Use of an inhibitor of hsa_circ_0136666 in the preparation of a tumor immune enhancing agent
By developing an hsa_circ_0136666 inhibitor that targets the miR-375/PRKDC/PD-L1 signaling axis, the problem of immune escape in advanced gastric cancer was solved, achieving the effect of a tumor immune enhancer and reducing drug resistance.
Patent Information
- Application Number
- CN202211642305.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-20
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2042-12-20
AI Technical Summary
Current treatments for advanced gastric cancer suffer from drug resistance due to tumor immune escape mechanisms, and there is a lack of effective ways to improve this. How to reduce the risk of immune escape from the source has become a difficult problem.
Develop an hsa_circ_0136666 inhibitor that targets the antisense oligonucleotides, siRNA, shRNA, etc. of hsa_circ_0136666 to inhibit the miR-375/PRKDC/PD-L1 signaling axis, reduce PD-1 or PDL1 expression, and enhance tumor immune response.
It significantly inhibits tumor immune escape, promotes the activity of anti-tumor drugs, reduces drug resistance, and enhances the therapeutic effect on tumors such as advanced gastric cancer.
Smart Images

Figure CN115887660B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biomedicine, and relates to application of an inhibitor of hsa_circ_0136666 in preparation of a tumor immune enhancer. BACKGROUND
[0002] Gastric carcinoma (GC) is the second leading cause of cancer death worldwide, with a high mortality rate due to the fact that gastric cancer is often diagnosed at an advanced stage, with about 770,000 deaths in 2020, more than half of the global disease burden in China. Early gastric cancer is mostly asymptomatic or only has mild symptoms. When the clinical symptoms are obvious, the lesion is already in the advanced stage. The main regimen of first-line chemotherapy for the treatment of advanced gastric cancer in clinic includes oxaliplatin combined with fluorouracil drugs, and the targeted drug is trastuzumab (for HER2 positive patients), but due to off-target effects and tumor immune escape mechanisms, the effect of targeted drugs on prolonging the survival period of patients has reached a bottleneck. Therefore, there is an urgent need to find new strategies and methods for the treatment of gastric cancer.
[0003] Immune escape usually refers to an immunosuppressive pathogen that blocks and inhibits the immune response of the body through other structural and non-structural products. The main mode of tumor immune escape is related to T cells. The activation of T cells is related to the activation and inhibition of checkpoint signal pathways. The direct inhibition of T cell function is achieved by up-regulating the interaction between CTLA-4 and PD1 ligand and receptor. During the formation of tumors, tumor cells can change and maintain the conditions for their own survival and development through autocrine and paracrine, promote the growth and development of tumors, and this microsystem that promotes the growth of tumors is called tumor microenvironment. The production of tumor microenvironment is an indirect way to inhibit anti-tumor T cell response. By combined drug use, supplemented with checkpoint inhibitors, the immune escape phenomenon can be greatly avoided, and the activity and effect of anticancer drugs can be enhanced.
[0004] Small nucleic acid drugs are also known as RNAi (RNA interference) technology drugs. Small nucleic acid drugs are a completely new drug category different from small molecule drugs and antibody drugs, and the drug structure is a nucleotide sequence, and the drug mechanism is to act on mRNA to inhibit the expression of target proteins through gene silencing, so as to achieve the purpose of treating diseases. Small nucleic acid drugs cover siRNA, miRNA and antisense nucleic acids, etc. In principle, RNA interference can be used to treat any disease related to the increase of expression of identified genes, including treatment of viral diseases, cancer and inflammatory diseases.
[0005] Circular RNAs (circRNAs) are covalently closed endogenous biomolecules in eukaryotes, which belong to non-coding RNAs. They are generated by a non-canonical splicing process called "back-splicing", in which a downstream donor site is covalently linked to an upstream acceptor site. Circular RNAs are abundant and evolutionarily conserved, and their biogenesis is regulated by specific cis-acting elements and trans-acting factors, with tissue-specific and cell-specific expression patterns. Key physiological functions of circRNAs include miRNA sponges ("sponges"), transcriptional regulators, and binding to RNA-binding proteins, which play important biological functions by regulating protein functions or encoding cryptic peptides. Previous studies have shown that hsa_circ_0136666 is associated with abnormal tumor growth, but the related studies do not provide the immune mechanism related to circRNAs, how to cause T cell inactivation and immune escape phenomenon. SUMMARY
[0006] The present application first proposes the application of hsa_circ_0136666 inhibitor in the preparation of anti-tumor immune escape drugs, that is, the inhibitor can inhibit the tumor immune escape phenomenon; first discloses the immune escape mechanism of hsa_circ_0136666 in gastric cancer, and hsa_circ_0136666 mediates tumor immune escape through the miR-375 / PRKDC / PD-L1 signal axis.
[0007] The specific technical solutions of the present application are as follows:
[0008] Use of an inhibitor of hsa_circ_0136666 in the preparation of a tumor immunopotentiating agent, the cDNA nucleotide sequence of which is shown as SEQ ID NO: 1, and the specific information is as follows: GCAATTTATCATCTCAAGTTCCCCTTAAGAGACTTCTGAACACCTGGACAAACAGATATCCAGATGCTAAAATGGACCCAATGAACATCTGGGATGACATCATCACAAATCGATGTTTCTTTCTCAGCAAAATAGAGGAGAAGCTTACCCCTCTTCCAGAAGATAATAGTATGAATGTGGATCAAGATGGAGACCCCAGTGACAGGATGGAAGTGCAAGAGCAGGAAGAAGATATCAGCTCCCTGATCAGGAGTTGCAAGTTTTCCATGAAAATGAAGATGATAGACAGTGCCCGGAAGCAGAACAATTTCTCACTTGCTATGAAACTACTGAAGGAGCTGCATAAAGAGTCAAAAACCAGAGACGATTGGCTGGTGAGCTGGGTGCAGAGCTACTGCCGCCTGAGCCACTGCCGGAGCCGGTCCCAGGGCTGCTCTGAGCAGGTGCTCACTGTGCTGAAAACAGTCTCTTTGTTGG (SEQ ID NO. 1).
[0009] Preferably, the inhibitor is one or several of an antisense oligonucleotide, siRNA, shRNA, aptamer, and transcriptional activating RNA targeting hsa_circ_0136666.
[0010] Preferably, the siRNA nucleotide sequence is as follows:
[0011] Sense strand: 5’GUUGGGCAAUUUAUCAUCUCAdTdT3’ (SEQ ID NO. 2). Antisense strand: 5’UGAGAUGAUAAAUUGCCCAACdTdT3’ (SEQ ID NO. 3).
[0012] Preferably, the shRNA nucleotide sequence is as follows:
[0013] 5’GTTGGGCAATTTATCATCTCA3’ (SEQ ID No: 6).
[0014] Preferably, the inhibitor is combined with a PD-1, PDL1 inhibitor or a conventional anti-tumor drug, such as a chemical drug, paclitaxel, etc., to reduce the expression of PD-1 or PDL1, thereby reducing tumor immune escape, and the mechanism of action is different from that of the conventional anti-tumor drug, which is a tumor immune enhancer for anti-tumor drugs.
[0015] Preferably, the drug further comprises a gene drug delivery system.
[0016] Preferably, the tumor is liver cancer, lung cancer, colorectal cancer, gastric cancer or breast cancer.
[0017] Mechanism of action:
[0018] As shown in Figure 9 The disclosed mechanism of tumor immune enhancement pathway, i.e. hsa_circ_0136666 mechanism diagram, is hsa_circ_0136666 / miR-375 / PRKDC / PD-L1 signal axis: in tumor cells, hsa_circ_0136666 binds to miR-375 through base complementary pairing, inhibits the function of miR-375 to degrade target gene PRKDC mRNA through 3'UTR, PRKDC transcription up-regulation increases DNA PK protein expression, affects the interaction between DNAPK and PD-L1 protein, enhances the stability of PD-L1 protein, causes the aggregation of PD-L1 on the surface of tumor cells, and the overexpression of PD-L1 on the surface of tumor cells causes T cell immune suppression, down-regulates immune response, and causes tumor immune escape phenomenon.
[0019] The present application proves that hsa_circ_0136666 is generally highly expressed in tumor tissues and tumor cell lines and is related to the malignant degree of tumor through fluorescence in situ hybridization experiments and qRT-PCR experiments; through CCK-8 experiments, it is proved that overexpression of hsa_circ_0136666 promotes tumor cell proliferation, and knockdown inhibits proliferation, but its anti-tumor effect is general; through Western blot experiments, it is proved that overexpression of hsa_circ_0136666 up-regulates the expression of PD-L1 protein; through luciferase experiments and RIP experiments, it is proved that hsa_circ_0136666 and miR-375 and miR-375 and PRKDC 3'UTR exist base complementary pairing sequences; through xenotransplant tumor experiments, it is proved that lentivirus overexpression of hsa_circ_0136666 can significantly promote tumor growth, and knockdown inhibits tumor growth; through enzyme-linked immunosorbent experiments, it is proved that knockdown of hsa_circ_0136666 significantly down-regulates the expression of cancer-promoting factors; through flow cytometry experiments, it is proved that overexpression of hsa_circ_0136666 can promote the proliferation of immune suppressor cells (TAM, Treg, MDSCs), and CD3+CD4+ / CD3+CD8+T cells are significantly reduced, indicating that immune escape occurs.
[0020] Beneficial effects
[0021] The present application first discloses that hsa_circ_0136666 is abnormally highly expressed in advanced gastric cancer tissues, overexpression of hsa_circ_0136666 promotes tumor cell proliferation, and knockdown inhibits proliferation, but its anti-tumor effect is general, which is not enough to be used as an anti-tumor drug development, and during tumor treatment, immune escape occurs, leading to drug resistance or inaction of anti-tumor drugs, especially in the middle and late stages of tumor occurrence, there is no good method to improve it, and different drugs are generally used in clinical to prevent or inhibit the occurrence of immune escape, but the same result will eventually occur, how to find the cause from the source to improve the tumor microenvironment and reduce the risk of immune escape is a technical problem that has been difficult to solve in the field.
[0022] The present application first provides a tumor immune escape mechanism, namely hsa_circ_0136666 / miR-375 / PRKDC / PD-L1. The present application proves through experiments that overexpression of has_circ_0136666 can significantly promote the occurrence of tumor immune escape phenomenon, promote the abnormal increase of TAM, Treg and MDSCs cells in tumor area, and CD4+ and CD8+ T cells are significantly down-regulated. It is suggested that the inhibitor for reducing the expression of hsa_circ_0136666 can be used as a tumor immune enhancer or adjuvant for the treatment of gastric cancer. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1: Figure 1 A is the distribution map of hsa_circ_0136666 in normal tissues, Figure 1 B is the distribution map of hsa_circ_0136666 in carcinoma in situ tissues, Figure 1 C is the distribution map of hsa_circ_0136666 in para-cancer tissues, Figure 1 D is the distribution map of hsa_circ_0136666 in metastatic lesions
[0024] Figure 2 : Expression difference chart of hsa_circ_0136666 in different cell lines
[0025] Figure 3 : Figure 3 A is the efficiency of lentivirus overexpression of hsa_circ_0136666 detected in MKN-45 cells, Figure 3 B is the efficiency of siRNA knockdown of hsa_circ_0136666 detected in AGS cells, Figure 3 C is the CCK-8 curve of MKN-45 cells overexpressing hsa_circ_0136666, Figure 3 D is the CCK-8 curve of AGS cells knocking down hsa_circ_0136666
[0026] Figure 4 : Figure 4 A is the western blot of the expression difference of immune checkpoint proteins and mTOR signaling pathway proteins in AGS cells, Figure 4 B is the western blot of the expression difference of immune checkpoint proteins and mTOR signaling pathway proteins in MKN-45 cells
[0027] Figure 5 : Figure 5 A is the RIP experiment of hsa_circ_0136666 and miR-375 binding, Figure 5 B is the luciferase reporter gene experiment of hsa_circ_0136666 and miR-375 binding, Figure 5 C is the RIP experiment of miR-375 and PRKDC mRNA binding, Figure 5 D is the luciferase reporter gene experiment of miR-375 and PRKDC mRNA binding.
[0028] Figure 6 : Figure 6 A is the tumor photograph of Balb / c Nude overexpressing hsa_circ_0136666 tumor-bearing mice, Figure 6 B is the tumor weight comparison chart of overexpression hsa_circ_0136666 tumor-bearing mice,Figure 6 C is the tumor photograph of hsa_circ_0136666 knockdown tumor-bearing mice, Figure 6 D is the tumor weight comparison chart of hsa_circ_0136666 knockdown tumor-bearing mice
[0029] Figure 7 Figure 7 A is the IL-6 expression difference chart of Balb / c Nude overexpressing hsa_circ_0136666 tumor infiltrating area;
[0030] Figure 7 B is the IL-6 expression difference chart of Balb / c Nude hsa_circ_0136666 knockdown tumor infiltrating area; Figure 7 C is the TGF-β1 expression difference chart of Balb / c Nude overexpressing hsa_circ_0136666 tumor infiltrating area; Figure 7 D is the TGF-β1 expression difference chart of Balb / c Nude hsa_circ_0136666 knockdown tumor infiltrating area
[0031] Figure 8 Figure 8 A is the CD4+CD8+T cell difference chart of C57BL / c mice overexpressing hsa_circ_0136666 tumor-bearing mice tumor infiltrating area, Figure 8 B is the tumor-associated macrophage difference chart of tumor infiltrating area, Figure 8 C is the regulatory T cell difference chart of tumor infiltrating area, Figure 8 D is the myeloid-derived immunosuppressive cell difference chart of tumor infiltrating area Figure 9 Mechanism chart of hsa_circ_0136666 / miR-375 / PRKDC / PD-L1 DETAILED DESCRIPTION
[0032] The present application is further described by the following examples, which include the use of materials and specific sources. It should be understood, however, that these are only examples and are not intended to limit the present application. Materials of similar or identical type, nature or function to the following reagents, types and models of instruments, or properties or functions can be used in the implementation of the present application. Unless otherwise specified, the reagents used in the present application can be any suitable commercially available reagents.
[0033] Example 1. Detection of hsa_circ_0136666 expression in tissues and cells
[0034] 1. Tissue samples
[0035] The tissue chip was selected from the gastric adenocarcinoma tissue chip purchased from Shanghai Xinsuobio Technology Co., Ltd. in 2021, chip number HStmA050Me01, and the tissues included 21 cases of adenocarcinoma or signet ring cell carcinoma primary lesion, paracancerous or metastatic lesion sections, and 5 cases of normal partial gastric tissue sections. The collection of all samples in this study was approved by the hospital ethics committee and the informed consent of the patients was obtained.
[0036] 2. Fluorescence in situ hybridization experiment
[0037] (1) Fixation and permeation
[0038] a. 4% paraformaldehyde room temperature fixation for 10 mins;
[0039] b. 1XPBS wash for 5 mins, 3 times;
[0040] c. Add 1 mL of pre-cooled Triton X-100 to each well, 4°C for 5 mins;
[0041] d. After discarding Triton X-100, wash with 1XPBS for 5 mins, 3 times;
[0042] e. Pre-hybridization: add enough RNA hybridization buffer to cover the chip, incubate at 55°C for 2h.
[0043] (2) Probe denaturation in the dark
[0044] a. Dilute the probe with hybridization buffer, dilution ratio is 1:50-200, commonly used ratio is 1:100. The diluted probe working solution is denatured at 85°C for 5 mins;
[0045] b. The probe working solution is incubated at 37°C for 2 mins.
[0046] (3) Hybridization in the dark
[0047] a. Wipe off the pre-hybridization hybridization buffer;
[0048] b. Add the denatured probe working solution;
[0049] c. Immediately cover the coverslips gently to completely cover the tissue with the probe working solution, or cover with a thin film. The slides are hybridized in a wet box at 37-42°C overnight;
[0050] d. Add 2xSSC dropwise to make the coverslips float off, and after removing the coverslips, wash with PBS for 3 times, 5 mins each time.
[0051] (4) Fluorescence detection in the dark
[0052] a. Add an appropriate amount of 3% BSA solution to the sections, incubate at 37°C for 60 mins;
[0053] b. Wipe off the 3% BSA solution;
[0054] c. Remove the coverslips with 1XPBS, wash twice with PBS for 5 mins each, avoid light, shake off the residual PBS;
[0055] e. Shake off the DAPI, wash with 1XPBS for 3 times, 5 mins each, then rinse with distilled water properly;
[0056] f. Carefully remove the chip from the well under the condition of avoiding light, fix it on the glass slide with mounting medium, and then detect it.
[0057] 3. Cell culture
[0058] Gastric cancer cells AGS, MKN-45 were purchased from Wuhan Ponsay Biotech Co., Ltd. Normal human gastric mucosa epithelial cells GES-1, gastric cancer cells BGC-823, MGC-803 were provided by Nanjing Medical University laboratory; Among them, AGS was cultured with Ham's F-12 complete medium containing 10% fetal bovine serum (Procell, Wuhan, China), MKN-45 was cultured with RPMI-1640 medium containing 20% fetal bovine serum (lonsera, Shanghai, China), GES-1, BGC-823 and MGC-803 were all cultured with RPMI-1640 medium containing 10% fetal bovine serum (lonsera, Shanghai, China). Cultured in a 37℃, 5% carbon dioxide incubator. The experiment used logarithmic growth phase cells.
[0059] 4. RNA extraction
[0060] TRIZOL method was used to extract tissue RNA, and strict enzyme-free operation was carried out throughout the process, and low temperature was paid attention to.
[0061] (1) Personnel and environmental preparation: the experimental personnel wore disposable masks and gloves, sprayed and wiped the experimental table with 0.1% exogenous RNAase inhibitor, and used pipette gun, enzyme-free gun head, 1.5mL enzyme-free EP tube, 2mL enzyme-free grinding tube and other experimental equipment.
[0062] (2) Experimental article preparation: the high-speed low-temperature centrifuge was cooled to 4℃, and chloroform, isopropyl alcohol, anhydrous ethanol and enzyme-free water were inserted into the ice box or placed in the 4℃ refrigerator for precooling, and TRIZOL was balanced to room temperature.
[0063] (3) Cell sedimentation to 1mL TRIZOL, room temperature lysis for 10 minutes.
[0064] (4) Add 200 μL of chloroform to each tube, shake vigorously for at least 15 seconds, and let stand at room temperature for 5-10 minutes. Centrifuge at 12,000 rpm for 15 minutes at 4℃. While waiting for centrifugation, prepare a new 1.5 mL enzyme-free EP tube and label it.
[0065] (5) After centrifugation, gently remove the EP tube from the centrifuge well and insert it into the EP tube rack in the ice box. Do not shake the EP tube vigorously to avoid disrupting the liquid layering. Observation shows that the liquid in the tube is divided into three layers: the upper layer is a colorless aqueous phase, which is the RNA layer; the middle layer is a white membrane-like layer, which is the protein layer; and the bottom layer is a pink organic phase, which mainly contains organic substances such as phenol red and chloroform. Use a 200μL pipette to slowly aspirate the upper colorless liquid into a labeled 1.5mL enzyme-free EP tube, avoiding contact with the white protein layer and the lower pink liquid. You can aspirate three times to obtain 400-500μL of the upper aqueous phase liquid.
[0066] (6) Add an equal volume of pre-cooled isopropanol (about 500 μL) to each tube, tighten the cap, invert the EP tube, mix gently, and let stand at -20°C for 30 minutes.
[0067] (7) Centrifuge at 4℃, 12,000 rpm for 15 min. While waiting for centrifugation, prepare 75% ethanol (anhydrous ethanol: enzyme-free water = 3:1), and insert it into an ice box to pre-cool after preparation.
[0068] (8) After centrifugation, carefully discard the supernatant, add 1 mL of the above-prepared 75% ethanol to each tube, tighten the cap, invert the EP tubes, and tap the tube walls to make the RNA adhering to the bottom of the tube float in the liquid. This washing is more thorough and can reduce organic contamination.
[0069] (9) Centrifuge at 4℃, 12,000 rpm for 3 min.
[0070] (10) After centrifugation, a porcelain white gel-like precipitate can be seen at the bottom or side wall of the tube, which is RNA. After pouring out the liquid in the tube, centrifuge again at 4°C, 12,000 rpm for 3 min.
[0071] (11) Carefully aspirate the remaining liquid in the tube using a pipette until it is completely aspirated. Place the open end of the EP tube on the EP tube rack to air dry naturally. When the precipitate becomes translucent, add an appropriate amount of enzyme-free water according to the size of the precipitate, and place it in a 4°C refrigerator for half an hour to allow it to fully dissolve.
[0072] (12) Mix the RNA solution by pipetting, and use a Nanodrop2000 micro spectrophotometer to detect the RNA concentration and OD value. The RNA sample can be stored at -80℃ or directly start subsequent experiments.
[0073] 5. Reverse transcription of mRNA into cDNA
[0074] The reverse transcription kit HiScriptIIIRTSuperMix for qPCR (+gDNA wiper) (R323-01) developed by Vazyme Company was used in this experiment, which included two steps of genomic DNA removal and cDNA synthesis. The operation was carried out according to the instructions of the kit.
[0075] (1) Personnel and environmental preparation: the experimental personnel wore disposable masks and gloves, sprayed and wiped the experimental table with 0.1% exogenous RNAase inhibitor, and used pipettes, enzyme-free gun heads, 1.5 mL enzyme-free EP tubes, enzyme-free PCR tubes and other experimental equipment.
[0076] (2) Experimental article preparation: the required reagents in the kit R323-01 were taken out from -20℃, and after thawing, the tube wall was knocked, the liquid in the tube was mixed, and then it was inserted into the ice box for use after point separation.
[0077] (3) Removal of genomic DNA: the reaction solution was prepared in an enzyme-free PCR tube according to the system shown in Table 1 below.
[0078] Table 1 Genomic DNA removal reaction system
[0079]
[0080] (4) Mix the above-mentioned reagents and sample RNA, and then place it in the PCR instrument after point separation, and carry out the reaction according to the following program:
[0081] ① 42℃, 2min; ② 4℃, ∞.
[0082] (5) Reverse transcription reaction: the reverse transcription reaction solution was prepared according to the system shown in Table 2 below.
[0083] Table 2 Reverse transcription reaction system
[0084]
[0085] (6) Mix the above-mentioned reagents and sample RNA, and then place it in the PCR instrument after point separation, and carry out the reaction according to the following program:
[0086] ① 37℃, 15min; ② 85℃, 5sec; ③ 4℃, ∞.
[0087] (7) After the reverse transcription was completed, 20 μL of cDNA stock solution was obtained and stored at -80℃. When used, avoid repeated freezing and thawing.
[0088] 6. Real-time fluorescent quantitative PCR reaction
[0089] 2x ChamQ Universal SYBR qPCR Master Mix kit from Vazyme was used and the kit instructions were followed. Table 3 shows the preparation system of the PCR reaction solution.
[0090] Table 3 Real-time fluorescent quantitative PCR reaction system
[0091]
[0092] (1) Preparation of experimental items: 2x ChamQ Universal SYBR qPCR Master Mix, forward primer, reverse primer and cDNA were taken out from -20°C, and after thawing, the tube wall was knocked, the liquid in the tube was mixed, and then it was inserted into an ice box for use after being spotted apart.
[0093] (2) For the same amplification gene, a mixture composed of 2x ChamQ Universal SYBR qPCR Master Mix, forward primer, reverse primer and enzyme-free water was prepared according to the amount of reaction number + 1, and then it was mixed and added to the hole of the PCR reaction plate at 9 μL per hole. Finally, the corresponding template was added.
[0094] (3) After the PCR reaction plate was completely sealed with a sealing film, it was centrifuged at 4°C, 2,500 rpm for 4 min.
[0095] (4) The PCR reaction plate was placed in the corresponding module of the fluorescent quantitative PCR instrument, and the following table 4 reaction program was set, and then the amplification was started to detect the expression of the target gene.
[0096] Table 4 qRT-PCR reaction program
[0097]
[0098] Upstream primer: F: 5'-CAGAGACGATTGGCTGGTGA-3', as shown in SEQ No. 4;
[0099] Downstream primer: R: 5'-TGATAAATTGCCCAACAAAGAGACT-3', as shown in SEQ No. 5.
[0100] (5) Relative quantitative analysis of genes: After each denaturation period, the instrument automatically records the average fluorescence value of the last 10% of the cycle time to represent the PCR production at the end of the last cycle, and accumulates in turn. After all reactions are completed, the fluorescence intensity values of all reaction wells are obtained, and the amplification curve graph is automatically generated and converted into data for analysis. We set the threshold value in the exponential growth range of the curve, and according to the cycle number experienced by each reaction well when the fluorescence intensity reaches the threshold value, that is, the Ct value, relative quantitative analysis is carried out. The calculation formula is: relative expression = 2^-ΔΔCt (wherein, ΔCt = Ct value of target gene - Ct value of internal reference gene, ΔΔCt = experimental group ΔCt - average value of control group ΔCt).
[0101] 7. Results:
[0102] hsa_circ_0136666 is highly expressed in clinical gastric cancer tissues and gastric cancer cell lines, and the specific results are as follows:
[0103] Figure 1 The results show that hsa_circ_0136666 is expressed in normal, primary, adjacent tumor and metastasis (FITC-labeled with green fluorescence), and the expression level of primary tumor (Tumor tissue) is the highest, followed by adjacent tumor (Adjacent-tumor), and the expression level of metastasis (Metastasis) is lower, but still higher than that of normal tissue. The hsa_circ_0136666 molecule provided by the present application is abnormally highly expressed in gastric cancer tissues, indicating that hsa_circ_0136666 has good regional specificity expression, and has a good indication effect on tumor prevention and treatment.
[0104] Figure 2 The results show that compared with normal human gastric mucosa epithelial cells GES-1 cells, the expression level of hsa_circ_0136666 in each gastric adenocarcinoma cell line is generally high. Among the four gastric cancer cells, the expression level of hsa_circ_0136666 in MKN-45 is the lowest, and the expression level in MGC-803 cells is the highest. And the difference is significant. *p<0.05, ***p<0.001, ****p<0.0001.
[0105] This example shows that hsa_circ_0136666 is generally up-regulated in gastric cancer from the aspects of cells and tissues, and is related to the cachexia of tumor. It is suggested that the expression of hsa_circ_0136666 is closely related to the growth process of tumor.
[0106] Example 2. Detection of the effect of hsa_circ_0136666 and siRNA on the proliferation of gastric cancer cells
[0107] 1. Virus vector construction
[0108] The cDNA sequence of hsa_circ_0136666 was inserted into a lentiviral expression vector to construct a virus vector overexpressing hsa_circ_0136666. The sequence map of hsa_circ_0136666 was provided by the inventor, and the virus vector was constructed by Shanghai Jimai Technology Co., Ltd.
[0109] 2. Cell line and cell culture
[0110] The gastric cancer cell line MKN-45 cells were taken and cultured in an RPMI-1640 medium supplemented with 20% fetal bovine serum and 1% double-antibiotic at 37°C in a 5% CO2 incubator.
[0111] 3. Virus transfection
[0112] (1) 18-24 hours before lentivirus transfection, adherent cells were plated at 1×10^5 / well in a 24-well plate. The number of cells at the time of lentivirus transfection was about 2×10^5 / well.
[0113] (2) The next day, the original culture medium was replaced with 2 ml of fresh culture medium containing 6 μg / ml polybrene, and an appropriate amount of virus suspension was added. Incubate at 37°C.
[0114] (3) Continue to culture for 24 hours, replace the virus-containing culture medium with fresh culture medium.
[0115] (4) After 72-96 hours of infection, observe the fluorescence expression.
[0116] (5) The cells were expanded to a 12-well plate, and a culture medium containing 0.8 μg / ml puromycin was added for screening culture.
[0117] (6) The puromycin-screened cells were expanded and cultured, and part of the cells were collected and detected for overexpression effect by fluorescence quantitative PCR.
[0118] 4. Small interfering RNA (siRNA) construction
[0119] Specific small interfering RNA (siRNA) targeting the reverse splice site of hsa_circ_0136666 and negative control (si-NC) were designed and synthesized by Biomics, and the sequence map of hsa_circ_0136666 was provided by the inventor.
[0120] The siRNA sequence is as follows:
[0121] Sense: 5' GUUGGGCAAUUUAUCAUCUCAdTdT 3' (SEQ ID NO. 2).
[0122] Antisense: 5' UGAGAUGAUAAAUUGCCCAACdTdT 3' (SEQ ID NO. 3).
[0123] 5. siRNA transfection
[0124] 50nM siRNA was transfected into AGS cells by jet-PRIME (polyplus, New York, USA). The interference effect was detected by fluorescence quantitative PCR.
[0125] 6. CCK-8 experiment
[0126] (1) After the cells treated in step 3 and step 5 above were digested and centrifuged, the cells were counted. The cell suspension was adjusted to a concentration of 5x10^4 / mL, and the cell suspension was mixed and plated into a 96-well plate, 100 μL of cell suspension per well, i.e. 5000 cells per well. Each group of cells had 3-6 replicate wells, and in addition, six wells containing medium were set as blank controls (100 μL of empty medium was also added to each well).
[0127] (2) After the cells were cultured for about 8h and adhered, 10 μL of CCK-8 reaction solution was added to each well of the first cell culture plate, and incubated at 37°C for 1h in the dark. The OD value at 450nm was detected as the initial value on the first day.
[0128] (3) The next four days required adding CCK-8 reagent at the same time point to observe the proliferation changes of the cells.
[0129] (4) After detecting the cell OD value for three consecutive days, the data was analyzed by Graphpad Prime 8 software.
[0130] 7. Data processing and analysis
[0131] SPSS23.0 software was used for statistical analysis of the results. GraphPad Prism 8.0 software was used for plotting. According to the situation, paired t-test was used for statistical analysis. The data was expressed as the mean ± standard deviation of at least three independent experiments, and P<0.05 was considered statistically significant.
[0132] 8. Results:
[0133] Overexpression of hsa_circ_0136666 leads to tumor cell proliferation, and after knocking down hsa_circ_0136666 with the interference sequence siRNA, tumor proliferation is reduced. The specific results are as follows:
[0134] Figure 3 A results show that compared with NC (negative control group), the overexpression efficiency of hsa_circ_0136666 lentivirus is about 100 times, reaching the overexpression effect; Figure 3 B results show that compared with NC (negative control group), the knockdown efficiency of siRNA on hsa_circ_0136666 is about 70%, reaching the knockdown effect; Figure 3 C results show that in MKN-45 cells, overexpression of hsa_circ_0136666 can enhance the proliferation ability of tumor cells, NC represents hsa_circ_0136666 empty load, and the difference is significant; Figure 3 D results show that after AGS cell transfection siRNA, the proliferation ability of tumor cells is weakened, si-NC represents the interference negative control group, and the difference is significant. *p<0.05, **p<0.01, ****p<0.0001.
[0135] This example shows that hsa_circ_0136666 is closely related to gastric cancer cell proliferation from the aspects of hsa_circ_0136666 overexpression and knockdown.
[0136] Example 3. Detection of the influence of hsa_circ_0136666 on immune checkpoint related protein expression
[0137] 1. Cell line and cell culture
[0138] Take MKN-45 and AGS cells, and culture in the same way as in Example 1.
[0139] 2. Plasmid transfection
[0140] The cells were inoculated into a 6-well plate one day in advance, and the cell density was controlled to reach 70% the next day. The overexpression plasmid of hsa_circ_0136666 was transfected using Polyplus transfection reagent.
[0141] 3. Extraction of cell protein
[0142] Discard the culture solution, wash the cells with 4℃ pre-cooled PBS for 2 times, and then pour off the PBS and place the cell culture bottle on ice. Add 200μl of protease and phosphatase inhibitor-containing lysis solution, shake well, and lyse on ice for 30 minutes. The cell bottle should be shaken constantly during the lysis period. After complete lysis, scrape the adherent cells with a cell scraper, and transfer the cells and lysis solution to a clean 1.5ml centrifuge tube. Centrifuge at 12000rpm, 4℃, 5min. Absorb the supernatant in the centrifuge tube after centrifugation, and transfer it to a new centrifuge tube. The supernatant contains protein samples. If not used immediately, store the samples in a -80℃ freezer.
[0143] 4. Results
[0144] The results of the Western blot experiment showed that overexpression of hsa_circ_0136666 can significantly increase the expression of immune checkpoint protein PD-L1 in two cell lines, and the expression is reduced after knockdown. It has little effect on the expression of other immune checkpoint and mTOR pathway proteins. The results are shown in Figure 4 .
[0145] This embodiment detects immune checkpoint pathway and mTOR cancer-promoting pathway key molecules from protein expression level, shows that overexpression of hsa_circ_0136666 can significantly increase the expression of PD-L1, siRNA can significantly reduce the expression of PD-L1 protein, which suggests that hsa_circ_0136666 regulates tumor immunity through PD-L1 pathway.
[0146] Example 4. Verification of hsa_circ_0136666 regulating miR-375 / PRKDC pathway
[0147] 1. Bioinformatics prediction
[0148] Using starBase v2.0 online prediction software, the base complementary pairing binding site of hsa_circ_0136666 and miR-375 was predicted; using miRmap online prediction software, the base complementary pairing binding site of miR-375 and PRKDC mRNA 3'UTR was predicted.
[0149] 2. Luciferase reporter gene experiment
[0150] The circ-PRKDC or PRKDC 3'UTR fragment containing the wild type or mutant complementary sequence of miR-375 was cloned into the pmir-report vector to establish the luciferase reporter plasmid: WT-circ-PRKDC, MUT-circ-PRKDC, PRKDC 3'UTR-WT and PRKDC 3'UTR-MUT. Next, HEK-293T cells were seeded into a 24-well plate. MiR-375 or miR-NC was transfected into the cells together with the indicated vector, and the Renilla luciferase plasmid was co-transfected. The luciferase activity was detected by the dual luciferase reporter kit (Vazyme) 48 hours later.
[0151] 3. RIP experiment
[0152] RIP assay was performed using Protein A / G magnetic beads (Bimake). MKN-45 cells were co-transfected with wild type or mutant sequence hsa_circ_0136666 (PRKDC 3’UTR) and miR-375 mimics, and after 48 h of culture, the cells were added with RIPA lysis buffer, and then the cell extracts were incubated with immunoglobulin G (anti-IgG) or Argonaute-2 (Ago2) overnight, and Protein A / G magnetic beads were added at 4°C for 2 hours. Finally, the level of miR-375 on the magnetic beads was quantified by qRT-PCR analysis.
[0153] 4. Results
[0154] hsa_circ_0136666 has base complementary pairing sequence with miR-375, and can directly bind and enrich miR-375, and miR-375 can bind to the PRKDC 3’UTR region. The specific results are as follows:
[0155] Figure 5 The results show that by using bioinformatics prediction software, the binding sequence of hsa_circ_0136666 and miR-375 is found, and the luciferase experiment proves that the mutual binding can reduce the luciferase activity, which indirectly proves that hsa_circ_0136666 and miR-375 are mutually combined; the RIP experiment proves that hsa_circ_0136666 can bind and enrich miR-375. Similarly, miR-375 can bind to the PRKDC 3’UTR region. The above results are significant. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001
[0156] This example proves that hsa_circ_0136666, miR-375 and PRKDC 3’UTR are mutually combined through base complementary pairing, which suggests that the hsa_circ_0136666 / miR-375 / PRKDC signal axis plays a key role in tumor signal transduction.
[0157] Example 5. Detection of the effect of hsa_circ_0136666 on tumor growth and tumor immunity
[0158] 1. Xenograft tumor experiment
[0159] (1) Preparation of nude mice, female 5-week-old BALB / cNude mice, body weight 18-20 g, purchased from Jiangsu Jizhuangkang Biotechnology Co., Ltd. (License No. SCXK (Su) 2018-0008), and raised in SPF level experimental animal breeding room with 12:12 light / dark cycle, constant temperature and humidity culture.
[0160] (2) Interference lentivirus construction
[0161] The specific interference lentivirus targeting the reverse splicing site of hsa_circ_0136666 and the negative control virus were synthesized by Genomed (Shanghai), and the sequence map of hsa_circ_0136666 was provided by the inventor. The shRNA target sequence is as follows: 5 'GTTGGGCAATTTATCATCTCA3'(SEQ ID No: 6)
[0162] (3) shRNA infection
[0163] The interference lentivirus infected human gastric cancer MKN-45 cells.
[0164] (4) Cell preparation, expansion culture MKN-45 hsa_circ_0136666 overexpression and blank control group cells, MKN-45 shRNA and blank control group cells, digestion and centrifugation to collect cells, and cell counting. The cell suspension was prepared into a cell suspension with a density of 2x10^7 / 100uL.
[0165] (5) Tumorigenesis, inject the cell resuspension into the left and right two abdominal armpit and inguinal subcutaneous parts of the mouse, and inject 2x10^7 cells in each part. After injection, maintain the original feeding environment conditions, and after one week of injection, the nude mice were sacrificed by dislocation of the cervical spine. The tumor was removed, weighed, and photographed.
[0166] (6) Results
[0167] Lentivirus infection of hsa_circ_0136666 promotes tumor volume increase, and lentivirus infection of shRNA inhibits tumor growth. The specific results are as follows:
[0168] Figure 6 A result shows that the tumor volume of the hsa_circ_0136666 overexpression MKN-45 cell group injected is significantly increased, and NC represents the MKN-45 cell group injected with negative control treatment; Figure 6 B result shows that compared with the NC group, the tumor weight of the hsa_circ_0136666 overexpression MKN-45 cell group is significantly increased, and the difference is significant; Figure 6 C result shows that the tumor volume of the sh_circ_0136666 knockdown expression cell group injected is significantly reduced, and NC represents the MKN-45 cell group injected with negative control treatment; Figure 6 D result shows that compared with the NC group, the tumor weight of the sh_circ_0136666 knockdown expression cell group is significantly reduced, and the difference is significant. **p<0.01, ***p<0.001
[0169] 2. Enzyme-linked immunosorbent assay
[0170] (1) For tumor tissues with little difference in tumor weight, add 300 μl of normal saline (0.9% NaCl solution) to the tube, then homogenize with an electric homogenizer.
[0171] (2) Before homogenization, wash the blades twice in advance, each time using 300 μl of normal saline, then maintain constant stirring at 4°C for 2 hours (on a rotary shaker in a cold room).
[0172] (3) Centrifuge at 13,000 x rpm for 20 minutes at 4°C. Place on ice, aliquot the supernatant into new, pre-cooled tubes and store the samples at -80°C. Minimize the number of freeze-thaw cycles as much as possible.
[0173] (4) Perform the experiment according to the instructions of the UNIKRINE Mouse IL-6 ELISA Kit (Catalog No.: EK206) and the Human / Mouse / Rat TGF-β1 ELISA Kit (Catalog No.: EK981).
[0174] (5) Results
[0175] The lentivirus infection hsa_circ_0136666 group significantly up-regulated the pro-cancer factor IL-6, and the lentivirus infection shRNA group significantly down-regulated the cytokines IL-6 and TGF-β1. It shows that the tumor microenvironment is regulated by hsa_circ_0136666. The specific results are as follows:
[0176] Figure 7 A result shows that after lentivirus overexpression of hsa_circ_0136666, IL-6 in the tumor infiltrating area is significantly up-regulated; 7B result shows that after lentivirus infection of shRNA, IL-6 in the tumor infiltrating area is significantly down-regulated; Figure 7 C result shows that after lentivirus overexpression of hsa_circ_0136666, TGF-β1 in the tumor infiltrating area has no significant change compared with the NC group; Figure 7 D result shows that after lentivirus infection of shRNA, TGF-β1 in the tumor infiltrating area is significantly down-regulated. Some results are significant. *p<0.05, **p<0.01
[0177] 3. Same species tumor transplantation experiment
[0178] (1) Mouse preparation, female 5-week-old C57BL / c mice, body weight 18-20 g, purchased from Qinglongshan Animal Breeding Farm (License No.: SCXK (YU) 2020-0005), fed in SPF level experimental animal breeding room, 12:12 light / dark cycle, constant temperature and humidity culture.
[0179] (2) Cell preparation, expand culture MFC (mouse gastric cancer cell) hsa_circ_0136666 overexpression and blank control group cells, digestion and centrifugation to collect cells, cell counting. The cell suspension was prepared to a density of 1x10^7 cells / 100uL of cell suspension.
[0180] (3) Tumorigenesis process, inject cell resuspension into the left and right abdominal axillary and inguinal subcutaneous sites of mice, 1x10^7 cells per site. Maintain the original feeding environment after injection. After 21 days of injection, the mice were executed by dislocation. The tumor tissue was removed and subjected to the next experiment.
[0181] 4. Flow cytometry
[0182] (1) Collect the tumor tissue into a tissue culture dish containing 5mL of PBS. Use a 1mL syringe to squeeze the tissue at the bottom to break it into a single cell suspension. Place a cell filter (300 mesh screen) at the top of a 15ml centrifuge tube. Pass the cells in the tissue culture dish through the cell filter to remove cell clumps and debris.
[0183] (2) Centrifuge the cell suspension at 1850rpm for 5 minutes at 2-8°C, discard the supernatant.
[0184] (3) Resuspend the cell pellet in an appropriate volume of PBS, then perform cell counting and activity analysis.
[0185] (4) Make the final concentration of cells 1x10^7 cells / mL, and aliquot into different Ep tubes. According to the experimental group, set up the same type of control tube and each flow channel single positive tube CD3 / CD4 / CD8 (detecting tumor-associated macrophages as CD11c / CD86 / CD206, detecting regulatory T cells as CD4 / Foxp3, detecting MDSCs as CD11b / Gr-1, and so on).
[0186] (5) Add 0.5ul of fluorescent antibody CD3 / CD4 / CD8 (CD11c / CD86 / CD206, CD4 / Foxp3, CD11b / Gr-1), avoid light incubation for 20min.
[0187] (6) Centrifuge the cell suspension at 1850rpm for 5 minutes at 2-8°C, discard the supernatant, and remove the unbound antibody.
[0188] (7) Resuspend the cell pellet in no less than 200ul of PBS, pass the cells through the cell filter (300 mesh screen) to the polypropylene tube (flow tube), and detect on the machine.
[0189] (8) Results
[0190] Overexpression of hsa_circ_0136666 significantly up-regulates the pro-cancer phenotype of immune suppressive cells (TAM, Treg, MDSCs), reduces the number of immune cells (CD4+ and CD8+ T cells), and promotes the occurrence of tumor immune escape. The specific results are as follows:
[0191] Figure 8 A shows that in C57BL / c mice inoculated with hsa_circ_0136666 overexpression MFC cells, the number and proportion of CD3+CD4+ and CD3+CD8+ T cells in the tumor tissue of the mice are significantly reduced, indicating that the anti-tumor immune function is weakened, Figure 8 B, Figure 8 C, Figure 8 D respectively show that compared with the control group, the pro-cancer phenotype of tumor-associated macrophages, regulatory T cells and MDSCs cells in the overexpression group is significantly up-regulated. NC represents the group inoculated with negative control treated MFC cells. This example shows that hsa_cic_0136666 can regulate immune function, cause immune disorders, and promote the occurrence of immune escape.
[0192] This example shows from the tumor volume, tumor weight, cytokines and immune cells that overexpression of hsa_circ_0136666 significantly promotes the immune escape process, and the tumor growth of the lentivirus infected shRNA group is significantly inhibited. It is suggested that hsa_circ_0136666 is a key factor of immune response, and the inhibitor that reduces the expression of hsa_circ_0136666 can be used as an anti-tumor immune escape drug for the treatment of cancer.
[0193] The above examples are exemplary, and are only the preferred specific embodiments of the present application, and the protection scope of the present application is not limited thereto. For those skilled in the art, without departing from the technical principles of the present application, a number of improvements and modifications can also be made, and these improvements and modifications should also be considered as the protection scope of the present application.
Claims
1. Use of an inhibitor of hsa_circ_0136666 in the preparation of a tumor immunopotentiator, the nucleotide sequence of the hsa_circ_0136666 being as shown in SEQ ID NO: 1; characterized in that: The inhibitor is an siRNA or shRNA targeting hsa_circ_0136666; The siRNA nucleotide sequence is as follows: the sense strand is SEQ ID NO. 2, and the antisense strand is SEQ ID NO. 3; The shRNA nucleotide sequence is as follows: SEQ ID No: 6; The tumor is gastric cancer.
2. Use according to claim 1, characterized in that, The inhibitor of hsa_circ_0136666 is used in combination with an anti-tumor drug.
3. Use according to claim 2, characterized in that, The anti-tumor drug is a PD-1 inhibitor, a PDL1 inhibitor, platinum, fluorouracil or paclitaxel.