> 60 <211> twenty three <212> DNA / RNA <213> Artificial Sequence <400> 60 tcagggtgcc ttctaaagaa act 23 <210> 61 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 61 acctccatcc cgaactacaa c 21 <210> 62 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 62 cgccacaaac agtgtcactc 20 <210> 63 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 63 gtcctactca agtccggcta c 21 <210> 64 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 64 catattcagc caacagccca t 21 <210> 65 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 65 agcagttttg gatctcgtag tg 22 <210> 66 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 66 actgtttcca ccacgttcaa at 22 <210> 67 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 67 gagtcaacgg atttggtcgt 20 <210> 68 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 68 gacaagcttc ccgttctcag 20 <210> 69 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 69 catgtacgtt gctatccagg c 21 <210> 70 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 70 ctccttaatg tcacgcacga t 21 <210> 71 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 71 ttgcagttgc caatacctat gc 22 <210> 72 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 72 ccagtcacag tagtcgtcac a 21 <210> 73 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 73 gggatcagct ccgtggatct 20 <210> 74 <211> twenty three <212> DNA / RNA <213> Artificial Sequence <400> 74 tgcactttgg tactcttgaa gtt 23 <210> 75 <211> 15 <212> DNA / RNA <213> Artificial Sequence <400> 75 gctgcgctgc cgtgg 15 <210> 76 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 76 ggtgtgggga cactctgtct 20 <210> 77 <211> 19 <212> DNA / RNA <213> Artificial Sequence <400> 77 gtggcatcgt tgaggagtg 19 <210> 78 <211> 19 <212> DNA / RNA <213> Artificial Sequence <400> 78 cacgtccctc tcggacttg 19 <210> 79 <211> twenty three <212> DNA / RNA <213> Artificial Sequence <400> 79 aaggacctgt ctaggtttga tgc 23 <210> 80 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 80 tggcttcata ggtgacttcc a 21 <210> 81 <211> twenty three <212> DNA / RNA <213> Artificial Sequence <400> 81 atagacatga cctccttcct cct 23 <210> 82 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 82 aggcaatgca tgtgtggaag 20 <210> 83 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 83 tgctgaagag cagggattcg 20 <210> 84 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 84 actgaggttt gcactcctgg 20 <210> 85 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 85 cggtttgggg caaatcaagt 20 <210> 86 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 86 gcaccctcca gaacttcgag 20 <210> 87 <211> 19 <212> DNA / RNA <213> Artificial Sequence <400> 87 agaggaacgc ttgctcacc 19 <210> 88 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 88 gccttgtgag tgcctcctac 20 <210> 89 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 89 gatcgccaca cttctccctg 20 <210> 90 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 90 tgtgtgttta agcttggtgc g 21 <210> 91 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 91 gacagtcctc gttgtgttcg 20 <210> 92 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 92 ctgaagatca cgcagaagcc 20 <210> 93 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 93 ctccgtgtgc ccattacctt 20 <210> 94 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 94 cagggcgagg cgaatagaaa 20 <210> 95 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 95 agtgtctgaa gcccaatgac tt 22 <210> 96 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 96 acagccccct cattaggact 20 <210> 97 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 97 attgctgggg ttcagagacg 20 <210> 98 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 98 gccagatgtc tgggtgtgaa 20 <210> 99 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 99 cactttcatg gcgtcccctc 20 <210> 100 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 100 caagactcca gcagtgacga 20 <210> 101 <211> 19 <212> DNA / RNA <213> Artificial Sequence <400> 101 cagcaggcac ccttggtaa 19 <210> 102 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 102 aactctcgtg ctgtatgtgc t 21 <210> 103 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 103 gcgctttaca ctgcctgatg 20 <210> 104 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 104 gctgagagtt ctgaggccag 20 <210> 105 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 105 aatctgccgt cctttcctgg 20 <210> 106 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 106 gcattggatt gcggatgacc 20 <210> 107 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 107 cttctcacgg gcaaaccctc 20 <210> 108 <211> 19 <212> DNA / RNA <213> Artificial Sequence <400> 108 ctcgagaagt gccagtccg 19 <210> 109 <211> 28 <212> DNA / RNA <213> Artificial Sequence <400> 109 ggggtaccag aagcaaaggc cttcctaa 28 <210> 110 <211> 29 <212> DNA / RNA <213> Artificial Sequence <400> 110 cccaagctta gggccagcct gggtgacgt 29 <210> 111 <211> 28 <212> DNA / RNA <213> Artificial Sequence <400> 111 ccctcgagag ttattttgaa acataccc 28 <210> 112 <211> 30 <212> DNA / RNA <213> Artificial Sequence <400> 112 ccaagcttca tataatgtca gtgctctata 30 <210> 113 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 113 agcaaaggcc ttcctaatgc 20 <210> 114 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 114 aaaccaaggc cagggtagtc 20 <210> 115 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 115 aatgcactag tagcaggggt 20 <210> 116 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 116 gaaaccaagg ccagggtagt 20 <210> 117 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 117 ggcagtcaag agataaggga 20 <210> 118 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 118 atatctcagt ggttgtgaag gg 22 <210> 119 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 119 gctcacacct gtaatcccag 20 <210> 120 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 120 gagtagctgg gactacaggc 20 <210> 121 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 121 tacgtcagta gtgctccctg 20 <210> 122 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 122 aaggcaagaa ggtccctaat 20 <210> 123 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 123 ttgcaaattt ccctggaggg t 21 <210> 124 <211> 19 <212> DNA / RNA <213> Artificial Sequence <400> 124 attcacagct agccattgg 19 <210> 125 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 125 cttaaagtcc atgagtcgct tg 22 <210> 126 <211> 17 <212> DNA / RNA <213> Artificial Sequence <400> 126 gagagaacat ggattgg 17 <210> 127 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 127 caagtttaga caccaccatg g 21 <210> 128 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 128 caagtttagg atgcatgtta gg 22

Claims

1. Hilnc The use of downregulators is for preparing pharmaceutical compositions for treating hyperlipidemia-induced obesity and non-alcoholic fatty liver disease; in, The aforementioned Hilnc lncRNAs having the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3; Among them, the Hilnc Down-regulators are selected from: (a) Target Hilnc The Gli binding site in the promoter region, and the downregulators that prevent Gli binding, the aforementioned Hilnc The Gli binding sites in the promoter region include: Hilnc The promoter from position -660 to -652 is a downregulatory sgRNA used in CRISPR gene editing reagents, and its nucleotide sequence is shown in SEQ ID NO:

4. (b) Targeting Hilnc The upstream sgRNA used for CRISPR gene editing reagents has nucleotide sequences as shown in SEQ ID NO:5, 6 and 7; (c) Targeting Hilnc The shRNA, whose nucleotide sequence is shown in SEQ ID NO: 8; (d) Targeting Hilnc The siRNA, whose nucleotide sequences are shown in SEQ ID NO: 11 and SEQ ID NO: 12; (e) Targeting Hilnc The siRNA has nucleotide sequences as shown in SEQ ID NO: 14 and SEQ ID NO:

15.

2. Specific detection Hilnc The reagent for expressing the expression level is used to prepare a kit for analyzing high-fat-induced obesity and non-alcoholic fatty liver disease; the reagent is: specific amplification. Hilnc Primers that specifically recognize Hilnc probes, or specific recognition Hilnc The chip; in, The aforementioned Hilnc lncRNAs having the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO:

3.

3. The use as described in claim 2, characterized in that, The reagent is included in the kit.

4. A method for screening candidate substances for treating hyperlipidemia-induced obesity and non-alcoholic fatty liver disease, characterized in that, The method includes: (1) Add the substance to be screened to the expression Hilnc In the system; the aforementioned Hilnc lncRNAs having the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3; (2) Detect the system and observe its contents. Hilnc The expression of the substance to be screened can be inhibited. Hilnc The expression of indicates that the substance to be screened is a candidate substance that can be used to treat hyperlipidemia-induced obesity and non-alcoholic fatty liver disease.

5. The method as described in claim 4, characterized in that, The method also includes setting up a control group to clearly distinguish the test group from the control group. Hilnc The difference in expression compared to the control group.

Images