Specific molecular marker primers and kit for Jinxiang 194 strain and their application

Abstract

The invention discloses a Jinxiang 194 strain-specific molecular marker primer, a kit and an application thereof, wherein the primer pair is named PF3-R1; the upstream primer sequence thereof is: 5'-GGAGAGGGAGAGAGAAAACGA-3'; and the downstream primer sequence is: 5'-AGAGAGGGAAGAGGAGAAGAG-3'. The molecular marker primer pair PF3-R1 of the invention has strong specificity, can specifically amplify the genomic DNA of the shiitake mushroom strain Jinxiang 194, and has no amplification effect on other shiitake mushroom strains. The specific molecular marker primer pair PF3-R1 can be used to quickly and accurately identify the shiitake mushroom strain Jinxiang 194.

Description

[Technical field]

[0001] The invention relates to the technical field of microorganisms, and in particular to a Jinxiang 194 strain-specific molecular marker primer, a kit and applications thereof. [Background technology]

[0002] The shiitake mushroom strain Jinxiang 194 is a new strain selected and bred by the applicant. Compared with the existing shiitake mushroom strains, the strain has the characteristics of strong alkali resistance and good anti-fungal ability. Through experiments, it is found that the acidity range of the mycelium growth of the strain is pH4-11, and the most suitable pH is 4-8. The alkali resistance ability is much higher than that of the existing shiitake mushroom varieties promoted for cultivation; the mycelium of the strain grows vigorously in the culture medium with the pH adjusted to 9 by lime, the infection rate of the fungus sticks is low, and the success rate of the fungus sticks reaches 97-100%. At present, the identification of shiitake mushroom strains is generally carried out from the morphology, properties and physiological characteristics, and the shiitake mushroom strains are easily affected by the planting environment and human subjective factors, resulting in inaccurate identification of shiitake mushroom strains. Therefore, the study of an effective identification method for the shiitake mushroom strain Jinxiang 194 is of great significance for the further genetic improvement research and production promotion and cultivation of the strain.

[0003] The present invention aims to design specific primers on the basis of the original ISSR genetic difference analysis, establish the specific molecular marker of Jinxiang 194, and use the molecular marker to simply, quickly and clearly identify the strain. [Summary of the invention]

[0004] The invention overcomes the technical problem that the identification results of Lentinus edodes species are unstable and inaccurate in the prior art by identifying Lentinus edodes species based on morphology, traits and physiological characteristics, and provides Jinxiang 194 strain-specific molecular marker primers, a kit and applications thereof.

[0005] To solve the above problems, the present invention adopts the following technical solutions:

[0006] A molecular marker primer pair specific to Jinxiang 194 strain, the primer pair is named PF3-R1;

[0007] The upstream primer sequence is: 5'-GGAGAGGGAGAGAGAAAACGA-3';

[0008] The downstream primer sequence was: 5′-AGAGAGGGAAGAGGAGAAGAG-3′;

[0009] The Jinxiang 194 Lentinula edodes is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with a deposit number of CGMCC No.40137 and a deposit date of April 24, 2022.

[0010] The present invention also includes a kit, which comprises the primer pair.

[0011] A method for identifying a shiitake mushroom strain Jinxiang 194 from multiple shiitake mushroom strains by using the primer pair, the method comprising: extracting total DNA of the shiitake mushroom strain to be identified, performing PCR amplification by using the primer pair PF3-R1, and determining that the strain is the shiitake mushroom strain Jinxiang 194 when a 345bp fragment is amplified; the preservation number of the shiitake mushroom strain Jinxiang 194 is: CGMCC No.40137.

[0012] Furthermore, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 50 s, 25 cycles, fill-in at 72°C for 7 min, and storage at 4°C; the PCR reaction system used in the PCR amplification is as follows in 20 μL: 2×Es TaqMasterMix 10 μL, ddH2O 7 μL, 10 μmol / L upstream primer 1 μL, 10 μmol / L downstream primer 1 μL, and 1 μL of genomic DNA of the mushroom strain to be tested.

[0013] Furthermore, the nucleic acid sequence of the specific fragment amplified by the primer pair PF3-R1 is shown in the sequence listing SEQ ID NO: 3.

[0014] Compared with the prior art, the present invention has the following beneficial effects: the primer pair PF3-R1 of the present invention has strong specificity, can specifically amplify the DNA extracted from the shiitake mushroom strain Jinxiang 194, and can amplify a 345bp fragment, while having no amplification effect on other shiitake mushroom strains. Using the primer pair PF3-R1, the molecular marker screening and identification method of the present application can simply, quickly and accurately screen and identify the shiitake mushroom strain Jinxiang 194, which is of great significance to the market promotion of the shiitake mushroom strain Jinxiang 194.

Brief Description of the Drawings

[0015] Figure 1-2 This is an ISSR genetic difference diagram between the Jinxiang 194 strain of the present invention and other Lentinus edodes strains; in the figure, Maker is DNA maker, and lanes 1-15 are respectively: the Lentinus edodes varieties in lanes 1-15 are respectively: 508, Lentinus edodes 808, Yexiang No. 3, Yexiang No. 4, Yexiang No. 7, Qihe No. 2, Qihe No. 9, Qingke 20, Jinxiang 194, Qingke 212, Kunming No. 1, Shenxiang 17, Guanxiang No. 1, Xiangza 6-1, and Xiangza 107-2. Figure 2 The primer used was XG-ISSR9, Figure 3 The primers used were XG-ISSR15;

[0016] Figure 3The amplification effect diagram of primer pair PF1-R1, primer pair PF1-R3, primer pair PF3-R1, primer pair PF3-R3 and primer pair PF2-R2 on Kunming No. 1, 194, 808 and Yexiang No. 7;

[0017] Figure 4-5 This is a diagram showing the amplification effect of primer pair PF3-R1 on 15 mushroom varieties. In the figure, Maker is DNAmaker, Figure 4 Lanes 1-4 are: Shiitake 808, Jinxiang 194, Kunming 1 and Yexiang 7. Figure 5 The lanes 1-15 are: 508, Xianggu 808, Yexiang No. 3, Yexiang No. 4, Yexiang No. 7, Qihe No. 2, Qihe No. 9, Qingke 20, Jinxiang 194, Qingke 212, Kunming No. 1, Shenxiang 17, Guanxiang No. 1, Xiangza 6-1, Xiangza 107-2. [Specific implementation method]

[0018] The present invention will be further described below in conjunction with examples and tests.

[0019] Embodiment 1:

[0020] ISSR primers (XG-ISSR9: VHVGTGTGTGTGTGTGTGT and XG-ISSR15: AGAGAGAGAGAGAGAGG) were used to perform PCR amplification on the Lentinus edodes varieties in Table 1, wherein the PCR amplification reaction system was: (20 μL): 2×Es TaqMasterMix (Dye) 10 μL, ddH2O 8 μL, primers (10 μmol / L) 1 μL, DNA template 1 μL;

[0021] The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 54°C for 45 s, extension at 72°C for 90 s, 35 cycles, fill-in at 72°C for 7 min, and storage at 4°C.

[0022] Among them, the PCR pattern of Lentinus edodes strain amplified by primer XG-ISSR9 is as follows Figure 1 The PCR pattern of the Lentinus edodes strain amplified by primer XG-ISSR15 is shown in Figure 2 As shown;

[0023] Figure 1-2 In the table, Marker is a DNA marker. The mushroom varieties in lanes 1-15 are: 508, Lentinula 808, Yexiang 3, Yexiang 4, Yexiang 7, Qihe 2, Qihe 9, Qingke 20, Jinxiang 194, Qingke 212, Kunming 1, Shenxiang 17, Guanxiang 1, Xiangza 6-1, Xiangza 107-2. (The strain sources are shown in Table 1)

[0024] Compare the spectra to find the specific band of Jinxiang 194.

[0025] The specific band of the Jinxiang 194 strain in the amplification map was recovered using primer XG-ISSR15 and sequenced. The results are as follows:

[0026] AGAGAGAGAGAGAGGAAGACAGGGAAAGGGAGAGGGAGAGAAAACGATATCACCCCGCTCCTGCTCCTGGTCCGGCTCCGACTCCCACTTCTTCTTCGACTCCTCCTATTCGTCTTCTCATAATGAGTCTTCGTCTTCATCGTCTTCGTCTCTAAGGAGTGATATTCGGAATGGATTTCCCAATGGA ATTCACAGCAATATAAAGAGTGGTACAAAAAGTGGTATTCGGAACGACACAAAAAACGGTACGAGAAATAGCACAAAAAATCCTACTACTCGAACCGGCACCCCAAGAACCGAAGAAGAATTAGTTAGGCGGTTGAACGAGGTGAGTTGCATTCCTTCTCTTCTCTTCTCCTCTTCCCTCTCTCTCTCTCT

[0027] 2. Design 5 pairs of specific molecular marker primers based on the sequencing results:

[0028] (1) Primer pair PF1-R1, upstream sequence: 5′-GAGAGAGGAAGACAGGGAAAG-3′; downstream sequence: 5′-AGAGAGGGAAGAGGAGAAGAG-3′;

[0029] (2) Primer pair PF1-R3, upstream sequence: 5′-GAGAGAGGAAGACAGGGAAAG-3′; downstream sequence: 5′-GGAATGCAACTCACCTCGTTC-3′;

[0030] (3) Primer pair PF3-R1, upstream sequence: 5′-GGAGAGGGAGAGAGAAAACGA-3′; downstream sequence: 5′-AGAGAGGGAAGAGGAGAAGAG-3′;

[0031] (4) Primer pair PF3-R3, upstream sequence: 5'-GGAGAGGGAGAGAGAAAACGA-3'; downstream sequence: 5'-GGAATGCAACTCACCTCGTTC-3';

[0032] (5) Primer pair PF2-R2, upstream sequence: 5'-CACTTCTTCTTCGACTCCTTCC-3'; downstream sequence: 5'-AGGAATGCAACTCACCTCGTTC-3'.

[0033] Screening and verification of the specific molecular markers designed above:

[0034] (1) Five pairs of primers were used to verify PCR amplification of four Lentinus edodes strains: Kunming No. 1, Jinxiang 194, Lentinus 808 and Yexiang No. 7. The PCR reaction conditions were: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 60 s, 30 cycles, 72°C fill-in for 7 min, and storage at 4°C. The PCR amplification results are shown in Figure 2. Figure 4 As shown: Figure 4 In the figure, the marker is a DNA marker, and the lanes 1-4 are: Kunming No. 1, 194, Xianggu 808 and Yexiang No. 7.

[0035] from Figure 3 As can be seen, the primer pair PF3-R1, upstream sequence: 5'-GGAGAGGGAGAGAGAAAACGA-3' (SEQ ID NO: 1); downstream sequence: 5'-AGAGAGGGAAGAGGAGAAGAG-3' (SEQ ID NO: 2) has good specificity.

[0036] The above primer pair PF3-R1 was further verified. The PCR reaction conditions for verification were: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 60 s, 30 cycles, 72°C fill-in for 7 min, and storage at 4°C. The reaction system was calculated as 20 μL: 2×Es TaqMasterMix 10 μL, ddH2O 7 μl, 10 μmol / L upstream primer 1 μl, 10 μmol / L downstream primer 1 μl, and 1 μL of genomic DNA of the mushroom strain to be tested. The amplified product obtained was as follows: Figure 4 As shown:

[0037] Figure 4 In the figure, the marker is a DNA marker, and lanes 1-4 are respectively: Lentinula 808, Jinxiang 194, Kunming 1, and Yexiang 7; Figure 4 It can be seen that a specific band only appears at the 345 bp position in the second lane (i.e., the Lentinus edodes strain Jinxiang 194), and no specific band appears in other lanes.

[0038] The above primers were used to verify PF3-R1 and more varieties of Lentinus edodes. The PCR reaction conditions for verification were: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 50 s, 25 cycles, 72°C fill-in for 7 min, 4°C storage, and the reaction system was 20 μL: 2×Es TaqMasterMix 10 μL, ddH2O 7 μl, 10 μmol / L upstream primer 1 μl, 10 μmol / L downstream primer 1 μl, and 1 μL of genomic DNA of the Lentinus edodes strain to be tested; the amplified product obtained was as follows: Figure 5 As shown:

[0039] Figure 5 In the figure, Marker is a DNA marker, and lanes 1-15 are: 508, Lentinula 808, Yexiang No. 3, Yexiang No. 4, Yexiang No. 7, Qihe No. 2, Qihe No. 9, Qingke 20, Jinxiang 194, Qingke 212, Kunming No. 1, Shenxiang 17, Guanxiang No. 1, Xiangza 6-1, Xiangza 107-2.

[0040] from Figure 5 It can be seen that among the 15 mushroom varieties, except for Figure 5 Except for the specific band appearing at the 345bp position of the 9th lane (i.e., the shiitake mushroom strain Jinxiang 194), no specific bands appeared in other lanes. This shows that the primer pair PF3-R1 of the present application can have specific recognition for the shiitake mushroom strain Jinxiang 194, and can distinguish Jinxiang 194 shiitake from other shiitake mushroom strains.

[0041] The DNA fragment amplified by primer pair PF3-R1 was sequenced, and a fragment of 345 bp was obtained. The fragment was contained in the DNA fragments recovered from the gel. The nucleic acid sequence of the specific fragment is shown in SEQ ID NO: 3 in the sequence table.

[0042] In the above experiment, the sources of the mushroom strains used in the examples are shown in Table 1 below:

[0043] Table 1 15 mushroom species in specific detection

[0044] serial number Strain name Strain source serial number Strain name Strain source 1 508 Commercially cultivated strains in Guangxi 9 Kunming No.1 Introducing commercial cultivation strains from Kunming 2 Mushroom 808 Commercially cultivated strains in Guangxi 10 Shenxiang 17 Introducing commercial cultivation strains from Shanghai 3 Wild Fragrance No.3 Guangxi wild strains 11 Guanxiang No.1 Guangxi wild strains 4 Wild Fragrance No.4 Guangxi wild strains 12 Fragrant miscellaneous 6-1 The applicant unit hybridizes and breeds strains 5 Wild Fragrance No.7 Guangxi wild strains 13 Fragrant miscellaneous 107-2 The applicant unit hybridizes and breeds strains 6 Seven Rivers 2 Introducing commercial cultivation strains from Shandong 14 Qingke 212 Commercially cultivated strains in Guangxi 7 Seven Rivers No. 9 Introducing commercial cultivation strains from Shandong 15 Jinxiang194 The strains of this application 8 Qingke 20 Commercially cultivated strains in Guangxi 16

[0045] In summary, the primer pair PF3-R1 of the present application has a high specificity and can quickly distinguish the Jinxiang 194 strain from a variety of Lentinus edodes varieties.

[0046] The above description is a detailed description of the preferred feasible embodiments of the present invention, but the embodiments are not intended to limit the scope of the patent application of the present invention. All equivalent changes or modified changes completed under the technical spirit suggested by the present invention should fall within the patent scope covered by the present invention.

Claims

1. A pair of molecular marker primers specific to the strain of Lentinula edodes, characterized in that: The primer pair was named PF3-R1; The upstream primer sequence is: 5'-GGAGAGGGAGAGAGAAAACGA-3'; The downstream primer sequence was: 5′-AGAGAGGGAAGAGGAGAAGAG-3′; The Jinxiang 194 Lentinula edodes is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, and its deposit number is: CGMCC No.40137. The deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC No.40137, and the deposit date is April 24, 2022.

2. A kit, characterized in that: The kit comprises the primer pair according to claim 1.

3. A method for identifying the Lentinus edodes strain Jinxiang 194 from a plurality of Lentinus edodes strains using the primer pair of claim 1, characterized in that: The method comprises the following steps: extracting the total DNA of the shiitake mushroom strain to be identified, performing PCR amplification on PF3-R1 using the primer pair, and determining that the strain is the shiitake mushroom strain Jinxiang 194 when a 345 bp fragment is amplified; the Jinxiang 194 shiitake mushroom (Lentinula edodes) is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration, and its deposit number is CGMCC No. 40137, the deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, the deposit number is CGMCC No. 40137, and the deposit date is April 24, 2022.

4. The method according to claim 3, characterized in that The reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 50 seconds, 25 cycles, fill-in at 72°C for 7 minutes, and storage at 4°C; the PCR reaction system used in the PCR amplification is calculated as follows in 20 μL: 2×Es TaqMasterMix 10 μL, ddH2O 7 μL, 1 μL of 10 μmol / L upstream primer, 1 μL of 10 μmol / L downstream primer, and 1 μL of genomic DNA of the mushroom strain to be tested.

5. The method according to claim 3, characterized in that: The nucleic acid sequence of the specific fragment amplified by the primer pair PF3-R1 is shown in SEQ ID NO:3.

Images