A method for oversupplying cytoplasmic acetyl-CoA in yeast and its application

Abstract

The present invention belongs to the field of biotechnology, and in particular, relates to a method for oversupplying cytoplasmic acetyl-CoA and a related strain construction method. The present invention first analyzes the various destinations of intracellular acetyl-CoA, and reduces the flux of acetyl-CoA to lipid synthesis by enzyme engineering means, which effectively increases the level of cytoplasmic acetyl-CoA without affecting strain growth; further, the present invention also characterizes the endogenous peroxidase / mitochondrial carnitine acyl transfer pathway of Yarrowia lipolytica, which effectively increases cytoplasmic acetyl-CoA while clarifying the transport mode of the yeast; finally, the present invention further increases the cytoplasmic acetyl-CoA content by accelerating lipid recycling. These diverse and multi-angle metabolic engineering strategies broaden the cytoplasmic acetyl-CoA capacity, perform well in constructing cell factories for producing compounds with acetyl-CoA as precursors, and have wide application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for oversupplying cytoplasmic acetyl-CoA and a related strain construction method, and an application in producing sesquiterpene products. Background Art

[0002] Acetyl CoA is an important intermediate metabolite in cell metabolism, involving the TCA cycle and the supply of ATP and reducing power. It is also a precursor for the synthesis of energy substances such as fatty acids and ketone bodies, and a precursor for the synthesis of physiologically active substances such as cholesterol and its derivatives. A variety of high-value chemicals can be synthesized from acetyl CoA, including fatty acids, flavonoids and terpenoids.

[0003] The non-traditional yeast Yarrowia lipolytica is an industrial oil yeast. Studies have reported that fermentation of Yarrowia lipolytica fermentation broth can eventually harvest 70% of the strain's dry weight of lipids. The natural cell metabolic pathway of Yarrowia lipolytica with glucose as a carbon source tends to accumulate lipids as a storage energy source. However, the continuous deepening of the understanding of the physiological metabolism of Yarrowia lipolytica and the rapid development of genetic modification technologies such as CRISPR / Cas and Cre / loxP have promoted the process of metabolic engineering of Yarrowia lipolytica. This traditional oil-producing yeast has been developed into a diversified chemical cell factory, especially with potential in the production of compounds derived from acetyl-CoA.

[0004] At present, methods including strengthening lipid recycling, knocking out lipid synthesis genes, and expressing exogenous pathways to oversupply acetyl-CoA in the cytoplasm have been successful in Yarrowia lipolytica. For example, β-oxidation is the main way for acyl-CoA to be converted into acetyl-CoA in cells. Overexpression of key genes in the β-oxidation pathway includes

[0005] MFE2 , PEX10 etc. can increase the supply of cytosolic acetyl-CoA, but this method is not advantageous when non-lipid carbon sources are used. Furthermore, knocking out genes in the triglyceride synthesis pathway such as DGA1 and DGA2 Acetyl-CoA supply can be increased, but with a decrease in cell growth rate and biomass. Introduction of heterologous pathways including the peroxidase / mitochondrial carnitine acyltransfer pathway from Saccharomyces cerevisiae or the non-oxidative pentose phosphate pathway from Bacillus subtilis can increase cytosolic acetyl-CoA levels, but heterologous pathways have limited applicability. Summary of the invention

[0006] The present invention first analyzes the various destinations of intracellular acetyl-CoA, and reduces the flux of acetyl-CoA to lipid synthesis by enzyme engineering, which effectively increases the cytoplasmic acetyl-CoA level without affecting the growth of the strain (if the lipid synthesis pathway is completely knocked out, it will lead to lethal results); further, the present invention also characterizes the endogenous peroxidase / mitochondrial carnitine acyl transfer pathway of Yarrowia lipolytica, which effectively increases cytoplasmic acetyl-CoA and clarifies the transport mode of the yeast; finally, the present invention further increases the cytoplasmic acetyl-CoA content by accelerating lipid recycling. Thus, the present invention is completed.

[0007] The invention provides a method for oversupplying cytoplasmic acetyl-CoA in yeast and a related strain construction method.

[0008] The invention provides a method for oversupplying cytoplasmic acetyl-CoA in yeast, and a strain for oversupplying acetyl-CoA is constructed based on the method.

[0009] The present invention provides a method for constructing a recombinant genetic engineering bacterium that oversupplies cytoplasmic acetyl-CoA, comprising mutating yeast endogenous acetyl-CoA carboxylase (ACC1) to ACC1 S667D ACC1 S667E ACC1 S1178D and ACC1 S1178E , constructing different ACC1 mutants: ACC1 S667D ACC1 S667E ACC1 S1178D and ACC1 S1178E The mutant recombinant genetically engineered bacteria can weaken lipid synthesis and increase the supply of acetyl-CoA in the cytoplasm. The yeast is any one of the yeasts such as Yarrowia lipolytica, Saccharomyces cerevisiae, Kluyveromyces, Pichia pastoris, Hansenula, etc. with endogenous ACC1. Optionally, the starting Yarrowia lipolytica is GA-1.

[0010] The present invention characterizes the endogenous peroxidase / mitochondrial carnitine acyl transfer pathway of Yarrowia lipolytica for the first time, including overexpression of carnitine acetyltransferase (CAT2) in the starting strain, which accelerates the transmembrane transport of acetyl-CoA.

[0011] Furthermore, in order to accelerate the reuse of stored lipids in the starting bacteria, the contents of triacylglycerol lipase (TGL4) gene, fatty acid coenzyme A synthetase (FAA1) gene, multifunctional β-oxidase (MFE1) gene, 3-ketoacyl coenzyme A sulfhydrylase (POT1) gene and peroxisomal matrix protein (PEX10) gene are increased. For example, increasing the content and / or expression level of the enzyme is achieved by increasing the copy number or transcription level of the corresponding enzyme gene of the starting bacteria.

[0012] Furthermore, in order to increase the level of acetyl-CoA from citrate lysis in the starting bacteria, the expression levels of citrate lyases (ACL1 and ACL2) were increased.

[0013] The starting strain is further subjected to at least one of the following transformations to obtain the genetically engineered strain: A1, site-directed mutation ACC1 to ACC1 S667D ACC1 S667E ACC1 S1178D and ACC1 S1178E ; A2, Strengthen CAT2 Gene expression; A3, enhancement TGL4 Gene expression; A4, enhancement FAA1 Gene expression; A5, enhancement MFE1 Gene expression; A6, enhancement POT1 Gene expression; A7, enhancement PEX10 Gene expression; A8, enhancement ACL1, ACL2 Gene expression;.

[0014] Optionally, the ACC1 The sequence of the ACC1 protein encoded by the gene is Genbank accession number AOW02694.1; and / or, ACL2 The sequence of the ACL2 protein encoded by the gene is Genbank accession number AOW04580.1; and / or, CAT2 The sequence of the CAT2 protein encoded by the gene is Genbank accession number AOW01502.1; and / or, TGL4 The sequence of the TGL4 protein encoded by the gene is Genbank accession number AOW06932.1; and / or, FAA1 The sequence of the FAA1 protein encoded by the gene is Genbank accession number AOW04223.1; and / or, MFE1 The sequence of the MFE1 protein encoded by the gene is Genbank accession number AOW05454.1; and / or, POT1 The sequence of the POT1 protein encoded by the gene is Genbank accession number AOW05614.1; and / or, PEX10 The sequence of the PEX10 protein encoded by the gene is Genbank accession number AOW02173.1; and / or, ACL1 The sequence of the ACL1 protein encoded by the gene is Genbank accession number AOW06401.1.

[0015] More preferably, according to the above construction method, the A1 is subjected to site-directed mutation of the starting bacteria ACC1 Gene realization; and / or, the A2 is introduced into the starting bacteria CAT2Gene expression cassette is realized; and / or, the A3 is introduced into the starting bacteria TGL4 Expression cassette is realized; and / or, the A4 is introduced into the starting bacteria FAA1 Achieve; and / or, the A5 is introduced into the starting bacteria MFE1 Gene expression cassette is realized; and / or, the A6 is introduced into the starting bacteria POT1 Gene expression cassette is achieved; and / or, the A7 is introduced into the starting bacteria PEX10 Gene expression cassette is realized; and / or, the A8 is introduced into the starting bacteria ACL1, ACL2 Gene expression cassette implementation.

[0016] More preferably, the ACC1 The mutant is a protein ACC1 in which the serine at position 667 and the serine at position 1178 are mutated to aspartic acid or glutamic acid.

[0017] Preferably, according to the above construction method, the gene expression cassette comprises a promoter, the gene open reading frame and a terminator, and the promoter is P EXP1 ; The terminator is T PEX20 .

[0018] Preferably, according to the above construction method, the genes involved in the genetic engineering modification are all endogenous genes of Yarrowia lipolytica.

[0019] The present invention thus provides a recombinant genetically engineered bacterium obtained by the above-mentioned construction method.

[0020] Another object of the present invention is to provide an application method for producing high value-added chemicals using cytosolic acetyl-CoA.

[0021] The present invention also provides any one of the following applications related to the production of acetyl-CoA derivative products: X1, application of the above-mentioned construction method or the recombinant genetically engineered bacteria obtained therefrom in the preparation and production of acetyl-CoA derivative products; X2, application of the above-mentioned construction method or the recombinant genetically engineered bacteria obtained therefrom in the production of acetyl-CoA derivatives.

[0022] The present invention firstly downregulates the activity of endogenous ACC1 of Yarrowia lipolytica by point mutation, thereby achieving oversupply of acetyl-CoA without affecting the normal growth of the strain. Compared with literature reports, reducing lipid production without affecting strain growth is a major advantage; further, the present invention is the first to characterize the endogenous peroxidase / mitochondrial carnitine acyl transfer pathway of Yarrowia lipolytica, which effectively increases cytoplasmic acetyl-CoA; finally, the present invention further increases the cytoplasmic acetyl-CoA content by accelerating lipid recycling. The recombinant genetically engineered bacteria thus obtained have significant effects in producing high-value-added acetyl-CoA derivatives and have wide application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Enhanced sesquiterpene production levels in engineered strains of cytosolic acetyl-CoA.

[0024] Figure 2 Superimposed ACC1 mutation and key gene overexpression strains on sesquiterpene production. Implementation

[0025] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0026] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0027] Graphpadprism 9.0 statistical software was used to process the data, and the experimental results were expressed as mean values.

[0028] YPD medium, each liter of YPD medium contains: 20g peptone, 10g yeast extract, 20g glucose, 20g agar powder (added to YPD solid medium). Resistance medium is YPD liquid or solid medium supplemented with 250 mg / L of nourseothricin.

[0029] Delft liquid medium, each liter of Delft liquid medium contains: 20 g glucose, 7.5 g ammonium sulfate, 0.5 g magnesium sulfate heptahydrate, 14.4 g potassium dihydrogen phosphate, 2 ml trace metal salt stock solution (1 liter volume contains 3.0 g iron sulfate heptahydrate, 4.5 g zinc sulfate heptahydrate, 4.5 g calcium chloride dihydrate, 0.84 g manganese chloride dihydrate, 0.3 g cobalt chloride hexahydrate, 0.3 g copper sulfate pentahydrate, 0.4 g sodium molybdate dihydrate, 1.0 g boric acid, 0.1 g potassium iodide, 19.0 g ethylenediaminetetraacetic acid disodium salt), 1 ml vitamin stock solution (1 liter volume contains 0.05 g D-biotin, 1.0 g D-pantothenic acid, 1.0 g vitamin B1, 1.0 g pyridoxine, 1.0 g niacin, 0.2 g 4-aminobenzoic acid, 25.0 g inositol), 60 mg uracil.

[0030] Example 1. Preparation of target gene

[0031] 1. Acquisition of genes related to acetyl-CoA modification

[0032] Primers were designed at the mutation point of ACC1 point mutation, yeast genomic DNA was extracted as a template, and the primers required for gene amplification in Table 1 were used for amplification to obtain fragments of the expected size. For the acquisition of CAT2, TGL4, FAA1, MFE1, POT1, ACL1, ACL2, EXP1 promoters, and pex20 and CYC1 terminators, yeast genomic DNA was extracted as a template, and the primers required for gene amplification in Table 1 were used for amplification to obtain fragments of the expected size.

[0033] The amplification system was configured using PrimSTARHS DNA polymerase (TAKARA), and the amplification system was: 10 μL 5×PS Buffer, 4 μL Dntp Mix, 1 μL each primer, 1 μL genomic DNA template, 0.5 μL HS polymerase (2.5 U / μL), and distilled water was added to a total volume of 50 μL. The amplification conditions were: 98°C pre-denaturation for 3 minutes (1 cycle); 98°C denaturation for 10 seconds, 55°C annealing for 5 seconds, 72°C extension for 2.5 minutes (30 cycles); 72°C extension for 10 minutes (1 cycle).

[0034] Table 1 shows the primer sequences

[0035]

[0036] 2. Construction of ACC1 mutant fragments

[0037] The inventors have found that in yeast, ACC1 activity is regulated by protein kinase SNF1, which recognizes specific phosphorylation sites and phosphorylates serine residues. By comparing ACC1 of Saccharomyces cerevisiae and Yarrowia lipolytica, it is found that the relevant phosphorylation sites are evolutionarily conservative, and finally it is determined that serine 667 and serine 1178 are phosphorylation modification sites of Yarrowia lipolytica ACC1. Therefore, the present invention mutates these two serines into glutamic acid and aspartic acid respectively, so as to achieve the effect of simulating phosphorylation, and it is expected to achieve the downregulation of ACC1 activity.

[0038] To build ACC1 S667D Using Overlap PCR technology, the fragment ACC1 obtained above was S667D -up and ACC1 S667D -dw was used for ligation amplification, and the amplification system was configured with PrimSTARHS DNA polymerase (TAKARA). The amplification system was: 5×PS Buffer 10μL, Dntp Mix 4μL, primer ACC1 S667 -up and ACC1 S667-dw 1 μL each, genomic DNA template 1 μL (ACC1 S667D -up and ACC1 S667D -dw fragments were added at a molar ratio of 1:1), HS polymerase (2.5U / μL) 0.5μL, and distilled water was added to a total volume of 50μL. Amplification conditions were: 98℃ pre-denaturation for 3 minutes (1 cycle); 98℃ denaturation for 10 seconds, 55℃ annealing for 5 seconds, 72℃ extension for 3 minutes (30 cycles); 72℃ extension for 10 minutes (1 cycle). The product was recovered and stored by tapping to obtain ACC1 S667D Mutant repair fragments. The construction methods of other ACC1 mutant fragments are similar to ACC1 S667D The same, ACC1 was constructed S667E Fragment, ACC1 S1178D Fragment and ACC1 S1178E Fragment.

[0039] 6. Construction of expression elements

[0040] To construct the expression element P EXP1 -CAT2-T pex20 The fragment P obtained above was cloned using Overlap PCR technology. EXP1 , CAT2 and T pex20 For ligation amplification, the amplification system was configured using PrimSTARHS DNA polymerase (TAKARA). The amplification system was: 10 μL 5×PS Buffer, 4 μL Dntp Mix, and primer P EXP1 -f and T pex20 -r 1 μL each, genomic DNA template 1 μL (P EXP1 , CAT2 and T pex20 Each fragment was added in a molar ratio of 1:3:1), HS polymerase (2.5U / μL) 0.5μL, and distilled water was added to a total volume of 50μL. The amplification conditions were: 98℃ pre-denaturation for 3 minutes (1 cycle); 98℃ denaturation for 10 seconds, 55℃ annealing for 5 seconds, 72℃ extension for 3 minutes (30 cycles); 72℃ extension for 10 minutes (1 cycle). The product was recovered and stored by tapping. P EXP1 -CAT2-T pex20 Expression element. EXP1 -CAT2-T pex20 The expression element contains a CAT2 expression cassette, which expresses the CAT2 gene, and the expression product is CAT2 protein. The construction method of other expression elements is the same as that of P EXP1 -CAT2-T pex20 The same, respectively obtained P EXP1 -TGL4-T pex20 Expression element, PEXP1 -FAA1-T pex20 Expression element, P EXP1 -MFE1-T pex20 Expression element, P EXP1 -POT1-T pex20 Expression elements and P EXP1 -ACL1-T CYC1 -ACL1-P EXP1 Expression elements.

[0041] Example 2: Construction of recombinant bacteria

[0042] 1. Preparation of competent yeast

[0043] The starting strain Yarrowia lipolytica GA-1 with the ability to produce germaene A was streaked on YPD solid medium at 30°C overnight, and then a single colony was selected from the plate and streaked again on fresh YPD solid medium, and cultured at 30°C overnight. The colonies in the YPD solid plate were eluted with sterile water and centrifuged at 2500rpm for 5 minutes using a sterile centrifuge tube to collect the cells. The culture medium was discarded, and the cells were suspended in sterile water and centrifuged again as above. The water was discarded to obtain competent cells. After that, the recombinant plasmid expressing gRNA (plasmid 1-3) was transformed into the strain together with the expression element or homologous recombination fragment. The recombinant plasmid expressing gRNA recognized and bound to the specific PAM region of the corresponding site, and at the same time activated and guided the Cas9 protein to perform the shearing function, so that the double-stranded DNA at the corresponding site was broken. At this time, the expression element or homologous recombination fragment containing the homologous region was integrated into the strain DNA through homologous recombination repair.

[0044] 2. Construction of recombinant plasmid containing gRNA

[0045] Construction of plasmid pgRNAYL-1: Using pET32a vector as template, corresponding primers were used to amplify fragment 1 containing fragment AmpR expression cassette and ori fragment, and using Yarrowia lipolytica genome as template, corresponding primers were used to amplify fragment P POT 、CEN1、P EXP1 , P tRNA and T rpr1 , the nourseothricin resistance gene and tracrRNA gene were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. Then, by overlap PCR, the nourseothricin resistance gene expression frame was obtained as fragment 2 and the gRNA expression frame was obtained as fragment 3 using the corresponding primers. Then, using the CloneExpress II kit (Novozyme), fragments 1, 2, and 3 were recombined in vitro, transformed into DH5α competent cells for amplification, and plasmids were extracted to obtain plasmid pYLgRNA-1.

[0046] Plasmids pgRNAYL-2 and pgRNAYL-3: The construction method is the same as above, and the corresponding targets are shown in Table 2.

[0047] Table 3 Target sequences

[0048] Plasmid name Target sequence gRNA1 ACAAGCATACAGCCCTCGGG gRNA2 GGAGTTAGACCTCTTTCTGA gRNA3 GGTGTACGAAAAGTCGGAGA

[0049] 3. Construction of ACC1 point mutation strain

[0050] The construction of strain YLAC-1 is used as an example. After the starting strain Yarrowia lipolytica GA-1 was cultured overnight on YPD solid medium, competent cells were prepared and the following order was added: 80 μL PEG (50% w / v), 5 μL 1.0 mol / L lithium acetate, 5 μL 2 mol / L DTT, 10 μL salmon sperm DNA (sigma) DNA (2 mg / mL), 10 μL water and gene (ACC1 S667D , plasmid gRNA2); shake vigorously until the cells are completely mixed, and keep warm at 39°C for 1 hour; centrifuge at 6000-8000rpm for 15s, remove the transformation mixture; aspirate 500 μL YPD liquid medium to resuspend the cells, and incubate at 30°C, 250 rpm for 2 hours; centrifuge at 6000-8000rpm for 15s, remove the medium; add 100 μL sterile water to the reaction tube, gently suspend the precipitate and apply it to the YPD plate with nourseothricin, wait for the colonies to grow, select the colonies to the YPD plate, and the colonies grown on the plate are named YLAC-1 and saved. The construction method of other ACC1 mutant strains is the same as that of YLAC-1, and YLAC-2, YLAC-3 and YLAC-4 were obtained respectively.

[0051] 4. Construction of strains to improve the expression level of key genes

[0052] Take the strain YLAC-5, which has improved the expression level of CAT2, as an example. The competent cells were prepared by culturing the starting strain Yarrowia lipolytica GA-1 overnight on YPD solid medium. The following sequence was added: 80 μL PEG (50% w / v), 5 μL 1.0 mol / L lithium acetate, 5 μL 2 mol / L DTT, 10 μL salmon sperm DNA (sigma) DNA (2 mg / mL), 10 μL water and gene (P EXP1 -CAT2 -T pex20Expression element, plasmid gRNA1); shake vigorously until the cells are completely mixed, and keep warm at 39℃ for 1 hour; centrifuge at 6000-8000rpm for 15s, remove the transformation mixture; aspirate 500 μL YPD liquid medium to resuspend the cells, and incubate at 30℃, 250 rpm for 2 hours; centrifuge at 6000-8000rpm for 15s, remove the medium; add 100 μL sterile water to the reaction tube, gently suspend the precipitate and apply it to the YPD plate with nourseothricin, wait for the colonies to grow, select the colonies to the YPD plate, and the colonies grown on the plate are named YLAC-5 and saved. The construction method of other strains to improve the expression level of key genes is the same as that of strain YLAC-5, and strains YLAC-6, YLAC-7, YLAC-8, YLAC-9, YLAC-10, and YLAC-11 were constructed.

[0053] 5. Cultivation of engineered strains and product acquisition

[0054] The yeast engineered strains YLAC-1 to YLAC-11 prepared in this example and the starting strain GA-1 were activated in Delft liquid medium, respectively. Seed solution was prepared in Delft liquid medium (30° C., 250 rpm, 16 h), and inoculated at 1% in a 100 mL conical flask containing 20 mL Delft liquid medium and 2 ml of n-dodecane or isopropyl myristate as an extractant. The mixture was cultured at 30° C. and 250 rpm for 2-5 days. Finally, the liquid in the conical flask was transferred to a 50 mL centrifuge tube and centrifuged at 5000 rpm for 5 min. The organic phase was collected for later use.

[0055] The collected organic phase was diluted 50 times with n-hexane and detected by GC-MS. GC-MS determination conditions: injection port temperature 260℃, injection volume 1μL, no splitting, solvent delay 3min; chromatographic column: HP-5ms (30m*0.25mM); chromatographic conditions: 60℃, 3min, 40℃ / min to 150℃, 20℃ / min to 220℃, 40℃ / min to 260℃ for 2min; MS conditions: FullScan: 50-750 amu. A mixed standard of sesquiterpenoid substances was used for qualitative and quantitative analysis. The results are shown in Table 3 and Figure 1 As shown, the results show that the ACC1 mutant engineering strains YLAC-3 and YLAC-4 obtained in this example; the key enzyme overexpression strains YLAC-5, YLAC-6 and YLAC-7 have significantly increased the production of acetyl-CoA derivatives. S1178D ,ACC1 S1178EAnd the key enzymes CAT2, TGL4 and FAA1 play a significant role in increasing the supply of cytosolic acetyl-CoA. This result shows that this embodiment provides a way to effectively oversupply acetyl-CoA and achieves excellent results in producing sesquiterpene compounds with acetyl-CoA as the starting substrate.

[0056] Table 3 Oversupply of acetyl-CoA by engineered strains to increase sesquiterpenoid production

[0057] Strain name Sesquiterpene yield (mg / L) GA-1 2108.3±21.1 YLAC-1 2131.9±41.3 YLAC-2 2031.9±106.2 YLAC-3 2415.2±90.7 YLAC-4 2419.6±61.0 YLAC-5 2309.5±99.6 YLAC-6 2379.1±36.7 YLAC-7 2329.3±45.1 YLAC-8 2197.9±10.5 YLAC-9 2083.9±58.3 YLAC-10 2148.6±55.3 YLAC-11 2096.4±49.6

[0058] Example 3: Engineering strains superimposed with ACC1 mutants and increasing the expression of key genes

[0059] 1. Construction of engineered strains

[0060] In this example, strains YLAC-3 and YLAC-4 with beneficial mutations in ACC1 in Example 2 were used as starting strains, and the expression levels of genes CAT2, TGL4 and FAA1 were increased on this basis. Take the construction of strain YLAC-12 as an example for illustration. Competent cells were prepared by culturing the starting strain Yarrowia lipolytica YLAC-03 overnight on YPD solid medium, and the following order was added: 80 μL PEG (50% w / v), 5 μL 1.0 mol / L lithium acetate, 5 μL 2mol / L DTT, 10 μL salmon sperm DNA (sigma) DNA (2 mg / mL), 10 μL water and gene (P EXP1 -CAT2 -T pex20 Expression element, plasmid 1); shake vigorously until the cells are completely mixed, and keep warm at 39℃ for 1 hour; centrifuge at 6000-8000rpm for 15s, remove the transformation mixture; aspirate 500 μL YPD liquid medium to resuspend the cells, and incubate at 30℃, 250 rpm for 2 hours; centrifuge at 6000-8000rpm for 15s, remove the medium; add 100 μL of sterile water to the reaction tube, gently suspend the precipitate and apply it to the YPD plate with nourseothricin, wait for the colonies to grow, select the colonies to the YPD plate, and the colonies grown on the plate are named YLAC-12 and saved. The construction method of other engineering strains is the same as that of YLAC-12, and YLAC-13, YLAC-14, YLAC-15, YLAC-16 and YLAC-17 were constructed.

[0061] 2. Engineering bacteria culture and product extraction

[0062] The yeast engineering strains YLAC-11 to YLAC-17 prepared in Example 2 and the starting strains YLAC-3 and YLAC-4 were activated in Delft liquid medium, respectively, and seed solution was prepared in Delft liquid medium (30° C., 250 rpm, 16 h), and inoculated into a 100 mL conical flask containing 20 mL Delft liquid medium and 2 ml n-dodecane at an inoculum of 1%, and cultured at 30° C., 250 rpm for 2-5 days. Finally, the liquid in the conical flask was transferred to a 50 ml centrifuge tube, centrifuged at 5000 rpm for 5 min, and the organic phase was collected for later use. The collected organic phase material was diluted 50 times with n-hexane and detected by GC-MS. GC-MS determination conditions: injection port temperature 260℃, injection volume 1μL, no splitting, solvent delay 3min; chromatographic column: HP-5ms (30m*0.25mM); chromatographic conditions: 60℃, 3min, 40℃ / min to 150℃, 20℃ / min to 220℃, 40℃ / min to 260℃ for 2min; MS conditions: FullScan: 50-750 amu. Mixed standards of sesquiterpenoid substances were used for qualitative and quantitative analysis. The results are shown in Table 4 and Figure 2 As shown, taking YLAC-4 as the starting strain, increasing the FAA expression level to obtain strain YLAC-16 further increased the yield of sesquiterpene germarene A, indicating that the acetyl-CoA oversupply method proposed in the present invention has a superposition effect.

[0063] Table 4. Multiple strategies for supplying acetyl-CoA engineering strains with sesquiterpene yields

[0064] Strain name Sesquiterpene yield (mg / L) YLAC-3 2474.2±58.0 YLAC-4 2486.2±127.9 YLAC-12 2610.9±108.1 YLAC-13 2382.6±286.2 YLAC-14 2505.2±87.6 YLAC-15 2490.9±116.9 YLAC-16 2793.5±67.7 YLAC-17 2505.9±189.1

[0065] 3. Production of sesquiterpenes by Yarrowia lipolytica fermentation

[0066] The engineered strain YLAC-16 was used for 5L scale fermentation in a fermenter. By optimizing the fermentation conditions, Delft medium was used, 10% IPM was added to the medium, the culture conditions were 30°C, pH 5.0, dissolved oxygen 40%, the rotation speed was 300 rpm-700 rpm, the glucose concentration was maintained at 10 g / L, and the final content of germarene A in the fermentation broth was 25 g / L. This result shows that the method of oversupplying acetyl-CoA, the constructed yeast strain and the optimized fermentation process proposed in the present invention have a significant promoting effect on the production level of sesquiterpenes in Yarrowia lipolytica.

[0067] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A method for constructing a recombinant genetically engineered bacterium that oversupplies cytosolic acetyl-CoA, characterized in that: The endogenous acetyl-CoA carboxylase ACC1 of the starting yeast Yarrowia lipolytica is mutated to construct a mutant recombinant genetic engineering bacterium containing the corresponding ACC1 mutant; The amino acid sequence of the endogenous acetyl-CoA carboxylase ACC1 is shown in Genbank accession number AOW02694.1; The acetyl-CoA carboxylase ACC1 mutant is obtained by mutating the 1178th serine in the amino acid sequence of endogenous acetyl-CoA carboxylase ACC1 to aspartic acid or glutamic acid.

2. The construction method according to claim 1, characterized in that: The starting yeast is further modified by at least one of the following: the carnitine acetyltransferase CAT2 gene, the triacylglycerol lipase TGL4 gene, the fatty acid coenzyme A synthetase FAA1 gene, the multifunctional β-oxidase MFE1 gene, the 3-ketoacyl coenzyme A thiol enzyme POT1 gene, the peroxisome matrix protein PEX10 gene, the citrate lyase ACL1 gene and the citrate lyase ACL2 gene in the starting yeast are enhanced by expression to increase the content and / or activity of the expressed proteins.

3. The construction method according to claim 2, characterized in that: This is achieved by increasing the copy number or transcription level of the corresponding enzyme gene in the starting yeast.

4. The construction method according to claim 2, characterized in that: Said CAT2 The sequence of the CAT2 protein encoded by the gene is Genbank accession number AOW01502.1; and / or, TGL4 The sequence of the TGL4 protein encoded by the gene is Genbank accession number AOW06932.1; and / or, FAA1 The sequence of the FAA1 protein encoded by the gene is Genbank accession number AOW04223.1; and / or, MFE1 The sequence of the MFE1 protein encoded by the gene is Genbank accession number AOW05454.1; and / or, POT1 The sequence of the POT1 protein encoded by the gene is Genbank accession number AOW05614.1; and / or, PEX10 The sequence of the PEX10 protein encoded by the gene is Genbank accession number AOW02173.1; and / or, ACL1 The sequence of the ACL1 protein encoded by the gene is Genbank accession number AOW06401.1; and / or, ACL2 The sequence of the ACL2 protein encoded by the gene is Genbank accession number AOW04580.

1.

5. The construction method according to claim 4, characterized in that: This is achieved by introducing a corresponding gene expression cassette into the starting bacteria; the gene expression cassette includes a promoter, the gene open reading frame and a terminator.

6. The construction method according to claim 5, characterized in that: The promoter is P EXP1 ; The terminator is T PEX20 .

7. The construction method according to claim 1, characterized in that: The starting yeast ACC1 Gene mutation was achieved by site-directed mutagenesis.

8. The construction method according to any one of claims 1 to 7, characterized in that: The genes involved in genetic engineering modification are all derived from Yarrowia lipolytica.

9. The recombinant genetically engineered bacteria obtained by the construction method according to any one of claims 1 to 8.

10. An application related to the production of sesquiterpene products, which is selected from one of the following applications: application of the construction method described in any one of claims 1 to 8 or the recombinant genetically engineered bacteria obtained therefrom in the preparation of products producing sesquiterpene; application of the construction method described in any one of claims 1 to 8 or the recombinant genetically engineered bacteria obtained therefrom in the production of sesquiterpene.

Images