Midbrain organoids and high-speed mass production method thereof, method for screening neurotoxic substances and screening drugs for dopaminergic neuron-related diseases using the same

Abstract

This invention relates to midbrain organoids and their manufacturing methods, methods for screening neurotoxic substances using them, and methods for screening drugs for dopaminergic neuron-related diseases. The manufacturing method can produce organoids at high speed and rapidly, thereby enabling rapid drug screening, blocking abnormal differentiation, minimizing dead nuclei, and reducing variations between organoids. Therefore, it can be effectively used for organoid production.

Description

Technical Field

[0001] This invention relates to a method for high-speed, large-scale manufacturing of midbrain organoids, a method for screening neurotoxic substances derived from them, and a method for drug screening for the treatment of dopaminergic neuron-related diseases. More specifically, it relates to the starting cell number and culture format required for manufacturing midbrain organoids, which, through adjustment, can enable the high-speed, large-scale manufacturing of high-quality midbrain organoids with minimal inter-individual variability. Background Technology

[0002] Organoids are a novel stem cell differentiation technology that utilizes the differentiation, self-renewal, and self-organization capabilities of stem cells to reproduce cellular composition and structure similar to organs in vivo through three-dimensional culture. Furthermore, by producing patient-customized organoids, it is possible to produce customized therapeutic drugs for various diseases at low cost and in a short period of time; this technology is considered promising.

[0003] Recent reports indicate the production of brain organoids that reflect various brain characteristics, and active research is underway using brain organoids to study Zika virus or to conduct disease simulation studies and new drug development using patient-derived brain organoids.

[0004] However, producing patient-customized organoids is costly and time-consuming. For example... Figure 1 As shown, the production of truly patient-derived induced pluripotent stem cells (iPSCs) typically takes 6–8 weeks or more, and its efficiency is usually very low, around 0.02%. Furthermore, the time required to produce organoids varies depending on the organ, but most require 3 to 6 months or more. Therefore, developing patient-specific new drugs is practically difficult for older patients with degenerative brain diseases and other patients in urgent need of drug treatment. In addition, the production of most organoids, including brain organoids, faces the following problems, which must be addressed for the practical application or industrialization of organoid research.

[0005] First, producing organoids requires significant costs and a long time.

[0006] For differentiation and maturation, oxygen and nutrients need to be supplied to the organoid's interior. Therefore, shaking bioreactors are often used to provide the necessary continuous shaking and differentiation within the CO2 incubator. For long-term, specific differentiation of organoids, long-term treatment with expensive differentiation-promoting factors is necessary. Therefore, producing long-term, specific organoids requires substantial costs. Figure 1 ).

[0007] Second, batch variation among organoids is very severe. Figure 2 Therefore, in disease simulation studies and new drug screening studies using organoids, inaccurate results may be produced.

[0008] Third, organoid differentiation can produce abnormal tissues known as "out-growth," which poses a serious problem hindering organoid quality and functionality. Figure 2 ).

[0009] Fourth, currently, organoids lack blood vessels, preventing the proper delivery of oxygen and nutrients to their core. This leads to a widespread phenomenon of "dead core," where internal cells die, hindering organoid maturation and thus posing a significant challenge. Figure 2 ).

[0010] Fifth, high-throughput screening (HTS) based on organoids: To conduct drug screening or drug repositioning research using HTS, it is necessary to develop a large-scale organoid production system conforming to the HTS format. Furthermore, the development of a one-step organoid production and new drug development system that integrates organoid production and drug screening within the HTS model is a necessary component for establishing a practical foundation for automated organoid production in the future. Summary of the Invention

[0011] Technical challenges

[0012] Therefore, in order to produce midbrain organoids at high speed / large scale, the inventors will use microplates such as 96- or 384-well plates, without using a shaking bioreactor, and utilize a high throughput screening (HTS) platform to produce midbrain organoids. In this way, besides producing midbrain organoids on the HTS platform (such as...), Figure 3In addition to the above, the HTS platform can also achieve high-speed, large-scale production of normal-level midbrain organoids with less inter-individual variation, abnormal differentiation, and suppressed dead nuclei. Compared with midbrain organoids produced by existing methods, high-speed, large-scale production of midbrain organoids shows significantly improved uniformity and functionality. Furthermore, it was found that time and costs required for midbrain organoid production can be saved.

[0013] Therefore, the object of the present invention is to provide a method for high-speed, large-scale culture of three-dimensional cell assemblies, the method comprising the following steps:

[0014] The steps involved in the formation of an embryoid body from cells separated from humans;

[0015] The steps of inducing differentiation from the embryoid body into a specific tissue to form a three-dimensional cell aggregate; and

[0016] The steps to induce the maturation of the three-dimensional cell aggregate,

[0017] The invention is characterized by the fact that the entire process, from the formation of the embryoid body to the induction of the maturation of the three-dimensional cell aggregate, is carried out on a large scale in the same microplate.

[0018] Another object of the present invention is to provide a three-dimensional cell aggregate manufactured by a high-speed, large-scale culture method for three-dimensional cell aggregates.

[0019] Another object of the present invention is to provide a three-dimensional cell assembly culture kit, which includes a concave culture portion of a three-dimensional cell assembly; and a cover portion including the concave culture portion.

[0020] Another object of the present invention is to provide a three-dimensional midbrain cell aggregate, which is a three-dimensional midbrain cell aggregate cultured from any one of human embryonic stem cells, human induced pluripotent stem cells and adult stem cells;

[0021] The three-dimensional midbrain cell aggregate is a three-dimensional midbrain cell aggregate that forms neuronal melanin.

[0022] Another object of the present invention is to provide a high-speed culture method for transforming human stem cells into three-dimensional cell assemblies, comprising the following steps:

[0023] The steps involved in the formation of embryoids from cells isolated from humans;

[0024] The steps of inducing differentiation from the embryoid body into a specific tissue to form a three-dimensional cell aggregate; and

[0025] The steps to induce the maturation of the three-dimensional cell aggregate;

[0026] From the step of forming the embryoid to the step of inducing the maturation of the three-dimensional cell aggregate, continuous non-vibrating culture is carried out in the same microplate.

[0027] The high-speed culture method is characterized by being an automated method for the high-speed culture of three-dimensional cell assemblies, including pipette robots, automatic handling, and flatbed transport vehicles.

[0028] Another object of the present invention is to provide a method for screening drugs for dopaminergic neuron-related diseases, comprising:

[0029] Steps for generating three-dimensional cell assemblies from induced pluripotent stem cells derived from patients with dopaminergic neuron-related diseases;

[0030] The step of treating the three-dimensional cell assembly with candidate substances;

[0031] The step of determining the survival rate of dopaminergic neurons from the three-dimensional cell assembly.

[0032] Another object of the present invention is to provide a method for providing information for treating dopaminergic neuron-related diseases, comprising the following steps:

[0033] Steps for culturing three-dimensional cell assemblies from cells derived from patients with dopaminergic neuron-related diseases;

[0034] The step of treating the three-dimensional cell assembly with candidate substances;

[0035] The step of determining the survival rate of dopaminergic neurons from the three-dimensional cell aggregate;

[0036] The steps involve providing patients with appropriate therapeutic drug information based on the survival rate of the dopaminergic neurons.

[0037] Another object of the present invention is to provide a method for identifying three-dimensional cell assemblies for drug testing, comprising the following steps:

[0038] (i) Steps for processing three-dimensional cell assemblies with candidate materials:

[0039] The step of treating with candidate material is performed in one or more steps included in the high-speed, large-scale culture method for three-dimensional cell assemblies; and

[0040] (ii) A method for identifying three-dimensional cell assemblies for drug testing, including a step of comparing the reactions produced by the three-dimensional cell assemblies in the presence and absence of the candidate substance.

[0041] Another object of the present invention is to provide a method for screening drug toxicity in vitro using a three-dimensional cell aggregate, comprising the following steps:

[0042] (i) The step of treating the three-dimensional cell assembly with a candidate material in one or more steps of the high-speed, large-scale culture method for three-dimensional cell assemblies;

[0043] (ii) A step of comparing the reactions produced by the three-dimensional cellular aggregates in each step in the presence and absence of the candidate substance;

[0044] (iii) The step of determining whether the cells present in the three-dimensional cell assembly are dead;

[0045] This provides a method for screening drug toxicity in vitro using three-dimensional cell assemblies.

[0046] Technical methods for solving problems

[0047] This invention relates to a method for high-speed and large-scale manufacturing of midbrain organoids, a method for screening neurotoxic substances derived from them, and a drug screening method for treating dopaminergic neuron-related diseases. According to the organoid manufacturing method of this invention, organoids can be produced at high speed and on a large scale, enabling rapid drug screening, blocking out-growth, minimizing dead core formation, reducing variation between organoids, and inducing excellent functionality through rapid maturation of midbrain organoids. In the process of manufacturing organoids, the inventors applied an initial starting cell number of 50 to 3,000, thereby reducing the time required for organoid manufacturing from the current 3 to 6 months or more to a maximum of less than 30 days.

[0048] The present invention will now be described in more detail.

[0049] One aspect of the present invention is a method for rapidly culturing three-dimensional cell assemblies from human stem cells, comprising:

[0050] The steps involved in the formation of an embryoid body from cells separated from humans;

[0051] The steps of inducing differentiation from the embryoid body into a specific tissue to form a three-dimensional cell aggregate; and

[0052] The steps to induce the maturation of the three-dimensional cell aggregate;

[0053] The characteristic feature is that the steps from forming the embryoid body to inducing the maturation of the three-dimensional cell aggregate are carried out continuously in the same microplate.

[0054] In this invention, the cells isolated from humans are one of human embryonic stem cells (hESC), induced pluripotent stem cells, and adult stem cells.

[0055] The term "stem cell" in this specification refers to a cell that has the ability to self-replicate and differentiate into two or more cells, including pluripotent stem cells, multipotent stem cells, and induced pluripotent stem cells.

[0056] In this invention, the three-dimensional cell assembly can be an organoid, such as a brain organoid.

[0057] The term "organoid" as used in this specification refers to a collection of cells formed by reassembling or recombining cells isolated from stem cells or organ-derived cells through 3D culture, and may include organoids or cell clusters formed from suspension cell cultures. The organoid may also be named a small similar organ, organ analogue, or similar organ. Specifically, the organoid comprises one or more types of cells that constitute an organ or tissue, and must be able to reproduce the structure and function of the tissue or organ.

[0058] In embodiments of the present invention, the diameter of the manufactured brain organoids is mostly in the range of about 0.9 to 1.4 mm, and their shape and size are uniform, so there is little variation between individuals and they exhibit good quality.

[0059] In this invention, the three-dimensional cell assembly may be formed in 20 to 50 days or 20 to 40 days, for example, in 20 to 30 days, but is not limited thereto.

[0060] In an embodiment of the invention, the activity of midbrain genes was confirmed after culturing for 7 days according to the method of the invention. Specific midbrain dopaminergic neurons (mDA neurons) appeared after 14 days of culturing, and the number of said mDA neurons increased after 21 days of culturing.

[0061] In this invention, after the three-dimensional cell aggregate is formed, it can be further cultured by shaking. Through this further shaking culture, it can be cultured for a long period of time.

[0062] In an embodiment of the present invention, a three-dimensional cell aggregate was cultured by shaking culture for more than 300 days after its formation.

[0063] In this invention, the microporous plate can be a porous plate with recesses. The porous plate with recesses can be a 96-well plate, a 384-well plate, or a 1,536-well plate.

[0064] In this invention, the initial number of cells isolated from humans can be between 50 and 3,000.

[0065] If a 96-well plate is used, the initial starting cell number is preferably 300 to 3,000, more preferably 300 to 1,000, more preferably 500, but not limited thereto.

[0066] If a 384-well plate is used, the initial starting cell number is preferably 50 to 500, more preferably 50 to 200, more preferably 100, but not limited thereto.

[0067] In this invention, the high-speed, large-scale culture method can be carried out without the use of bioreactors, for example, without the shaking process, throughout the entire process of forming a three-dimensional cell aggregate.

[0068] In this invention, the three-dimensional cell aggregate can be a midbrain cell aggregate.

[0069] In this invention, the three-dimensional cell assembly can be prepared from digested organs selected from a group consisting of liver, heart, and lungs.

[0070] In this invention, the step of forming a three-dimensional cell aggregate may include an ectoderm formation step or a midbrain tissue differentiation step.

[0071] The ectoderm formation step can be carried out in a culture medium containing CHIR99021, Dorsomorphin, and A83-01 (dual SMAD inhibitors).

[0072] The midbrain tissue differentiation step can be carried out in a culture medium containing CHIR99021, Dorsomorphin, A83-01, IWP, SAG, and FGF-8b.

[0073] In this invention, the step of inducing the maturation of three-dimensional cell aggregates can be carried out in a culture medium comprising SAG, FGF-8b, insulin, laminin, and further comprising a growth factor-reduced matrix gel.

[0074] In embodiments of the present invention, a method of directly adding matrix gel to the culture medium is used when performing the step of inducing the maturation of three-dimensional cell aggregates. However, according to existing known methods, the conventional method is to embed cells into matrix gel on a plate, which differs from the culture method of the present invention.

[0075] In this invention, during the step of forming a three-dimensional cell aggregate, within 7 days after tissue differentiation induction, endoderm markers may not be expressed, but ectoderm-forming factors may be expressed. The ectoderm-forming factors may be selected from, but are not limited to, one or more of N-CAD, PLZF, SOX1, SOX2, and NESTIN.

[0076] In this invention, during the step of forming a three-dimensional cell aggregate, for up to 14 days after tissue differentiation induction, there may be no expression of forebrain or hindbrain markers, but midbrain markers may be expressed. The midbrain markers may be selected from, but are not limited to, one or more of LMX1B, ASCL1, and TH.

[0077] In this invention, after performing the step of inducing the maturation of a three-dimensional cell aggregate, markers of midbrain dopaminergic neurons may be expressed.

[0078] In embodiments of the invention, midbrain markers are expressed on or before day 14, but expression levels are higher on day 21. It can be seen that midbrain dopaminergic neuron markers such as TH are expressed at high levels after the step of inducing the maturation of the three-dimensional cell aggregate.

[0079] In embodiments of the present invention, the steps from forming embryoid bodies to inducing the maturation of three-dimensional cell aggregates are carried out continuously in the same microplate without the need to move the microplate, enabling high-speed large-scale culture within 30 days using multi-microplates.

[0080] The second aspect of the present invention is a three-dimensional cell aggregate manufactured by a high-speed, large-scale culture method for three-dimensional cell aggregates.

[0081] Another aspect of the invention is a three-dimensional cell assembly culture kit, comprising a concave culture portion of a three-dimensional cell assembly; and a covering portion covering the concave culture portion.

[0082] In this invention, the three-dimensional cell aggregate culture kit may include a preservation solution.

[0083] Another aspect of the present invention is a three-dimensional midbrain cell aggregate, which is a three-dimensional midbrain cell aggregate cultured from one of human embryonic stem cells, human induced pluripotent stem cells and adult stem cells.

[0084] The three-dimensional midbrain cell aggregate is a three-dimensional midbrain cell aggregate that forms neuronal melanin.

[0085] The three-dimensional brain cell aggregates may form neuromelanin 20 to 50 days, 20 to 40 days, 20 to 35 days, 25 to 50 days, or 25 to 40 days after culture, for example, neuromelanin is formed 25 to 35 days after culture, but is not limited thereto.

[0086] In this invention, the three-dimensional midbrain cell assembly may exclude other brain tissues besides the midbrain.

[0087] In this invention, the rate of outgrowth of brain cell aggregates in three dimensions can be below 5%.

[0088] In this invention, the incidence of deep cell death in a three-dimensional brain cell aggregate can be less than 40% of the total area of ​​the cell aggregate.

[0089] In this invention, the diameter of the three-dimensional brain cell aggregate can be 0.9 to 1.4 mm, and it has a uniform size and uniform shape.

[0090] In this invention, the three-dimensional midbrain cell aggregate may include more than 10% midbrain dopaminergic neurons.

[0091] The three-dimensional midbrain cell ensemble may include more than 30% or more than 50% midbrain dopaminergic neurons. In the early stages, it may include approximately 80% midbrain dopaminergic neurons, but in the mature three-dimensional midbrain cell ensemble, various midbrain cell types will form, and the content of dopaminergic neurons may decrease throughout the cell population.

[0092] In this invention, the three-dimensional mesobrain cell aggregate is a three-dimensional mesobrain cell aggregate in which the gene expression variation rate can be uniformly formed and is less than 10%.

[0093] In embodiments of the present invention, the gene expression quality of the three-dimensional brain cell aggregates is very good, exhibiting homogeneity of over 90%. The remaining approximately 10% of observed cases show equivalent or better gene expression uniformity compared to those produced by conventional methods.

[0094] In this invention, the three-dimensional brain cell aggregate may include inhibitory nerves and excitatory nerves.

[0095] In this embodiment of the invention, the three-dimensional brain cell aggregate includes inhibitory and excitatory nerves, which are identified as comprising 10% to 30% or more of the entire cell aggregate. This can be seen from the description herein. Figure 11 and 15a This was confirmed in the experimental results of tissue staining data.

[0096] In this invention, electrophysiological activity can be observed in three-dimensional brain cell assemblages starting 15 days after cell differentiation. In conventional methods, electrophysiological activity typically appears several months after cell differentiation. This demonstrates the significant advantage of the present invention's method, which exhibits a very rapid maturation process.

[0097] In this invention, the three-dimensional midbrain cell assembly may include any of the following: substantia nigra, locus coeruleus, red nucleus, central gray matter, medial mammary band, oculomotor nucleus, and trochlear nucleus.

[0098] In this invention, the glial cells in the three-dimensional brain cell aggregate may include oligodendrocytes, and the three-dimensional brain cell aggregate may include 1% to 10% glial cells and oligodendrocytes.

[0099] In embodiments of the present invention, the extent to which the three-dimensional brain cell aggregate includes glial cells and oligodendrocytes can be described in this specification. Figure 11 and 15a This was confirmed in the experimental results of tissue staining data.

[0100] Another aspect of the present invention is a method for high-speed culture from human stem cells to three-dimensional cell assemblies, comprising the following steps:

[0101] The steps involved in the formation of embryoids from cells isolated from humans;

[0102] The steps of inducing differentiation from the embryoid body into a specific tissue to form a three-dimensional cell aggregate; and

[0103] The steps to induce the maturation of the three-dimensional cell aggregate;

[0104] From the step of forming the embryoid to the step of inducing the maturation of the three-dimensional cell aggregate, continuous non-vibrating culture is carried out in the same microplate.

[0105] The high-speed culture method is characterized by being a high-speed culture method for three-dimensional cell assemblies carried out in an automated manner, including pipette robots, automatic handling, and flatbed transport vehicles.

[0106] Another aspect of the present invention is a method for screening drugs for dopaminergic neuron-related diseases, comprising:

[0107] Steps for forming a three-dimensional cell aggregate from induced pluripotent stem cells derived from patients with dopaminergic neuron-related diseases;

[0108] The step of treating the three-dimensional cell assembly with candidate substances;

[0109] The step of determining the survival rate of dopaminergic neurons from the three-dimensional cell assembly.

[0110] In this invention, dopaminergic neuron-related diseases include, but are not limited to, one of Parkinson's disease, Alzheimer's disease, cerebral hemorrhage, stroke, Huntington's disease, Pick's disease, Kreutzfeldt-Jacob's disease, autism, and brain development disorders.

[0111] The information provision method can be used to evaluate drug toxicity and efficacy by applying three-dimensional cell assemblies to the screening of drugs for dopaminergic neuron-related diseases.

[0112] Based on the effectiveness of the candidate substances in preventing and treating the onset of dopaminergic neuron-related diseases, or in improving prognosis compared to control group substances, it can be determined that the candidate substances are effective as therapeutic drugs for dopaminergic neuron-related diseases.

[0113] Another aspect of the present invention is a method for providing information for treating dopaminergic neuron-related diseases, comprising the following steps:

[0114] Steps for culturing three-dimensional cell assemblies from cells derived from patients with dopaminergic neuron-related diseases;

[0115] The steps of treating the three-dimensional cell assembly with candidate materials; and

[0116] The step of determining the survival rate of dopaminergic neurons from the three-dimensional cell aggregate;

[0117] The steps to provide patients with appropriate treatment information based on the dopaminergic neuron survival rate.

[0118] In this invention, candidate substances include natural compounds, synthetic compounds, RNA, and DNA, which may be selected from, but are not limited to, polypeptides, enzymes, proteins, ligands, antibodies, antigens, bacterial or fungal metabolites, and bioactive molecules.

[0119] Another aspect of the present invention is a method for identifying three-dimensional cell assemblies for drug testing, comprising the following steps:

[0120] (i) Steps for processing three-dimensional cell assemblies with candidate materials:

[0121] The step of treating with candidate material is performed in one or more steps included in the high-speed, large-scale culture method for three-dimensional cell assemblies; and

[0122] (ii) A method for identifying three-dimensional cell assemblies for drug testing, comprising a step of comparing the reactions produced by the three-dimensional cell assemblies in each step in the presence and absence of the candidate substance.

[0123] Another aspect of the present invention is a method for screening drug toxicity in vitro using a three-dimensional cell aggregate, comprising the following steps:

[0124] (i) The step of treating the three-dimensional cell assembly with a candidate material in one or more steps of the high-speed, large-scale culture method for three-dimensional cell assemblies;

[0125] (ii) A step of comparing the reactions produced by the three-dimensional cellular aggregates in each step in the presence and absence of the candidate substance;

[0126] (iii) The step of determining whether the cells present in the three-dimensional cell assembly are dead;

[0127] The above describes a method for screening drug toxicity in vitro using three-dimensional cell assemblies.

[0128] The term "screening" in this specification refers to the process of selecting substances with specific properties from a candidate group composed of multiple substances using specific operations or evaluation methods.

[0129] The in vitro toxicity screening method can be used as a drug toxicity assessment platform to identify toxic substances or to identify the neurotoxicity of new drug candidates.

[0130] The effects of the invention

[0131] This invention relates to midbrain organoids and their manufacturing methods, methods for screening neurotoxic substances derived from them, and methods for drug screening for the treatment of dopaminergic neuron-related diseases. The manufacturing methods can produce organoids at high speed, perform rapid drug screening, block abnormal differentiation, minimize dead nuclei, reduce variations between organoids, induce high functionality in midbrain organoids, and effectively transform them into organoids that can be used for production. Attached Figure Description

[0132] Figure 1 This is a simulation diagram of the creation of induced pluripotent stem cells (iPSCs) for the production of patient-customized organoids and the organoid differentiation process.

[0133] Figure 2 It is a simulation diagram representing various problems in organoid production.

[0134] Figure 3This is a simulation diagram illustrating the organoid production strategy of the present invention compared to existing technologies.

[0135] Figure 4 These are morphological photographs (top), differentiation rate and morphological classification diagrams (middle), and standard morphological photographs (bottom) of midbrain organoids produced in a 96-well plate on day 7 of differentiation, according to an embodiment of the present invention.

[0136] Figure 5a This is a graph showing the expression of plutopotency marker genes in midbrain organoids produced in a 96-well plate on day 7 of differentiation, according to an embodiment of the present invention.

[0137] Figure 5b This is a graph showing the expression of mesoendodermal marker genes in mesobrain organoids produced in a 96-well plate on day 7 of differentiation, according to an embodiment of the present invention.

[0138] Figure 5c This is a graph showing the expression of neuroectoderm marker genes in mesencephalic organoids produced in a 96-well plate on day 7 of differentiation, according to an embodiment of the present invention.

[0139] Figure 6 These are morphological photographs (top), differentiation rate and morphological classification diagrams (middle), and standard morphological photographs (bottom) of midbrain organoids produced in a 96-well plate on day 14 of differentiation, according to an embodiment of the present invention.

[0140] Figure 7a This is a graph showing the expression of apoptosis marker genes in midbrain organoids produced in a 96-well plate on day 14 of differentiation, according to an embodiment of the present invention.

[0141] Figure 7b This is a graph showing the expression of forebrain marker genes in midbrain organoids produced in a 96-well plate on day 14 of differentiation, according to an embodiment of the present invention.

[0142] Figure 7c This is a graph showing the expression of midbrain marker genes in midbrain organoids produced in a 96-well plate on day 14 of differentiation, according to an embodiment of the present invention.

[0143] Figure 7d This is a graph showing the expression of hindbrain marker genes in midbrain organoids produced in a 96-well plate on day 14 of differentiation, according to an embodiment of the present invention.

[0144] Figure 8According to an embodiment of the present invention, morphological photographs (top), differentiation rate and morphological classification diagram (middle), and standard morphological photographs (bottom) of midbrain organoids produced in a 96-well plate on day 14 of differentiation under an initial starting cell number of less than 500 are shown.

[0145] Figure 9a This is a graph showing the in vivo expression of neuroectodermal marker genes in midbrain organoids produced in a 96-well plate on day 7 of differentiation, under an initial starting cell number of less than 500, according to an embodiment of the present invention.

[0146] Figure 9b This is a graph showing the expression of midbrain marker genes in midbrain organoids produced in a 96-well plate on day 14 of differentiation, under an initial starting cell number of less than 500, according to an embodiment of the present invention.

[0147] Figure 9c This is a graph showing the expression of hindbrain marker genes in midbrain organoids produced on day 14 of differentiation in a 96-well plate under an initial starting cell number of less than 500, according to an embodiment of the present invention.

[0148] Figure 10a These are comparative photographs of the size of midbrain organoids formed in a 384-well plate with different initial starting cell numbers, according to an embodiment of the present invention.

[0149] Figure 10b This is a graph showing the expression of midbrain marker genes in midbrain organoids produced in a 384-well plate according to an embodiment of the present invention.

[0150] Figure 11 This is a photograph showing the results of immunostaining analysis of specific midbrain dopaminergic neurons (mDA neurons) in midbrain organoids on day 14 of differentiation, according to an embodiment of the present invention.

[0151] Figure 12 According to an embodiment of the present invention, the morphological photographs (top), differentiation rate and morphological classification diagrams (middle), and standard morphological photographs (bottom) of the midbrain organoids on day 21 of differentiation are shown.

[0152] Figure 13a This is a graph showing the expression of apoptosis marker genes on day 21 of differentiation, according to an embodiment of the present invention.

[0153] Figure 13b This is a graph showing the expression of forebrain marker genes on day 21 of differentiation, according to an embodiment of the present invention.

[0154] Figure 13c This is a graph showing the expression of midbrain marker genes on day 21 of differentiation, according to an embodiment of the present invention.

[0155] Figure 13d This is a graph showing the expression of marker genes in the hindbrain on day 21 of differentiation, according to an embodiment of the present invention.

[0156] Figure 14a These are photographs comparing the sizes of midbrain organoids formed with different initial starting cell numbers according to an embodiment of the present invention, taken on a date-by-date basis.

[0157] Figure 14b This is a chart comparing the sizes of midbrain organoids formed by different initial starting cell numbers according to an embodiment of the present invention, by date.

[0158] Figure 15a This is an image showing the results of immunostaining analysis of specific midbrain dopaminergic neurons in midbrain organoids differentiated on day 21, formed with different initial starting cell numbers, according to an embodiment of the present invention.

[0159] Figure 15b This is an image of the results of immunostaining analysis, which shows the proportion of specific midbrain dopaminergic neurons in midbrain organoids on day 21 of differentiation formed by different initial starting cell numbers according to an embodiment of the present invention.

[0160] Figure 16a This is an image showing the results of immunostaining analysis of the size of the dead nucleus in midbrain organoids on day 21 of differentiation, formed from different initial starting cell numbers, according to an embodiment of the present invention.

[0161] Figure 16b This is a chart showing the results of immunostaining analysis of the size of dead nuclei in midbrain organoids on day 21 of differentiation, formed by different initial starting cell numbers, according to an embodiment of the present invention.

[0162] Figure 17 This is an image showing the results of immunostaining analysis of neuronal types and other cellular compositions of midbrain organoids produced under an initial starting cell number of 500, according to an embodiment of the present invention.

[0163] Figure 18 These are photographs showing the analysis results of midbrain organoids produced on a 96-well or 384-well plate high throughput screening (HTS) platform according to an embodiment of the present invention, displayed using high content imaging (HCI).

[0164] Figure 19These are photographs and result charts of the morphology (top) and size (bottom) of midbrain organoids produced by existing methods and midbrain organoids produced at high speed and on a large scale, according to embodiments of the present invention.

[0165] Figure 20 According to an embodiment of the present invention, in order to identify variations among midbrain organoid individuals produced at high speed and on a large scale, a graph comparing gene expression patterns among the various midbrain organoid individuals was constructed.

[0166] Figure 21 This is a photograph analyzing the generation results of neuromelanin in midbrain organoids produced at high speed and on a large scale, according to an embodiment of the present invention.

[0167] Figure 22 This is an image of neuronal melanin production confirmed by Fontana-Masson staining technique in midbrain organoids produced at high speed and on a large scale according to an embodiment of the present invention.

[0168] Figure 23 This is a comparison of the electrophysiological activity of midbrain organoids produced by conventional methods with those produced at high speed and on a large scale, according to an embodiment of the present invention.

[0169] Figure 24 These are photographs (top) and charts (bottom) illustrating the morphological and size changes of midbrain organoids produced at high speed and on a large scale, according to embodiments of the present invention, after treatment with the neurotoxic substances 6-OHDA and MPTP.

[0170] Figure 25 This is a graph showing the gene expression of apoptosis markers (top) and midbrain markers (bottom) in a high-speed, large-scale production of midbrain organoids treated with the neurotoxic substances 6-OHDA and MPTP, according to an embodiment of the present invention.

[0171] Figure 26 This is a schematic diagram of an organoid drug development platform for evaluating the efficacy and toxicity of HTS drugs, according to an embodiment of the present invention. Detailed Implementation

[0172] The invention will be further described according to embodiments thereof. However, these embodiments are merely illustrative of the invention, and the scope of the invention is not limited to these embodiments.

[0173] In this specification, unless otherwise stated, the percentage used to indicate the concentration of a particular substance is (weight / weight)% for solid / solid, (weight / volume)% for solid / liquid, and (volume / volume)% for liquid / liquid.

[0174] Example 1. Preparation of organoids

[0175] Organoids are prepared using the following procedure.

[0176] (Day 0) Cell count was 5 × 10 1 1×10 2 2.5×10 2 5×10 2 1×10 3 3×10 3 5×10 3 7×10 3 1×10 4 Human embryonic stem cells (hESCs) were seeded in COB1 medium in 96-well U-shaped plates containing 50 μM Y-27632 and 4 ng / ml basal fibroblast growth factor (bfgf). (GOB1: a 1:1 mixture of DMEM / F12 (Corning) and Neurobasal medium (Gibco) supplemented with the following: 100×N2 supplement (Gibco), 50×B27w / o vitamin A (Gibco), 1% penicillin / streptomycin (PS) (Gibco), 1% GlutaMAX.) TM (Gibco), 1% NEAA (non-essential amino acids; Gibco), 55 μM β-mercaptoethanol (Gibco), 1 μg / ml heparin (Sigma).

[0177] (Days 1–4) Embryoid body (EB) formation is achieved by adding 3 μM CHIR99021, 2 μM Dorsomorphin, 2 μM A83-01, and 1 μM WNT signaling system inhibitor IWP2 to COB1. This treatment period is limited to days 2, 3, and 4.

[0178] (Days 4-7) Add 3 μM CHIR99021, 2 μM Dorsomorphin, 2 μM A83-01, 1 μM IWP2 (an inhibitor of the MNT signaling system), 2 μg / ml SAG (statoacoustic ganglion), and 100 ng / ml FGF8 (fibroblast growth factor 8) to COB1. Replace the above culture medium by day 7. This treatment period is from day 5 to day 7.

[0179] (Day 7) Dissolve Matrigel on ice for approximately 4 hours. Add 100 ng / ml FGF8, 2 μg / ml SAG, 2.5 μg / ml insulin, and 200 ng / ml laminin to COB1 medium. Add the dissolved Matrigel to the medium. Then replace the organoid medium.

[0180] (Day 9) Replace the COB2 medium with BMM (Basal Mineral Medium) containing 10 ng / ml Brain-derived neurotrophic factor (BDNF), 10 ng / ml Glial cell line-derived neurotrophic factor (GDNF), 200 μM ascorbic acid, and 125 μM cAMP. Change the medium every two days. (COB2: A 1:1 mixture of DMEM / F12 (Corning) and Neurobasal medium (Gibco) supplemented with the following: 100 × N2 supplement (Gibco), 50 × B2 7w / o vitamin A (Gibco), 1% PS (Gibco), 1% GlutaMAX) TM (Gibco), 1% NEAA (Gibco), 55 μM β-mercaptoethanol (Gibco), 1 μg / ml heparin (Sigma).

[0181] Example 2. Confirmation of organoid characteristics on day 7 of differentiation

[0182] 2-1. Determine the survival rate and quality of organoids.

[0183] High-throughput screening (HTS) platform was used to generate brain organoids (EBs) from 96-well plates to induce midbrain organoid differentiation. This serves as the first stage for unifying applied research, including maturation and new drug development. Different starting cell numbers were tested. For this purpose, isolated single hESC cells were seeded into 96-well plates at concentrations of 500, 1,000, 3,000, 5,000, 7,000, and 10,000 cells per well. Differentiation was observed, and the results showed… Figure 4 In China, organoids are classified into three categories based on their quality: Category 1 (developing neural rosettes), Category 2 (bright round EBs), and Category 3 (ruptured EBs).

[0184] from Figure 4 The results show that a comparison of day 7 survival rate and EB quality revealed that while organoids were slightly smaller in size when the number of isolated cells seeded was 500, 1,000, and 3,000, the overall quality was better. However, when the number of isolated cells seeded was above 5,000, the organoids were mostly classified as Category 2. Category 1 was considered the best.

[0185] 2-2. Determining the gene expression characteristics of organoids

[0186] To understand the expression of organoid genes, plutopotency markers included OCT4 and NANOG, mesoendodermal markers included EOMES, MXL1, and T, and neuroectoderm markers included N-CAD, PLZF, SOX1, SOX2, and NESTIN. The expression levels of these markers in organoids were confirmed, and the results are as follows: Figures 5a to 5c As shown in Table 1, the primer sequences used for qPCR are also shown.

[0187] Table 1

[0188] Serial Number name Sequence (5'→3') 1 Oct4_F primers GACAGGGGGAGGGAGGGAGGCTAGG 2 Oct4_R primers CTTCCCTCCAACCAGTTGCCCCAAAC 3 Nanog_F primers TGCAACCTGAAGACGTGTGA 4 Nanog_R primers CTATGAGGGATGGGAGGA 5 Eomes_F primers CTCAAAAGGCATGGGAGGGTA 6 Eomes_R primers CACCACCAAGTCCATCTGCAA 7 MXL1F primers ACAACGCTCTTGAACGACGAA 8 MXL1R primers CGGCAACATCAACTGACAAC 9 T_F primers CGCCTCATAGCCTCATGGAC 10 T_R primers CACTGGCTGCCACGACAAA 11 NCAD-F primers TGATGAAGAAGGTGGAGGAGAAGA 12 NCAD-R primers ATTCGTCGGATTCCCACAGG 13 PLZF-F primers TCCCGCCCGACTGGAGGATA 14 PLZF-R primers TTCTTTCCTGTGCTCCCCGCTC 15 SOX1-F primers GCCGAGTGGAAGGTCATGTC 16 SOX1-R primers TTCTTGAGCAGCGTCTTGGTC 17 SOX2-F primers AGACTGCACATGAGCCAGACA 18 SOX2-R primers CGTCTCCAGCCAGCTTCAAC 19 NESTIN-F primers AGGAAAAAGACCATCTGCCCG 20 NESTIN-R primers GCCTCTTCAGCCAGAAACCAT

[0189] from Figures 5a to 5c It can be seen that the gene expression patterns are generally similar. No full differentiation function or mesoderm markers were expressed, only neuroectodermal markers were expressed, confirming normal early neural differentiation in the mesobrain organoids produced by the HTS platform.

[0190] Example 3. Confirmation of organoid characteristics on day 14 of differentiation

[0191] 3-1. Survival rate and quality assessment of organoids

[0192] Organoids differentiated on day 14, fabricated according to the method of Example 1, exhibited varying survival rates and morphologies depending on the initial number of starting cells. Organoid quality was categorized into four classes: Class 1 (bright edge with neural rosette), Class 2 (abnormal differentiation), Class 3 (covered by abnormal differentiation), and Class 4 (deep and dark EB). Results are shown in Table 2. Figure 6 middle.

[0193] Table 2

[0194] Cell count 500 1,000 3,000 5,000 7,000 10,000 Category 1 (units) 30 25 26 16 15 15 Category 2 (units) 0 5 1 1 3 1 Category 3 (units) 0 0 3 11 12 11 Category 4 (units) 0 0 0 2 0 3 total 30 30 30 30 30 30

[0195] From Table 1, Figure 6 It can be seen that when the number of cells is greater than 5,000, a large number of out-growth abnormal differentiations appear on the surface of the midbrain organoids, but when 500 to 3,000 isolated cells are used, high-quality midbrain organoids are produced without abnormal differentiation.

[0196] 3-2. Determine the gene expression characteristics of organoids

[0197] In addition, to understand gene expression, apoptosis markers included BAX, BAD, and PMA1P1; forebrain markers included FOXG1, LHX2, and SIX3; midbrain markers included LMX1B, ASCL1, and TH; and hindbrain markers included HA1, HB4, and HC9. The results were shown in [data missing]. Figures 7a to 7d The primer sequences used in qPCR are shown in Table 3.

[0198] Table 3

[0199]

[0200]

[0201] As can be seen from Figure 7, only midbrain markers were specifically expressed in all cases, confirming that the expression of apoptosis markers also increases with the increase of the initial cell number.

[0202] 3-3. Determining the effect of initial cell number on organoid formation

[0203] To investigate the effect on midbrain organoid formation, the above experiment was repeated using 100, 250, and 500 cells when using fewer than 500 cells. The results showed... Figure 8 , 9a To 9c. The primer sequences used in qPCR are shown in Tables 1, 3, and 4.

[0204] Table 4

[0205] Serial Number name Sequence (5'→3') 45 KROX20-F primers ACCGCCTCTCTCTCTCTTATT 46 KROX20-R primers GGGTAGGCCAGAGAGGAAGA

[0206] from Figure 8 It can be seen that the organoids on day 14 of differentiation did not differ significantly in morphology from those on day 7. However, from Figures 9a to 9cIt can be seen that in organoids with 100 and 250 cells, expression of neuroectodermal markers N-CAD, SOX2, and PLZF was observed in the early stage (day 7). However, expression of midbrain markers LMX1B, ASCL1, and TH was lower on day 14. Conversely, expression of hindbrain markers HC9, HAL, HB4, and KROX20 increased. Therefore, these results indicate that midbrain organoids have the highest production efficiency when using 500 cells.

[0207] Effect of initial starting cell number in 3-4.384-well plates on organoid formation

[0208] To facilitate large-scale production of midbrain organoids, the production conditions for midbrain organoids based on 384-well plates were confirmed. To produce midbrain organoids with a smaller volume of 384-well plates (~90 μl) compared to 96-well plates (~330 μl), the effectiveness was confirmed by starting cell numbers of 50, 100, 200, 300, and 500. The results showed… Figure 10a and 10b middle.

[0209] from Figure 10a It can be seen that the midbrain organoids on day 30 of differentiation, regardless of the number of initial cells, all showed similar morphology and size.

[0210] However, as Figure 10b As shown, the expression of midbrain markers TH, ACSL1, and LMX1B was higher when the starting cell count was 50, 100, and 200 compared to 500. Therefore, these results indicate that using 50, 100, and 200 starting cells is most efficient for producing midbrain organoids using 384-well plates.

[0211] 3-5. Determine the number of organoid-specific dopaminergic neurons in the midbrain.

[0212] In midbrain organoids on day 14 of differentiation, specific midbrain dopaminergic neurons (mDAneurons) were observed, and the results showed... Figure 11 In the middle. For example Figure 11 As shown, if 500 initial starting cells were used, the most uniform presence of mDA neurons was determined by the expression of tyrosine hydroxylase (TH).

[0213] Example 4. Determining organoid characteristics on day 21 of differentiation

[0214] 4-1. Determine the survival rate and quality of organoids.

[0215] Following the method of Example 1, the survival rate and quality of midbrain organoids manufactured on day 21 of differentiation were investigated. Organoid quality was categorized into four classes: Class 1 (early neural rosette development), Class 2 (smooth organoids), Class 3 (covered by abnormal differentiation), and Class 4 (ruptured organoids). Results are shown in Table 5 and... Figure 12 middle.

[0216] Table 5

[0217] Cell count 500 1,000 3,000 5,000 7,000 10,000 Category 1 (units) 24 8 0 0 0 0 Category 2 (units) 6 17 10 10 11 16 Category 3 (units) 0 5 20 15 14 8 Category 4 (units) 0 0 0 5 5 6 total 30 30 30 30 30 30

[0218] As shown in Table 5 and Figure 12 As shown, using 500 or 1,000 completely reduced the possibility of abnormal differentiation, and the generation of midbrain organoids formed from the neuroepithelial cell layer was observed. However, when using more than 3,000, the abnormal differentiation phenomenon was very serious, and only low-quality midbrain organoids were generated.

[0219] 4-2. Determining the gene expression characteristics of organoids

[0220] To understand gene expression, apoptosis markers BAX, BAD, and PMA1P1 were selected; forebrain markers FOXG1, LHX2, and SIX3 were selected; midbrain markers LMX1B, ASCL1, and TH were selected; and hindbrain markers HA1, HB4, and HC9 were selected. After confirming expression levels, the results were displayed as follows: Figures 13a to 13d The primer sequences used in qPCR are shown in Table 3.

[0221] Figures 13a to 13d The results showed that when 3,000 cells were used, the expression of apoptosis markers increased, while when 3,000 to 10,000 cells were used, the expression of some midbrain genes decreased.

[0222] Therefore, the HTS platform confirmed that the initial number of starting cells plays a very important role in the production of brain organoids.

[0223] 4-3. Compare the size of organoids

[0224] Comparing the size of midbrain organoids formed using 500 to 10,000 cells at differentiation days 7, 14, and 21, the results showed... Figure 14a and 14b middle.

[0225] like Figure 14a and 14b As shown, the size is roughly the same at 500 to 10,000 cells, which means that 500 to 1,000 initial starting cells are sufficient for the production of midbrain organoids.

[0226] 4-4. Determining the number of organoid-specific dopaminergic neurons in the middle brain

[0227] The number of specific midbrain dopaminergic neurons was determined in the midbrain organoids on day 21 of differentiation, and the results are shown in Table 6. Figure 15a and 15b middle.

[0228] Table 6

[0229] Cell count 500 1,000 3,000 5,000 7,000 10,000 Intracellular percentage (%) 12.6 7.0 4.9 3.0 3.9 1.4

[0230] As shown in Table 6, Figure 15a and 15b As shown, at cell numbers of 500 and 1,000, there are more specific midbrain dopaminergic neurons, and they are homogeneous. This indicates that the optimal initial cell number on the HTS platform is 500 and 1,000.

[0231] In particular, such as Figure 16a and 16b As shown, with an initial starting cell number of less than 1,000, the common problem of "dead nucleus" in organoids was effectively suppressed.

[0232] In addition, such as Figure 17 As shown, the midbrain organoids produced by the 500 initial initiating cells all contained TH-positive mDA neurons, as well as mature A9-type mDA neurons expressing GIRK2 (G protein-activated inward rectifier potassium channel 2). Further discovery of astrocytes confirmed the presence of oligodendrocytes and various subtypes of neurons.

[0233] 4-5. Determine the morphology of organoids

[0234] Finally, using 500 cells, organoids were produced on 96- and 384-well HTS platforms, and their morphology was observed using high-content imaging (HCI). Figure 18 As shown.

[0235] from Figure 19As can be seen, in all organoids cultured in 96-well plates on day 30, most organoids had diameters ranging from 0.9 to 1.4 mm, indicating very uniform production of identical midbrain organoids. Conversely, midbrain organoids produced using conventional methods without microplates exhibited highly heterogeneous morphology and size. Similar results were obtained in other types of human embryonic stem cells or human induced pluripotent stem cells.

[0236] from Figure 20 It can be seen that the gene expression of midbrain organoids in high-speed, large-scale production of 96-well plates was confirmed in individual midbrain organoids. More than 90% of the midbrain organoids were observed to be superior to those produced using existing technologies, and the remaining approximately 10% showed similar levels of gene expression to those produced using existing technologies. This implies that high-speed, large-scale production of midbrain organoids exhibits highly uniform characteristics with no inter-individual variation. Therefore, high-speed, large-scale production technology for midbrain organoids can serve as a standardized technology for the future industrialization of midbrain organoid technology.

[0237] Example 5. Functional validation of brain organoids in high-speed, large-scale production

[0238] To verify the functionality of brain organoids in high-speed, large-scale production, neuromelanin production and electrophysiological analyses were performed, and the results are as follows: Figure 21 and 22 As shown.

[0239] from Figure 21 It can be seen that, under high-speed, large-scale production of midbrain organoids, neuromelanin is produced on day 30 of differentiation. Considering that the formation of neuromelanin in midbrain organoids produced by conventional methods is only observed after more than 100 days of induced differentiation, this confirms that midbrain organoids induced and differentiated within 30 days under high-speed, large-scale production have similar functionality to midbrain organoids produced by conventional methods over several months.

[0240] like Figure 22 As shown, Fontana-Masson staining reconfirmed the formation of neuromelanin in midbrain organoids produced at high speed and on a large scale.

[0241] As part of the functional validation of midbrain organoids produced on a high-speed, large-scale basis, electrophysiological analysis was performed by measuring the firing rate of neural signals. The results showed that, as Figure 23 As shown, midbrain organoids produced by conventional methods have no electrophysiological activity before day 70 of differentiation. However, midbrain organoids produced at high speed and on a large scale show a significant increase in neural discharge rate starting from day 20 of differentiation, and a sharp increase in neural discharge rate on day 30 of differentiation.

[0242] This means that, compared with traditional methods, the functional maturation mode of midbrain organoids produced by this technology is very fast, allowing for high-speed and large-scale production. Therefore, with this technology, functionally mature midbrain organoids can be produced as early as 30 days after differentiation.

[0243] Example 6. In vitro drug toxicity evaluation based on high-speed, large-scale production of brain organoids.

[0244] As a platform for evaluating drug efficacy and toxicity, in order to verify the application potential of high-speed, large-scale production of brain organoids, an in vitro drug toxicity evaluation study based on high-speed, large-scale production of brain organoids was conducted. The results are as follows: Figure 24 and 25 As shown.

[0245] Specifically, in high-speed, large-scale production of midbrain organoids, the organoids were treated with neurotoxic substances that induce dopamine-induced neuronal apoptosis, 6-OHDA (6-hydroxydopamine) and MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), at concentrations of 100, 250, and 500 μM, for 10 days, and the area of ​​the midbrain organoids was measured.

[0246] from Figure 24 It can be seen that the size of the midbrain organoids decreased according to the concentration of each neurotoxic substance.

[0247] In addition, such as Figure 25 As shown, when midbrain organoids were treated with neurotoxic substances, the expression of apoptosis-related markers increased proportionally to the concentration of the toxic substance, confirming a decrease in midbrain marker expression. These results indicate that midbrain organoids have the potential to serve as a novel drug development platform for evaluating in vitro drug efficacy and toxicity.

[0248] In short, such as Figure 26 As shown, it is feasible to develop a variety of industrialization linkage technologies based on midbrain organoid technology, such as a new drug development platform for evaluating drug efficacy and toxicity, based on ultra-high-speed, large-scale production and standardization technologies for midbrain organoids. sequence list <110> Organoid Factory <120> Midbrain organoids and their high-speed, large-scale manufacturing methods, methods for screening neurotoxic substances and drugs for dopaminergic neuron-related diseases using them. <130> P22JM1NN04819CN <150> KR 10-2020-0079093 <151> 2020-06-29 <150> KR 10-2021-0010149 <151> 2021-01-25 <160> 46 <170> KoPatentIn 3.0 <210> 1 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Oct4_F primers <400> 1 gacaggggga ggggaggagc tagg 24 <210> 2 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Oct4_R primers <400> 2 cttccctcca accagttgcc ccaaac 26 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Nanog_F primers <400> 3 tgcaacctga agacgtgtga 20 <210> 4 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Nanog _R primers <400> 4 ctatgaggga tgggagga 18 <210> 5 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Eomes_F primers <400> 5 ctcaaaaggc atgggagggt a 21 <210> 6 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Eomes_R primers <400> 6 caccaccaag tccatctgca a 21 <210> 7 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> MXL1 F primers <400> 7 acaacgctct tgaacgacga a 21 <210> 8 <211> 20 <212> DNA <213> Artificial sequence <220> <223> MXL1 R primers <400> 8 cggcaacatc aactgacaac 20 <210> 9 <211> 20 <212> DNA <213> Artificial sequence <220> <223> T_F primers <400> 9 cgcctcatag cctcatggac 20 <210> 10 <211> 19 <212> DNA <213> Artificial sequence <220> <223> T_R primers <400> 10 cactggctgc cacgacaaa 19 <210> 11 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> NCAD-F primers <400> 11 tgatgaagaa ggtggaggag aaga 24 <210> 12 <211> 20 <212> DNA <213> Artificial sequence <220> <223> NCAD-R primers <400> 12 attcgtcgga ttcccacagg 20 <210> 13 <211> 20 <212> DNA <213> Artificial sequence <220> <223> PLZF-F primers <400> 13 tcccgcccga ctggaggata 20 <210> 14 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> PLZF-R primers <400> 14 ttctttcctg gctccccgct c 21 <210> 15 <211> 20 <212> DNA <213> Artificial sequence <220> <223> SOX1-F primers <400> 15 gccgagtgga aggtcatgtc 20 <210> 16 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> SOX1-R primers <400> 16 ttcttgagca gcgtcttggt c 21 <210> 17 <211> 20 <212> DNA <213> Artificial sequence <220> <223> SOX2-F primers <400> 17 agactgcaca tgagccagca 20 <210> 18 <211> 20 <212> DNA <213> Artificial sequence <220> <223> SOX2-R primers <400> 18 cgtctccagc cagcttcaac 20 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <220> <223> NESTIN-F primers <400> 19 aggaaaagac catctgcccg 20 <210> 20 <211> 20 <212> DNA <213> Artificial sequence <220> <223> NESTIN-R primers <400> 20 gcctctcagc cagaaaccat 20 <210> twenty one <211> 20 <212> DNA <213> Artificial sequence <220> <223> BAX-F primers <400> twenty one tgctgacgtg gacacggact 20 <210> twenty two <211> 20 <212> DNA <213> Artificial sequence <220> <223> BAX-R primers <400> twenty two ccagccaccc tggtcttgga 20 <210> twenty three <211> 20 <212> DNA <213> Artificial sequence <220> <223> BAD-F primers <400> twenty three tcggagtcgc cacagttcgt 20 <210> twenty four <211> 20 <212> DNA <213> Artificial sequence <220> <223> BAD-R primers <400> twenty four gcgctctttg ggcgaggaag 20 <210> 25 <211> 20 <212> DNA <213> Artificial sequence <220> <223> PMAIP1-F primers <400> 25 gggaagaagg cgcgcaagaa 20 <210> 26 <211> 25 <212> DNA <213> Artificial sequence <220> <223> PMAIP1-R primers <400> 26 agtttctgcc ggaagttcag tttgt 25 <210> 27 <211> 20 <212> DNA <213> Artificial sequence <220> <223> FOXG1-F primers <400> 27 gcgggccaga acagttactt 20 <210> 28 <211> 20 <212> DNA <213> Artificial sequence <220> <223> FOXG2-R primers <400> 28 cccagacagt cccgtcgtaa 20 <210> 29 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> LHX2-F primers <400> 29 acttctgtgc ctggcaacct g 21 <210> 30 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> LHX2-R primers <400> 30 tctgtttcca ggcgagatcc t 21 <210> 31 <211> 20 <212> DNA <213> Artificial sequence <220> <223> SIX3-F primers <400> 31 aacctccagc gactcggaat 20 <210> 32 <211> 20 <212> DNA <213> Artificial sequence <220> <223> SIX3-R primers <400> 32 ttcggtttgt tctggggatg 20 <210> 33 <211> 20 <212> DNA <213> Artificial sequence <220> <223> LMX1B-F primers <400> 33 ggcatcaaga tggaggagca 20 <210> 34 <211> 20 <212> DNA <213> Artificial sequence <220> <223> LMX1B-R primers <400> 34 tggtgagggc ttgctgacac 20 <210> 35 <211> 20 <212> DNA <213> Artificial sequence <220> <223> ASCL1-F primers <400> 35 ggtgatcgca caacctgcat 20 <210> 36 <211> 19 <212> DNA <213> Artificial sequence <220> <223> ASCL1-R primers <400> 36 gttctgagcg cttcccgtt 19 <210> 37 <211> 20 <212> DNA <213> Artificial sequence <220> <223> TH-F primers <400> 37 ctgagattcg ggccttcgac 20 <210> 38 <211> 20 <212> DNA <213> Artificial sequence <220> <223> TH-R primers <400> 38 tgcacctagc caatggcact 20 <210> 39 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> HA1-F primers <400> 39 agatcaacac ataccggagc c 21 <210> 40 <211> 20 <212> DNA <213> Artificial sequence <220> <223> HA1-R primers <400> 40 agcgcacgaa ggaattgcag 20 <210> 41 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> HB4-F primers <400> 41 agctggcagt ggcattggct a 21 <210> 42 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> HB4-R primers <400> 42 tgctgctcta ggaaccgaac c 21 <210> 43 <211> 20 <212> DNA <213> Artificial sequence <220> <223> HC9-F primers <400> 43 ttgctgtaca ttggctggga 20 <210> 44 <211> 20 <212> DNA <213> Artificial sequence <220> <223> HC9-R primers <400> 44 acacagctgc agcgctatta 20 <210> 45 <211> 20 <212> DNA <213> Artificial sequence <220> <223> KROX20-F primers <400> 45 accgcctcct cctccttatt 20 <210> 46 <211> 20 <212> DNA <213> Artificial sequence <220> <223> KROX20-R primers <400> 46 gggtaggcca gagaggaaga 20

Claims

1. A method for high-speed, large-scale culture of three-dimensional cell assemblies, the method comprising the following steps: The steps involved in the formation of embryoids from cells isolated from humans; The steps of inducing differentiation from the embryoid body into a specific tissue to form a three-dimensional cell aggregate; and The steps to induce the maturation of the three-dimensional cell aggregate; The characteristic feature is that the steps from forming the embryoid body to inducing the maturation of the three-dimensional cell aggregate are carried out continuously in the same microplate; The cells isolated from humans are one of human embryonic stem cells or induced pluripotent stem cells. The microporous plate is a porous plate with recesses; the porous plate with recesses is a 96-well plate or a 384-well plate. When the porous plate with the recess is a 96-well plate, the initial starting number of the cells separated from humans is 300 to 3,000. When the porous plate with the recess is a 384-well plate, the initial starting number of the cells isolated from humans is 50 to 500. The three-dimensional cell aggregate forms within 20 to 50 days.

2. The high-speed, large-scale culture method for three-dimensional cell assemblies according to claim 1 allows for long-term culture after the three-dimensional cell assemblies are formed, provided that further shaking culture is performed.

3. The method for high-speed, large-scale culture of three-dimensional cell assemblies according to claim 1, wherein the high-speed, large-scale culture method does not use a bioreactor throughout the entire process of forming the three-dimensional cell assemblies.

4. The method for high-speed, large-scale culture of three-dimensional cell assemblies according to claim 1, wherein the three-dimensional cell assemblies are midbrain cell assemblies.

5. The method for high-speed large-scale culture of three-dimensional cell assemblies according to claim 1, wherein the step of forming three-dimensional cell assemblies includes an ectoderm formation step or a midbrain tissue differentiation step.

6. The method for high-speed large-scale culture of three-dimensional cell assemblages according to claim 5, wherein the ectoderm formation step is carried out in a culture medium comprising CHIR99021, dihydrodeoxymorphine and A83-01.

7. The method for high-speed large-scale culture of three-dimensional cell assemblies according to claim 5, wherein the midbrain tissue differentiation step is carried out in a culture medium comprising CHIR99021, dihydrodeoxymorphine, A83-01, IWP, SAG and FGF-8b.

8. The method for high-speed large-scale culture of three-dimensional cell assemblies according to claim 1, wherein the step of inducing the maturation of the three-dimensional cell assemblies is carried out in a culture medium comprising SAG, FGF-8b, insulin, laminin, and further comprising matrix gel that inhibits growth factors.

9. In the high-speed large-scale culture method for three-dimensional cell aggregates according to claim 1, in the step of forming the three-dimensional cell aggregates, no endoderm markers are expressed, but ectoderm formation factors are expressed within 7 days after tissue differentiation induction.

10. In the high-speed large-scale culture method for three-dimensional cell aggregates according to claim 1, in the step of forming the three-dimensional cell aggregates, no forebrain or hindbrain markers are expressed, but midbrain markers are expressed within 14 days after tissue differentiation induction.

11. In the method for high-speed large-scale culture of three-dimensional cell assemblies according to claim 1, in the step of inducing the maturation of the three-dimensional cell assemblies, a marker expressing midbrain dopaminergic neurons is used.

12. A three-dimensional cell aggregate manufactured by the high-speed large-scale culture method of the three-dimensional cell aggregate according to claim 1; wherein the three-dimensional cell aggregate is a three-dimensional midbrain cell aggregate with a diameter of 0.9 to 1.4 mm, having a uniform size and uniform morphology.

13. A three-dimensional cell assembly culture kit, comprising a concave culture portion containing a three-dimensional cell assembly according to claim 12; and a covering portion including a covering portion of the concave culture portion.

14. The three-dimensional cell aggregate culture kit of claim 13, comprising a preservation solution.

15. A three-dimensional midbrain cell aggregate, which is a three-dimensional midbrain cell aggregate cultured from any one of human embryonic stem cells or human induced pluripotent stem cells according to the method of claim 1, wherein the three-dimensional midbrain cell aggregate is a three-dimensional midbrain cell aggregate that forms neuromelanin; wherein the three-dimensional midbrain cell aggregate is a three-dimensional midbrain cell aggregate with a diameter of 0.9 to 1.4 mm and has a uniform size and uniform morphology.

16. The three-dimensional midbrain cell assembly according to claim 15, wherein the three-dimensional midbrain cell assembly refers to a three-dimensional midbrain cell assembly excluding other brain tissues other than the midbrain.

17. The three-dimensional brain cell aggregate according to claim 15, wherein the abnormal differentiation rate of the three-dimensional brain cell aggregate is less than 5%.

18. The three-dimensional brain cell aggregate according to claim 15, wherein the incidence of deep cell apoptosis in the three-dimensional brain cell aggregate is less than 40% of the total area of ​​the cell aggregate.

19. The three-dimensional midbrain cell assembly according to claim 15, wherein the three-dimensional midbrain cell assembly comprises more than 10% midbrain dopaminergic neurons.

20. The three-dimensional midbrain cell aggregate according to claim 15, wherein the three-dimensional midbrain cell aggregate is a uniformly formed three-dimensional midbrain cell aggregate with a gene expression variation rate of less than 10%.

21. The three-dimensional midbrain cell assembly according to claim 15, wherein the three-dimensional midbrain cell assembly comprises inhibitory nerves and excitatory nerves.

22. The three-dimensional midbrain cell aggregate according to claim 15, wherein electrophysiological activity can be observed in the three-dimensional midbrain cell aggregate starting 15 days after cell differentiation.

23. The three-dimensional midbrain cell assembly according to claim 15, wherein the three-dimensional midbrain cell assembly comprises any one of the following: substantia nigra, locus coeruleus, red nucleus, central gray matter, medial mammary band, oculomotor nucleus, and trochlear nucleus.

24. The three-dimensional mesobrain cell assembly according to claim 15, wherein the three-dimensional mesobrain cell assembly comprises glial cells and oligodendrocytes.

25. A rapid culture method for transforming human stem cells into three-dimensional cell assemblies. Includes the following steps: The step of forming an embryoid from cells isolated from humans, according to claim 1; The steps of inducing differentiation from the embryoid body into a specific tissue to form a three-dimensional cell aggregate; The steps to induce the maturation of the three-dimensional cell aggregate; From the step of forming the embryoid to the step of inducing the maturation of the three-dimensional cell aggregate, continuous non-vibrating culture is carried out in the same microplate. The high-speed culture method is characterized by being a high-speed culture method for three-dimensional cell assemblies carried out in an automated manner, including pipette robots, automatic handling, and flatbed transport vehicles.

26. A method for screening drugs for dopaminergic neuron-related diseases, characterized in that, In the method for screening drugs for dopaminergic neuron-related diseases, include: The method according to claim 1, the step of forming a three-dimensional cell aggregate from induced pluripotent stem cells derived from patients with dopaminergic neuron-related diseases; The step of treating the three-dimensional cell assembly with candidate substances; The step of determining the survival rate of dopaminergic neurons from the three-dimensional cell assembly.

27. The method for screening drugs for dopaminergic neuron-related diseases according to claim 26, wherein the dopaminergic neuron-related disease is one of Parkinson's disease, Alzheimer's disease, cerebral hemorrhage, stroke, Huntington's disease, Pick's disease, Kreutzfeldt-Jacob's disease, autism, and brain developmental disorders.

28. The use of the high-speed, large-scale culture method for three-dimensional cell assemblies according to claim 1 in screening drugs for dopaminergic neuron-related diseases, wherein the use Includes the following steps: According to the method of claim 1, a three-dimensional cell ensemble is cultured from cells derived from patients with dopaminergic neuron-related diseases; The three-dimensional cell aggregate was treated with candidate substances; The survival rate of dopaminergic neurons was determined from the three-dimensional cell aggregate; Based on the survival rate of dopaminergic neurons, suitable drugs for dopaminergic neuron-related diseases are screened.

29. A method for screening drug toxicity in vitro using three-dimensional cell assemblies, comprising the following steps: (i) The step of treating the three-dimensional cell aggregate with a candidate substance in one or more steps of the high-speed large-scale culture method for three-dimensional cell aggregates according to claim 1; (ii) A step of comparing the reactions produced by the three-dimensional cellular aggregates in each step in the presence and absence of the candidate substance; (iii) The step of determining whether the cells present in the three-dimensional cell assembly are dead.

Images