A culture medium and culture method for expanding mouse adult lung stem cells

Abstract

The present invention discloses a culture medium and a culture method for amplifying mouse adult lung stem cells. The invention relates to the technical field of primary lung stem cell culture. The culture medium of the present invention can continuously and stably culture mouse adult lung stem cells for more than 30 generations. Compared with the existing culture systems in the world, a more stable long-term in vitro amplification system of lung stem cells is established; lung stem cells can maintain a high proliferation rate and multiple differentiation potentials after continuous passage.

Description

Technical Field

[0001] The present invention relates to the technical field of primary lung stem cell culture, and more particularly to a culture medium and a culture method for amplifying mouse adult lung stem cells. Background Art

[0002] As the main part of the respiratory system, the lung is the most important organ for gas exchange and immune defense in animals. It is extremely vulnerable to infection or damage caused by pathogens or foreign bodies in the external environment. Any disorder or abnormality in its function may cause serious respiratory diseases or even death in animals. Studies have found that after animals become adults, stem cells still reside in lung tissue. When there is tissue damage and stress, they can be activated, proliferate, and differentiate into mature lung cells, participating in a certain degree of tissue damage repair. However, in cases of idiopathic pulmonary fibrosis and severe pulmonary fibrosis caused by COVID-19 infection, lung stem cells are severely damaged and lost, and the lung tissue undergoes irreversible damage with almost no cell renewal, resulting in an extremely high mortality rate in advanced cases (1. Hogan Brigidl M, Barkauskas Christina e, Chapman Harold a, et al. 2014. Repair and Regeneration of the Respiratory System: Complexity, Plasticity, and Mechanisms of Lung Stem Cell Function. Cell stem cell, 15(2): 123-138. 2. Hou YJ, Okuda K, Edwards CE, et al. 2020. SARS-CoV-2 Reverse Genetics Reveals a Variable Infection Gradient in the Respiratory Tract. Cell, 182(2): 429-446. e414.). Given that lung stem cells can autonomously differentiate into mature lung cells in vivo, and stem cell therapy has been widely studied in animal models of different lung injuries and has shown good therapeutic effects, adult lung stem cell therapy is expected to become one of the most effective methods to improve respiratory diseases such as idiopathic pulmonary fibrosis and pulmonary fibrosis caused by COVID-19 infection. At the same time, lung stem cells can replace animals as an important carrier for screening targeted drugs for respiratory diseases and evaluating their efficacy.

[0003] According to current literature reports, basal cells in the airway region of mice can be effectively expanded for 15 generations under 2D culture conditions, while the in vitro culture of alveolar precursor cells in the distal lung region must rely on the 3D Matrigel gel system and cannot be cultured in 2D in vitro. Matrigel contains a variety of proteins and growth factors, the specific composition is unclear, the batch product difference is relatively large, and the price is expensive. Considering the maintenance of lung stem cell characteristics and the stability of the culture system, this system is not suitable for large-scale in vitro expansion and culture.

[0004] Therefore, establishing a 2D culture system for efficient and long-term stable expansion of lung stem cells is an urgent problem to be solved in stem cell therapy for respiratory diseases and evaluation of drug efficacy.

[0005] At the same time, it is of great significance to promote stem cell therapy for respiratory diseases, clinical drug screening, the construction of vascularized lung organoids and the research on the pathogenic mechanisms of respiratory diseases. Summary of the invention

[0006] In view of this, the present invention provides a culture medium and a culture method for expanding mouse adult lung stem cells. The culture medium system can continuously and stably culture mouse adult lung stem cells for more than 30 generations. The adult lung stem cells cultured to the 30th generation still maintain good cell morphology and a high proliferation rate, while maintaining strong stem cell characteristics and differentiation potential. After differentiation induction, they can differentiate into mature alveolar I cells and alveolar II cells, airway rod cells and other mature lung cells. It is of great significance to promote the study of stem cell therapy for respiratory diseases, clinical drug screening, the construction of vascularized lung organoids and the pathogenic mechanism of respiratory diseases.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] A culture medium for expanding mouse adult lung stem cells, comprising the following components: epidermal growth factor 5-20 ng / mL, fibroblast growth factor 5-20 ng / mL, human insulin growth factor 50-100 μg / mL, glutamine 2-3 mM, glutathione 50-80 μg / mL, Y-276325-10 μM, CHIR990211-2 μM, ascorbic acid 1-2 mM, superoxide dismutase 375-500 U / mL, L-proline 100-150 μg / mL, L-ornithine 100-200 μg / mL, biotin D125-200 μg / mL, pipemidic acid 100-150 μg / mL, α-tocopherol 100-200μg / mL, DL-α-tocopherol acetate 100-200μg / mL, retinol acetate 20-45μg / mL, oleic acid 50-75μg / mL, linoleic acid 0.5-2mg / mL, linolenic acid 0.5-2mg / mL, human transferrin 250-500μg / mL, corticosterone 2-4μg / mL, progesterone 0.63-1.4μg / mL, putrescine hydrochloride 900-2000μg / mL, fetal bovine albumin 250mg / mL, ethanolamine 0.05-0.15μL / mL and triiodothyronine 100-180ng / mL.

[0009] As a preferred technical solution of the present invention, the culture medium for expanding mouse adult lung stem cells includes the following components:

[0010] Epidermal growth factor 5ng / mL, fibroblast growth factor 5ng / mL, human insulin growth factor 50μg / mL, glutamine 2mM, glutathione 50μg / mL, Y-276325μM, CHIR990211μM, ascorbic acid 1mM, superoxide dismutase 375U / mL, L-proline 100μg / mL, L-ornithine 100μg / mL, biotin 125μg / mL, pipemidic acid 100μg / mL, α-tocopherol 1 00μg / mL, DL-α-tocopheryl acetate 100μg / mL, retinol acetate 20μg / mL, oleic acid 50μg / mL, linoleic acid 0.5mg / mL, linolenic acid 0.5mg / mL, human transferrin 250μg / mL, corticosterone 2μg / mL, progesterone 0.63μg / mL, putrescine hydrochloride 900μg / mL, fetal bovine albumin 250mg / mL, ethanolamine 0.05μL / mL and triiodothyronine 100ng / mL.

[0011] More preferably, the culture medium for expanding mouse adult lung stem cells uses DMEM / F12 as a solvent.

[0012] Another object of the present invention is to provide a method for preparing the above-mentioned culture medium for expanding mouse adult lung stem cells, comprising the following steps:

[0013] (1) epidermal growth factor, fibroblast growth factor, glutamine, glutathione, ascorbic acid, superoxide dismutase, L-proline, L-ornithine, biotin, pipemidic acid, human transferrin, putrescine hydrochloride and fetal bovine albumin were dissolved in DMEM / F12 to prepare a mother solution;

[0014] Y-27632, CHIR99021, α-tocopherol, DL-α-tocopherol acetate, retinol acetate, oleic acid, linoleic acid, linolenic acid, corticosterone, progesterone and triiodothyronine were dissolved in DMSO to prepare a stock solution;

[0015] Human insulin growth factor was dissolved in 0.005 M HCl to prepare a stock solution;

[0016] (2) Add each mother solution in step (1) to DMEM / F12 according to the final concentration of the culture medium, and finally add ethanolamine to make the final concentration 0.05-0.15 μL / mL.

[0017] As a preferred technical solution of the present invention, the method for preparing the culture medium comprises the following steps:

[0018] (1) EGF was dissolved in DMEM / F12 to prepare a stock solution of 5ug / ml.

[0019] Fibroblast growth factor was dissolved in DMEM / F12 to prepare a stock solution of 5ug / ml.

[0020] Human insulin growth factor was placed in 0.005 M HCl overnight to dissolve and prepared into a 25 mg / ml stock solution.

[0021] Glutamine was dissolved in DMEM / F12 to prepare a 200 mM stock solution.

[0022] Glutathione was dissolved in DMEM / F12 to prepare a 10 mg / ml stock solution.

[0023] Y-27632 was dissolved in DMSO to prepare a 10 mM stock solution.

[0024] CHIR99021 was dissolved in DMSO to prepare a 2 mM stock solution.

[0025] Ascorbic acid was dissolved in DMEM / F12 to prepare a 2M stock solution.

[0026] Superoxide dismutase was dissolved in DMEM / F12 to prepare a stock solution of 50 kU / mL.

[0027] L-proline was dissolved in DMEM / F12 to prepare a 10 mg / mL stock solution.

[0028] L-Ornithine was dissolved in DMEM / F12 to prepare a 10 mg / mL stock solution.

[0029] Biotin D was dissolved in DMEM / F12 to prepare a 20 mg / mL stock solution.

[0030] Pipemidic acid was dissolved in DMEM / F12 to prepare a 50 mg / ml stock solution.

[0031] α-Tocopherol was dissolved in DMSO to prepare a 100 mg / ml stock solution.

[0032] DL-α-tocopherol acetate was dissolved in DMSO to prepare a 100 mg / ml stock solution.

[0033] Retinol acetate was dissolved in DMSO to prepare a 20 mg / ml stock solution.

[0034] Oleic acid was dissolved in DMSO to prepare a 10 mg / ml stock solution.

[0035] Linoleic acid was dissolved in DMSO to prepare a 100 mg / ml stock solution.

[0036] Linolenic acid was dissolved in DMSO to prepare a 100 mg / ml stock solution.

[0037] Human transferrin was dissolved in DMEM / F12 to prepare a 25 mg / ml stock solution.

[0038] Corticosterone was dissolved in DMSO to prepare a stock solution of 1 mg / ml.

[0039] Progesterone was dissolved in DMSO to prepare a 2 mg / ml stock solution.

[0040] Putrescine hydrochloride was dissolved in DMEM / F12 to prepare a stock solution of 100 mg / ml.

[0041] Fetal bovine albumin was dissolved in DMEM / F12 to prepare a 2.5 g / mL stock solution.

[0042] Triiodothyronine was dissolved in DMSO to prepare a 2 mg / ml stock solution.

[0043] (2) Add the above components to the final concentration of the medium used by adding the mother solution of step (1) to DMEM / F12, and finally add ethanolamine to a final concentration of 0.05-0.15 μL / mL.

[0044] Another object of the present invention is to provide a method for culturing mouse adult lung stem cells, comprising the following steps: (1) culturing primary lung cells in a collagen-coated culture dish using a DMEM / F12 culture medium containing 10% FBS to allow other types of cells other than lung stem cells to adhere to the wall;

[0045] (2) Collecting lung stem cells that are not attached to the wall and culturing them with the above-mentioned culture medium until the stem cell clones grow up to obtain mouse adult lung stem cells.

[0046] As a preferred technical solution of the present invention, during the culture process in step (2), half of the liquid is replaced every other day.

[0047] Another object of the present invention is to provide mouse adult lung stem cells, which are cells obtained by culturing using the above culture medium or the above culture method.

[0048] Another object of the present invention is to provide use of the above culture medium in preparing cells.

[0049] Another object of the present invention is to provide use of the above culture medium in preparing expanded lung stem cell products.

[0050] The purpose of the present invention is to provide the application of the above-mentioned mouse adult lung stem cells for non-diagnostic and therapeutic purposes, and the application is any one of the following:

[0051] A: In vitro study of the regulatory mechanisms of adult lung stem cell proliferation, differentiation, and death;

[0052] B: Evaluation of the efficacy of lung stem cell therapy;

[0053] C: Construction of functional lung organoids;

[0054] D: Respiratory disease drug development, screening, and pharmacological efficacy evaluation.

[0055] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses a culture medium and a culture method for amplifying mouse adult lung stem cells. The culture medium of the present invention can continuously and stably culture mouse adult lung stem cells for more than 30 generations, and compared with the existing culture systems in the world, a more stable long-term in vitro amplification system of lung stem cells has been established; lung stem cells can maintain a high proliferation rate and multiple differentiation potential after continuous passage. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0057] Figure 1 This is a clone morphology diagram of mouse adult lung stem cells after 6 days of primary culture provided by the embodiment of the present invention, wherein Figure 1 Left: cells obtained from the culture medium of Example 1; Figure 1 The right side shows cells obtained from the culture medium of Example 2;

[0058] Figure 2 A graph showing the in vitro expansion and proliferation rate of mouse adult lung stem cells provided in an embodiment of the present invention;

[0059] Figure 3 The lung stem cell morphology (4X) of mouse adult lung stem cells expanded 25 times in the embodiment of the present invention;

[0060] Figure 4 The morphology of lung stem cells (20X) of mouse adult lung stem cells amplified 25 times in the embodiment of the present invention;

[0061] Figure 5 The properties of various types of cells after continuous expansion of adult lung stem cells for 30 generations in the embodiment of the present invention are shown in FIG. Figure 5 a is the nature of basal cells; Figure 5 b is the properties of epithelial progenitors; Figure 5 c is the properties of alveolar precursor cells AT2progenitors; Figure 5 d is the properties of the variant clubcells;

[0062] Figure 6 After the adult lung stem cells of the present invention were continuously amplified for 30 generations, qPCR was used to identify the marker genes of the highly expressed embryonic and adult lung progenitor cells; wherein Figure 6 The left side shows the identification result of adult lung stem cells expressing embryonic lung precursor cell genes in the example. Figure 6 The right side shows the identification result of adult lung stem cells expressing adult lung progenitor cell genes in the example.

[0063] Figure 7 The immunofluorescence staining results of lung stem cell differentiation identification after 30 generations of culture in the embodiment of the present invention are shown; Figure 7 a is club cells, Figure 7 b is ciliated cells, Figure 7 c: Type 1 alveolar cells AT1 (labeled with green fluorescence) and type 2 alveolar cells AT2 (labeled with red fluorescence). DETAILED DESCRIPTION

[0064] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0065] Example 1

[0066] Preparation of culture medium

[0067] Using DMEM / F12 as solvent, a culture medium containing the following final concentrations was prepared, including epidermal growth factor 5 ng / mL, fibroblast growth factor 5 ng / mL, human insulin growth factor 50 μg / mL, glutamine 2 mM, glutathione 50 μg / mL, Y-2763 25 μM, CHIR9902 11 μM, ascorbic acid 1 mM, superoxide dismutase 375 U / mL, L-proline 100 μg / mL, L-ornithine 100 μg / mL, biotin 125 μg / mL, pyrimethamine 10 μg / mL, 1 μg / mL dapoxetine ... Acid 100μg / mL, α-tocopherol 100μg / mL, DL-α-tocopheryl acetate 100μg / mL, retinol acetate 20μg / mL, oleic acid 50μg / mL, linoleic acid 0.5mg / mL, linolenic acid 0.5mg / mL, human transferrin 250μg / mL, corticosterone 2μg / mL, progesterone 0.63μg / mL, putrescine hydrochloride 900μg / mL, fetal bovine albumin 250mg / mL, ethanolamine 0.05μL / mL and triiodothyronine 100ng / mL

[0068] Preparation method:

[0069] (1) EGF was dissolved in DMEM / F12 to prepare a stock solution of 5ug / ml.

[0070] Fibroblast growth factor was dissolved in DMEM / F12 to prepare a stock solution of 5ug / ml.

[0071] Human insulin growth factor was placed in 0.005 M HCl overnight to dissolve and prepared into a 25 mg / ml stock solution.

[0072] Glutamine was dissolved in DMEM / F12 to prepare a 200 mM stock solution.

[0073] Glutathione was dissolved in DMEM / F12 to prepare a 10 mg / ml stock solution.

[0074] Y-27632 was dissolved in DMSO to prepare a 10 mM stock solution.

[0075] CHIR99021 was dissolved in DMSO to prepare a 2 mM stock solution.

[0076] Ascorbic acid was dissolved in DMEM / F12 to prepare a 2M stock solution.

[0077] Superoxide dismutase was dissolved in DMEM / F12 to prepare a stock solution of 50 kU / mL.

[0078] L-proline was dissolved in DMEM / F12 to prepare a 10 mg / mL stock solution.

[0079] L-Ornithine was dissolved in DMEM / F12 to prepare a 10 mg / mL stock solution.

[0080] Biotin was dissolved in DMEM / F12 to prepare a 20 mg / mL stock solution.

[0081] Pipemidic acid was dissolved in DMEM / F12 to prepare a 50 mg / ml stock solution.

[0082] α-Tocopherol was dissolved in DMSO to prepare a 100 mg / ml stock solution.

[0083] DL-α-tocopherol acetate was dissolved in DMSO to prepare a 100 mg / ml stock solution.

[0084] Retinol acetate was dissolved in DMSO to prepare a 20 mg / ml stock solution.

[0085] Oleic acid was dissolved in DMSO to prepare a 10 mg / ml stock solution.

[0086] Linoleic acid was dissolved in DMSO to prepare a 100 mg / ml stock solution.

[0087] Linolenic acid was dissolved in DMSO to prepare a 100 mg / ml stock solution.

[0088] Human transferrin was dissolved in DMEM / F12 to prepare a 25 mg / ml stock solution.

[0089] Corticosterone was dissolved in DMSO to prepare a stock solution of 1 mg / ml.

[0090] Progesterone was dissolved in DMSO to prepare a 2 mg / ml stock solution.

[0091] Putrescine hydrochloride was dissolved in DMEM / F12 to prepare a stock solution of 100 mg / ml.

[0092] Fetal bovine albumin was dissolved in DMEM / F12 to prepare a 2.5 g / mL stock solution.

[0093] Triiodothyronine was dissolved in DMSO to prepare a 2 mg / ml stock solution.

[0094] (2) Add the above components to the final concentration of the medium used by adding each stock solution of step (1) to DMEM / F12, and finally add ethanolamine to a final concentration of 0.05 μL / mL.

[0095] Example 2

[0096] Preparation of culture medium

[0097] Using DMEM / F12 as solvent, a culture medium containing the following final concentrations was prepared, including epidermal growth factor 20 ng / mL, fibroblast growth factor 20 ng / mL, human insulin growth factor 100 μg / mL, glutamine 3 mM, glutathione 80 μg / mL, Y-27632 10 μM, CHIR9902 12 μM, ascorbic acid 2 mM, superoxide dismutase 500 U / mL, L-proline 150 μg / mL, L-ornithine 200 μg / mL, and biotin 200 μg / mL , pipemidic acid 150μg / mL, α-tocopherol 200μg / mL, DL-α-tocopheryl acetate 200μg / mL, retinol acetate 45μg / mL, oleic acid 75μg / mL, linoleic acid 2mg / mL, linolenic acid 2mg / mL, human transferrin 500μg / mL, corticosterone 4μg / mL, progesterone 1.4μg / mL, putrescine hydrochloride 2000μg / mL, fetal bovine albumin 350mg / mL, ethanolamine 0.15μL / mL and triiodothyronine 180ng / mL.

[0098] Preparation method: Prepare the mother solutions of each component according to the preparation method of Example 1, then add the mother solutions of step (1) to DMEM / F12 according to the final concentration used in this example, and finally add ethanolamine to make the final concentration 0.15 μL / mL.

[0099] Example 3

[0100] In vitro culture of mouse adult lung stem cells

[0101] Collagen coating solution with a concentration of 7 μg / mL was prepared with 0.02M glacial acetic acid and coated on a 6 cm cell culture dish. Adult lung stem cells were isolated and extracted from the lung tissue of adult C57BL mice by digestion with 100U / ml collagenase. The extracted lung cells were inoculated on collagen-coated culture dishes and cultured overnight in a cell culture incubator with DMEM / F12 culture medium containing 10% fetal bovine serum (FBS) to allow cells other than lung stem cells to adhere to the wall.

[0102] After 16 hours, the cells that did not adhere to the wall were collected and cultured with the culture medium prepared in Example 1 and Example 2, respectively. Half of the medium was replaced every other day, and the cell morphology was observed every day. After 6 days of culture, the stem cell clones in the culture dish were nearly round, with smooth edges and dense cells inside (see Appendix Figure 1 ).

[0103] When the cell clones were larger than 1 mm in diameter, the stem cell clones were digested with collagenase and subcultured to 6-well plates at a ratio of 1:4. The number of cells seeded per well was about 1X10 5When the cell confluence in the 6-well cell culture plate reaches about 80%, continue to subculture to the 6-well cell culture plate at a ratio of 1:10 (the number of cells in each well is 2X10 5 / well). When the medium of the present invention is used to culture lung stem cells for more than 30 consecutive passages, the cells still maintain a high proliferation rate and good stem cell morphological characteristics (see Appendix Figure 2-4 ). Figure 2 , which is the cell proliferation curve within 33 generations of cell culture, and the cell expansion multiple is as high as 12 33 . Figure 3 and 4 The cell morphology of lung stem cells after 25 passages under 4X and 20X objective lenses is shown in sequence. At this time, the cells still maintain a good cell state. The data show that the culture medium of the present invention can stably expand mouse lung stem cells for at least 30 passages.

[0104] Example 4

[0105] Maintenance of stem cell properties by in vitro expansion system of lung stem cells

[0106] In order to verify that the adult lung stem cells cultured in the culture medium of the present invention can still maintain the characteristics of pluripotent stem cells after 30 passages, lung stem cells passaged 30 times were selected for verification. When the cells grew to 80%, the culture medium was discarded, the cells were washed with PBS, and then the cells were fixed with 4% paraformaldehyde solution at room temperature for 30 minutes, and the cells were washed with PBS. Antibody protein tracers that can mark basal progenitor cells (Krt5), proximal lung epithelial progenitor cells (SOX2), type II alveolar progenitor cells (Sftpc), Variant Club progenitor cells (CGRP) and other precursor cells with stem cell characteristics were added, and the antibodies and cells were incubated overnight at 4°C, and the cells were washed 3 times with PBS, followed by the addition of the corresponding immunofluorescence secondary antibody, incubated at room temperature for 1 hour, and the cells were washed 3 times with PBS, and then incubated with DAPI stain for 5 minutes. The cells were washed 3 times with PBS and observed under a fluorescence microscope (see Appendix). Figure 5 ). Figure 5 a, Krt5 and P63 antibodies co-label basal cell precursor cells; Figure 5 b, Progenitor cell marker SOX2 and epithelial cell marker EpCAM co-label lung epithelial progenitors; Figure 5 c, Sftpc, a marker of 2-type alveolar cells, and SOX9, a marker of distal lung progenitor cells, co-label AT2 progenitors; Figure 5d, the rod body progenitor marker CGRP and the progenitor cell marker SOX2 co-labeled variant club progenitors. The data show that the mouse lung stem cells expanded in the culture medium of the present invention have high pluripotency.

[0107] Example 5

[0108] Real-time fluorescence quantitative PCR verification of lung stem cell genes expressed by in vitro amplified lung stem cells

[0109] The cells cultured for 30 generations and the cells extracted from adult lung tissue were washed with PBS, fully lysed with Trizol, added with 1 / 2 chloroform, centrifuged at 4°C, 12000rpm for 15 minutes, the upper aqueous phase was taken and an equal volume of isopropanol was added to mix thoroughly, allowed to stand at room temperature for 10 minutes, and centrifuged at 4°C, 12000rpm for 15 minutes. After that, the precipitate was fully washed with 75% ethanol, dried at room temperature until translucent, and water was added to dissolve the RNA.

[0110] RNA reverse transcription was performed using a reverse transcription kit (Promega, A5001). First, 500 ng RNA was added with 1 μL primer dT, and the volume was adjusted to 5 μL with ddH2O. The reaction was heated at 70°C for 5 minutes to open the helical structure in the RNA, and then immediately placed in an ice bath for more than 5 minutes. Then, 4 μL 5X Reaction buffer, 4 μL MgCl2, 1 μL PCR dNTP, 0.5 μL RNase inhibitors, 1 μL Reverse Transcriptase and 4.5 μL ddH2O were added to the reaction system. After thorough mixing, the reverse transcriptase was inactivated at 25°C for 5 minutes, extended at 42°C for 1 hour, and reacted at 70°C for 15 minutes. The expression level of the corresponding gene was detected by real-time fluorescence quantitative PCR. The reaction system of real-time fluorescence quantitative PCR is shown in Table 1, the reaction conditions are shown in Table 2, and the primer sequences are shown in Table 3; the results are shown in the attached Figure 6 shown.

[0111] Table 1

[0112] Reagents Volume (μL) 2XSYBGreenTaq 10.0 Forwardprimer 0.6 Reverseprimer 0.6 cDNA 0.6 <![CDATA[ddH2O]]> 8.2 Total volume 20

[0113] Table 2

[0114]

[0115]

[0116] Table 3

[0117] Primer name Primer sequences Sox2-F GCGGAGTGGAAACTTTTGTCC, SEQ ID NO: 1 SOX2-R CGGGAAGCGTGTACTTATCCTT, SEQ ID NO: 2 SOX9-F CACACGTCAAGCGACCCATGAA, SEQ ID NO: 3 SOX9-R TCTTCTCGCTCTCGTTCAGCAG, SEQ ID NO: 4 Id2-F CTCCAAGCTCAAGGAACTGG, SEQ ID NO: 5 Id2-R AGGCTGATAGTGGGATG, SEQ ID NO: 6 Wnt7b-F ATGCCCGTGAGATCAAAAAG, SEQ ID NO: 7 Wnt7b-R GTGGTCCAGCAAAGTTTTGGT, SEQ ID NO: 8 Nkx2.1-F GCGACGTTTCAAGCAACAGA, SEQ ID NO: 9 Nkx2.1-R CGTGGGTGTCAGGTGAATCA, SEQ ID NO: 10 EphA4-F AATTTGGGCAGATCGTCAAC, SEQ ID NO: 11 EphA4-R CAGAGAATTCAGGGGAGCTG, SEQ ID NO: 12 Cdh1-F ACTGTGAAGGGGACGGTCAAC, SEQ ID NO: 13 Cdh1-R GGAGCAGGATCAGAATC, SEQ ID NO: 14 Cdc42-F GATTGGTGGAGAGCCATACACTC, SEQ ID NO: 15 Cdc42-R TGAGGATGGAGAGACCACTGAG, SEQ ID NO: 16 Sftpc-F TTGTCGTGGTGATTGTAGGG, SEQ ID NO: 17 Sftpc-R TGGAAAAGGTAGCGATGGTG, SEQ ID NO: 18 Krt5-F TCTGCCATCACCCCATCTGT, SEQ ID NO: 19 Krt5-R CCTCCGCCAGAACTGTAGGA, SEQ ID NO: 20 P63-F AGATCCCTGAACAGTTCCGAC, SEQ ID NO: 21 P63-R CGACGAGAATCCATGTCAAAGTT, SEQ ID NO: 22 NGFR-F CAATGTCCACCAGGAAAACGA, SEQ ID NO: 23 NGFR-R GGAAGTTAGGGGCAAGTCGG, SEQ ID NO: 24 Abca3-F CTTCATGGACGAAGCTGACCTG, SEQ ID NO: 25 Abca3-R GTGCGGTTCTTTTACCAGCGTC, SEQ ID NO: 26 GAPDH-F AGGTCGGTGTGAACGGATTTG, SEQ ID NO: 27 GAPDH-R TGTAGACCATGTAGTTGAGGTCA, SEQ ID NO: 28

[0118] As attached Figure 6The adult lung stem cells continuously expanded and cultured in vitro for 30 generations expressed embryonic lung stem cell genes ( Figure 6 a) and adult lung stem cell genes ( Figure 6 b), indicating that lung stem cells have high omnipotence.

[0119] Example 6

[0120] Identification of the Differentiation Potential of Lung Stem Cells in a Stem Cell Culture System

[0121] In order to verify that the adult lung stem cells cultured in the culture medium of the present invention can still maintain multiple differentiation potentials after continuous passage, lung stem cells passaged 30 times were selected for verification. On the third day of cell passage, the cells were induced to differentiate and then cultured for another 4 days. The induced differentiated lung cells were collected by centrifugation, the cells were washed with PBS, and then the cells were fixed with a 4% paraformaldehyde solution at room temperature for 30 minutes, and the cells were washed with PBS. Antibody proteins that can mark functional mature type I alveolar cells (RAGE), type II alveolar cells (SFTPC), and mature goblet cells (Sca1, Scgb1a1) were added to trace the mature lung cell types differentiated from lung stem cells, and the cells were incubated with the cells overnight at 4°C. The cells were washed 3 times with PBS, and then the immunofluorescence secondary antibody corresponding to the corresponding antibody was added. The cells were incubated at room temperature for 1 hour, and the cells were washed 3 times with PBS. Then, the cells were incubated with DAPI stain for 5 minutes, and the cells were washed 3 times with PBS and observed under a fluorescence microscope (see Appendix). Figure 7 ). Figure 7 a, Scgb1a1 and Sca1 antibodies co-label mature club cells; Figure 7 b, Foxj1, a ciliated cell marker, marks the differentiated ciliated cells; Figure 7 c, The differentiated alveolar type II cells and alveolar type I cells are marked by the alveolar type II cells marker protein Sftpc (red fluorescence) and the alveolar type I cells marker protein RAGE (green fluorescence).

[0122] The results showed that adult lung stem cells cultured continuously for 30 generations still maintained multiple cell differentiation potentials.

[0123] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0124] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A culture medium for expanding mouse adult lung stem cells, characterized in that: The following ingredients are included: epidermal growth factor 5-20 ng / mL, fibroblast growth factor 5-20 ng / mL, human insulin growth factor 50-100μg / mL, glutamine 2-3 mM, glutathione 50-80 μg / mL, Y-27632 5-10 μM, CHIR99021 1-2 μM, ascorbic acid 1-2 mM, superoxide dismutase 375-500 U / mL, L-proline 100-150 μg / mL, L-ornithine 100-200 μg / mL, biotin 125-200 μg / mL, pipemidic acid 100-150 μg / mL, α-tocopherol 100-200 μg / mL, DL-α-tocopheryl acetate 100-200μg / mL, retinol acetate 20-45 μg / mL, oleic acid 50-75 μg / mL, linoleic acid 0.5 -2 mg / mL, linolenic acid 0.5-2mg / mL, human transferrin 250-500 μg / mL, corticosterone 2-4 μg / mL, progesterone 0.63-1.4 μg / mL, putrescine hydrochloride 900-2000 μg / mL, fetal bovine albumin 250-350 mg / mL, ethanolamine 0.05-0.15 μL / mL and triiodothyronine 100-180 ng / mL.

2. The culture medium for expanding mouse adult lung stem cells according to claim 1, characterized in that The following ingredients are included: epidermal growth factor 5 ng / mL, fibroblast growth factor 5 ng / mL, human insulin growth factor 50 μg / mL, glutamine 2 mM, glutathione 50 μg / mL, Y-27632 5 μM, CHIR99021 1 μM, ascorbic acid 1 mM, superoxide dismutase 375 U / mL, L-proline 100 μg / mL, L-ornithine 100 μg / mL, biotin 125 μg / mL, pipemidic acid 100 μg / mL, α-tocopherol 100 μg / mL, DL-α-tocopheryl acetate 100 μg / mL, retinol acetate 20 μg / mL, oleic acid 50 μg / mL, linoleic acid 0.5 mg / mL, linolenic acid 0.5 mg / mL, human transferrin 250 μg / mL, corticosterone 2 μg / mL, progesterone 0.63 μg / mL, putrescine hydrochloride 900 μg / mL, fetal bovine albumin 250 mg / mL, ethanolamine 0.05 μL / mL and triiodothyronine 100 ng / mL.

3. The culture medium for expanding mouse adult lung stem cells according to claim 1 or 2, characterized in that: DMEM / F12 was used as the solvent.

4. A method for preparing a culture medium for expanding mouse adult lung stem cells according to any one of claims 1 to 3, characterized in that: The following steps are involved: (1) Epidermal growth factor, fibroblast growth factor, glutamine, glutathione, ascorbic acid, superoxide dismutase, L-proline, L-ornithine, biotin, pipemidic acid, human transferrin, putrescine hydrochloride and fetal bovine albumin were dissolved in DMEM / F12 to prepare a mother solution; Y-27632, CHIR99021, α-tocopherol, DL-α-tocopherol acetate, retinol acetate, oleic acid, linoleic acid, linolenic acid, corticosterone, progesterone and triiodothyronine were dissolved in DMSO to prepare a stock solution; Human insulin growth factor was dissolved in 0.005 M HCl to prepare a stock solution; (2) Add the mother solutions from step (1) to DMEM / F12 according to the final concentration of the culture medium, and finally add ethanolamine to a final concentration of 0.05-0.15 μL / mL.

5. A method for culturing mouse adult lung stem cells for non-diagnostic and therapeutic purposes, characterized in that: The following steps are involved: (1) Primary lung cells were cultured in collagen-coated culture dishes using DMEM / F12 medium containing 10% FBS to allow cell types other than lung stem cells to adhere to the dish; (2) Collecting non-adherent lung stem cells and culturing them with the culture medium described in any one of claims 1 to 3 to obtain mouse adult lung stem cells.

6. The method for culturing mouse adult lung stem cells according to claim 5, characterized in that: Step (2) During the culture process, half of the medium was replaced every other day.

7. A mouse adult lung stem cell, characterized in that: Cells obtained by culturing using the culture medium described in any one of claims 1 to 3 or the culture method described in claim 5 or 6.

8. Use of the culture medium according to claim 1 in preparing cells, characterized in that: The cells are used for non-diagnostic therapeutic purposes.

9. Use of the culture medium according to claim 1 in preparing an expanded lung stem cell product, characterized in that: The lung stem cells are used for non-diagnostic therapeutic purposes.

10. A use of the mouse adult lung stem cells for non-diagnostic and therapeutic purposes according to claim 7, characterized in that: The application is any of the following: A: In vitro study of the regulatory mechanisms of adult lung stem cell proliferation, differentiation, and death; B: Evaluation of the efficacy of lung stem cell therapy; C: Construction of functional lung organoids; D: Respiratory disease drug development, screening, and pharmacological efficacy evaluation.

Images