Amino acid yield-related protein encoding gene pyrG and related strains, biological materials and applications thereof

By modifying the pyrG protein and using recombinant vector technology, the problem of insufficient L-amino acid production in existing technologies has been solved, and the production of L-threonine, L-tryptophan, L-arginine and L-valine has been significantly improved.

CN115925834BActive Publication Date: 2026-06-23HEILONGJIANG EPPEN BIOTECH CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HEILONGJIANG EPPEN BIOTECH CO LTD
Filing Date
2022-10-08
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively increase the production of L-amino acids such as L-threonine, L-tryptophan, L-arginine, and L-valine.

Method used

By replacing, substituting, and/or adding amino acid residue 450 of the pyrG protein, and using protein tags, a protein capable of regulating microbial amino acid production was constructed. The expression of the pyrG gene was then regulated using recombinant vectors and microbial expression cassettes to achieve the regulation of amino acid production.

Benefits of technology

It significantly increased the production of L-threonine, L-tryptophan, L-arginine and L-valine, achieving precise control over microbial amino acid production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application discloses amino acid yield related protein pyrG and a biomaterial and application thereof, and belongs to the technical field of biotechnology. The problem to be solved by the application is to regulate the amino acid yield of microorganisms, and the amino acid can be L-threonine, L-tryptophan, L-arginine and L-valine. The protein is any one of the following proteins: A1) a protein with an amino acid sequence in which aspartic acid at the 450th position of sequence 2 is replaced by a sequence of histidine, serine, glycine, alanine, valine or phenylalanine; A2) a protein with more than 80% identity with the protein shown in A1) and having the function of regulating the amino acid yield of microorganisms, which is obtained by substitution, deletion and / or addition of amino acid residues on the amino acid sequence of A1); and A3) a fusion protein with the same function, which is obtained by connecting a label to the N terminal and / or C terminal of A1) or A2). The substance for regulating the expression of the pyrG protein gene can be used for regulating the amino acid yield of microorganisms or breeding of an amino acid yield strain.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of biotechnology. In particular, it relates to the amino acid production-related protein pyrG and its related strains, biomaterials, and applications. Background Technology

[0002] Numerous attempts have been made to improve methods for producing L-amino acids using Enterobacter strains. One such attempt involves research into recombinant DNA technology, which allows manipulation of specific genes to knock down or attenuate their expression, thereby producing L-amino acids. Another approach has been to modify Enterobacter strains that produce L-amino acids by amplifying and analyzing the effect of each gene involved in L-amino acid biosynthesis. Additionally, attempts have been made to introduce foreign genes derived from other bacteria.

[0003] However, there is still a need to develop technologies to enhance the production potential of useful substances such as L-amino acids. Summary of the Invention

[0004] The technical problem to be solved by this application is how to regulate or increase the production of L-amino acids in microorganisms, especially the production of L-threonine, L-tryptophan, L-arginine and L-valine.

[0005] To address the aforementioned technical problems, this invention provides a protein.

[0006] The protein provided by this invention is any one of the following proteins:

[0007] A1) A protein, wherein the protein is a pyrG protein or a mutant protein obtained by replacing the 450th amino acid residue of the pyrG protein with any of the following amino acid residues:

[0008] The pyrG protein contains phenylalanine residues, leucine residues, isoleucine residues, methionine residues, valine residues, serine residues, proline residues, threonine residues, alanine residues, tyrosine residues, histidine residues, glutamine residues, asparagine residues, lysine residues, glutamate residues, cysteine ​​residues, tryptophan residues, arginine residues, serine residues, or glycine residues; the pyrG protein is a protein with the amino acid sequence of sequence 2.

[0009] A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence of A1) has more than 80% identity with the protein shown in A1) and has the function of regulating the production of microbial amino acids.

[0010] A3) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0011] In the above text, the 450th amino acid residue refers to the 450th amino acid residue of sequence 2.

[0012] In the above-mentioned proteins, the protein is a pyrG protein or a mutant protein obtained by replacing the 450th amino acid residue of the pyrG protein with any of the following amino acid residues:

[0013] The amino acid residues are aspartic acid residues, histidine residues, serine residues, glycine residues, alanine residues, valine residues, or phenylalanine residues; the pyrG protein is a protein with the amino acid sequence of sequence 2.

[0014] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0015] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSU M62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.

[0016] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0017] In the protein described above, sequence 2 (SEQ ID No. 2) consists of 543 amino acid residues.

[0018] To address the aforementioned technical problems, the present invention also provides biomaterials:

[0019] The biomaterial provided by this invention may be any of the following:

[0020] B1) Nucleic acid molecules that encode the above proteins;

[0021] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0022] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0023] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0024] B5) Inhibit or reduce or downregulate the expression of nucleic acid molecules that encode the protein;

[0025] B6) expresses the gene encoding the RNA molecule described in B5);

[0026] B7) contains an expression cassette containing the gene described in B6);

[0027] B8) A recombinant vector containing the gene described in B6), or a recombinant vector containing the expression cassette described in B7;

[0028] B9) Recombinant microorganisms containing the gene described in B6), or recombinant microorganisms containing the expression cassette described in B7), or recombinant microorganisms containing the recombinant vector described in B4).

[0029] In the above-mentioned biological materials, the nucleic acid molecule described in B1) is any one of the following:

[0030] The coding sequence of Z1 is the DNA molecule shown in SEQ ID No. 5;

[0031] The coding sequence for Z2 is the DNA molecule shown in SEQ ID No. 7;

[0032] The coding sequence for Z3 is the DNA molecule shown in SEQ ID No. 9;

[0033] The coding sequence for Z4 is the DNA molecule shown in SEQ ID No. 11;

[0034] The coding sequence for Z5 is the DNA molecule shown in SEQ ID No. 13;

[0035] The coding sequence for Z6 is the DNA molecule shown in SEQ ID No. 15;

[0036] The nucleotide sequence of Z7 is the DNA molecule shown in SEQ ID No. 5;

[0037] The Z8 nucleotide sequence is the DNA molecule shown in SEQ ID No. 7;

[0038] The nucleotide sequence of Z9 is the DNA molecule shown in SEQ ID No. 9;

[0039] The nucleotide sequence of Z10 is the DNA molecule shown in SEQ ID No. 11;

[0040] The nucleotide sequence of Z11 is the DNA molecule shown in SEQ ID No. 13;

[0041] The Z12 nucleotide sequence is the DNA molecule shown in SEQ ID No. 15.

[0042] To solve the above-mentioned technical problems, the present invention provides the following uses:

[0043] The following are applications of materials in regulating microbial amino acid production, preparing materials for regulating microbial amino acid production, or in microbial breeding:

[0044] C1) The proteins mentioned above;

[0045] C2) Substances that regulate the expression of the gene encoding the protein;

[0046] C3) Substances that regulate the activity or content of the protein.

[0047] In the above text, the protein sequence described in C1) is shown in Sequence 1.

[0048] In the above-described uses, the substance regulating the expression of the gene encoding the protein is any one of the following:

[0049] D1) The nucleic acid molecule encoding the aforementioned protein;

[0050] D2), an expression cassette containing the nucleic acid molecules described in D1);

[0051] D3), ​​a recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2);

[0052] D4) Recombinant microorganisms containing the nucleic acid molecules described in D1), or recombinant microorganisms containing the expression cassette described in D2), or recombinant microorganisms containing the recombinant vector described in D3);

[0053] D5) Inhibit, reduce, or downregulate the expression of nucleic acid molecules encoding the genes of the above proteins;

[0054] D6) expresses the gene encoding the RNA molecule described in D5);

[0055] D7) contains an expression cassette containing the gene described in D6);

[0056] D8) A recombinant vector containing the gene described in D6), or a recombinant vector containing the expression cassette described in D7;

[0057] D9) Recombinant microorganisms containing the gene described in D6), or recombinant microorganisms containing the expression cassette described in D7), or recombinant microorganisms containing the recombinant vector described in D4).

[0058] The encoded protein described in D1) may be the protein described in sequence 1.

[0059] In the nucleic acid molecules described in B1) or D1), those skilled in the art can easily mutate the nucleotide sequence encoding the protein pyrG of the present invention using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides that have 80% or more of the nucleotide sequence identity with the protein TaHsfC2aL isolated in the present invention, as long as they encode protein pyrG and have the function of protein pyrG, are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.

[0060] The aforementioned 80% or higher identity can be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0061] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, a search can be performed to calculate the identity of amino acid sequences, and then the identity value (%) can be obtained.

[0062] In the above-mentioned biological materials, the nucleic acid molecule described in B1) or D1) may be the gene encoding the protein.

[0063] The protein described above, in which isoleucine at position 450 of sequence 2 is mutated to histidine (H), is shown in sequence 6. Its coding sequence is shown in sequence 5.

[0064] The protein with the isoleucine at position 450 of sequence 2 mutated to serine (S) described above has the sequence shown in Sequence 8. Its coding sequence is shown in Sequence 7.

[0065] The protein described above, in which isoleucine at position 450 of sequence 2 is mutated to glycine (G), is shown in sequence 10. Its coding sequence is shown in sequence 9.

[0066] The protein described above, in which isoleucine at position 450 of sequence 2 is mutated to alanine (A), is shown in sequence 14. Its coding sequence is shown in sequence 13.

[0067] The sequence of the protein in which isoleucine at position 450 of sequence 2 is mutated to valine (V) is shown in sequence 12. Its coding sequence is shown in the sequence.

[0068] The protein described above, in which isoleucine at position 450 of sequence 2 is mutated to phenylalanine (F), has the sequence shown in Sequence 16. Its coding sequence is shown in Sequence 15.

[0069] In this document, the vectors described are known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, they may be the vectors pEASY-Blunt and / or pCAMBIA-139;

[0070] In the aforementioned biological materials, the expression cassette described in B2) or D2) refers to DNA capable of expressing the gene in a host cell. This DNA may include not only promoters that initiate gene transcription but also terminators that terminate gene transcription. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); chemically inducible promoters from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both can be induced by jasmonic acid methyl ester); heat shock promoter (US Patent 5,187,267); tetracycline inducible promoter (US Patent 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)), seed storage protein-specific promoters (e.g., promoters of beta-conglycin, napin, oleosin and soybean beta-conglycin (Beach et al. (1985) EMBO J.4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited here are cited in full. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminators (see, for example: Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627.

[0071] In B3) or D3) above, a recombinant expression vector containing the gene expression cassette can be constructed using a plant expression vector. The plant expression vector can be a Gateway system vector or a binary Agrobacterium vector, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb. When constructing a recombinant expression vector using TaHsfC2aL, any enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiqutin promoter (pUbi), etc. These can be used alone or in combination with other plant promoters. Furthermore, when constructing a plant expression vector using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0072] In the above-mentioned biological materials, the nucleic acid molecule described in B5) or D5) can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0073] In the nucleic acid molecule described in B5), those skilled in the art can easily mutate the nucleotide sequence encoding the protein pyrG of the present invention using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides that have 75% or more identity with the nucleotide sequence of the protein pyrG isolated in the present invention, as long as they encode and function the protein pyrG, are all derived from and equivalent to the nucleotide sequence of the present invention.

[0074] The aforementioned 75% or higher identity can be 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0075] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, a search can be performed to calculate the identity of amino acid sequences, and then the identity value (%) can be obtained.

[0076] To address the aforementioned technical problems, this application also provides a method for regulating the production of amino acids by microorganisms.

[0077] The method for regulating microbial amino acid production provided in this application includes regulating the amino acid production of the target microorganism by regulating the expression of the coding gene of the above-mentioned protein in the target microorganism or regulating the activity or content of the above-mentioned protein.

[0078] To address the aforementioned technical problems, this application also provides a method for recombinant microorganisms.

[0079] The method for recombinant microorganisms provided in this application includes regulating the amino acid production of microorganisms by controlling the expression of the coding genes of the aforementioned proteins in the target microorganism or by regulating the activity or content of the aforementioned proteins, thereby obtaining microorganisms with altered amino acid production, wherein the amino acid production of the microorganisms with altered amino acid production is higher or lower than that of the target microorganism.

[0080] In the above text, the regulation can be increased or enhanced, or decreased or weakened.

[0081] In the above text, the upregulation or enhancement or increase of the expression of the gene encoding the protein, or the upregulation or enhancement or increase of the activity or content of the protein, can upregulate or enhance or increase the production of microbial amino acids.

[0082] In the above text, downregulating or weakening or reducing the expression of the gene encoding the protein, or downregulating or weakening or reducing the activity or content of the protein, can downregulate or weaken or reduce the production of microbial amino acids.

[0083] In the above text, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0084] In the above methods, the method aimed at regulating the expression of the gene encoding the protein or regulating the activity or content of the protein in an organism is any one of the following:

[0085] E1) Introduce the gene encoding the protein described above into the target microorganism;

[0086] E2) Introduce the gene encoding any of the following proteins into the target microorganism:

[0087] The amino acid sequence of M1 is the same as that of sequence 2 in the protein.

[0088] M2) is a protein obtained by substituting and / or deleting and / or adding amino acid residues to the protein of M1), which has more than 80% identity with the protein shown in M1) and has the function of regulating the production of microbial amino acids.

[0089] A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of M1 or M2).

[0090] E3) Knock out, downregulate, weaken, or reduce the expression of the pyrG gene in the target microorganism;

[0091] E4) The gene encoding sequence 2 protein in the genome of the target microorganism is altered so that the 450th aspartic acid in its encoded amino acid sequence is replaced with histidine.

[0092] The protein in sequence 2 is any one of the following:

[0093] A1) The amino acid sequence of this protein is the sequence shown in Sequence 2;

[0094] A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence of A1) has more than 80% identity with the protein shown in A1) and has the function of regulating the production of microbial amino acids.

[0095] A3) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0096] In the above text, introducing the coding gene for the protein described above or sequence 2 into the target microorganism can be done by inserting it into a chromosome, where it is inherited as part of the chromosome. The insertion site can specifically be the yaiT coding region. It can also exist as an extrachromosomal genetic factor. The extrachromosomal genetic factor can exist in plasmid form. The plasmid can be pET28(a).

[0097] In the above text, the coding gene existing in plasmid form may be at least one of sequence 1, sequence 5, sequence 7, sequence 9, sequence 11, sequence 13 and sequence 15.

[0098] In this application, the encoded protein described in E1) may be the protein of sequence 2, a protein in which isoleucine at position 450 of sequence 2 is mutated to histidine (H), a protein in which isoleucine at position 450 of sequence 2 is mutated to serine (S), a protein in which isoleucine at position 450 of sequence 2 is mutated to glycine (G), a protein in which isoleucine at position 450 of sequence 2 is mutated to alanine (A), a protein in which isoleucine at position 450 of sequence 2 is mutated to valine (V), or a protein in which isoleucine at position 450 of sequence 2 is mutated to phenylalanine (F).

[0099] In the above text, the sequence of the protein in which isoleucine at position 450 of sequence 2 is mutated to histidine (H) can be shown as Sequence 6. The sequence of the protein in which isoleucine at position 450 of sequence 2 is mutated to serine (S) can be shown as Sequence 8. The sequence of the protein in which isoleucine at position 450 of sequence 2 is mutated to glycine (G) can be shown as Sequence 10. The sequence of the protein in which isoleucine at position 450 of sequence 2 is mutated to alanine (A) can be shown as Sequence 14. The sequence of the protein in which isoleucine at position 450 of sequence 2 is mutated to valine (V) can be shown as Sequence 12. The sequence of the protein in which isoleucine at position 450 of sequence 2 is mutated to phenylalanine (F) can be shown as Sequence 16.

[0100] In the above text, the importation refers to integration in chromosomal form or as an extrachromosomal genetic factor. The extrachromosomal genetic factor may be a plasmid.

[0101] In the above text, the introduced sequence is the gene encoding a protein in which isoleucine at position 450 of sequence 2 is mutated to histidine (H). The target microorganism has increased production of L-glutamic acid, L-arginine, L-threonine, L-lysine and L-isoleucine, and decreased production of L-valine and L-methionine.

[0102] In the above text, the introduced sequence is the gene encoding a protein in which isoleucine at position 450 of sequence 2 is mutated to serine (S). The target microorganism has increased production of L-arginine, L-threonine, L-valine and L-isoleucine, and decreased production of L-glutamic acid, L-lysine and L-methionine.

[0103] In the above text, the introduced sequence is the gene encoding a protein in which isoleucine at position 450 of sequence 2 is mutated to glycine (G). The production of L-glutamic acid, L-arginine and L-threonine increases in the target microorganism, while the production of L-lysine, L-methionine and L-isoleucine decreases.

[0104] In the above text, the introduced sequence is the gene encoding a protein in which isoleucine at position 450 of sequence 2 is mutated to alanine (A). In the target microorganism, the production of L-arginine and L-threonine increases, while the production of L-glutamic acid, L-lysine, L-valine and L-methionine decreases.

[0105] In the above text, the introduced sequence is the gene encoding a protein in which isoleucine at position 450 of sequence 2 is mutated to valine (V), resulting in a decrease in the production of L-glutamic acid, L-arginine, L-threonine, L-lysine, L-valine, L-methionine, and L-cysteine ​​in the target microorganism.

[0106] The imported sequence is the gene encoding a protein in which isoleucine at position 450 of sequence 2 is mutated to phenylalanine (F). The target microorganism has increased production of L-arginine, L-threonine and L-lysine, and decreased production of L-glutamic acid, L-valine, L-methionine and L-isoleucine.

[0107] In the preceding text, the proteins with the following mutations—isoleucine at position 450 of sequence 2 mutated to histidine (H), isoleucine at position 450 of sequence 2 mutated to serine (S), isoleucine at position 450 of sequence 2 mutated to glycine (G), isoleucine at position 450 of sequence 2 mutated to alanine (A), isoleucine at position 450 of sequence 2 mutated to valine (V), or isoleucine at position 450 of sequence 2 mutated to phenylalanine (F)—may exist as extrachromosomal genetic factors. These extrachromosomal genetic factors may be plasmids. The plasmid may be pET28(a).

[0108] In the above text, the protein with the isoleucine at position 450 of sequence 2 mutated to histidine (H) can be integrated into a chromosome. The site of this chromosomal integration can be the yaiT gene region. The extrachromosomal genetic element can be a plasmid. The plasmid can be pET28(a).

[0109] In the above, the microorganism can be any of the following: C1) Bacteria; C2) Enterobacteriaceae; C3) Escherichia; C4) Escherichia coli. The Escherichia coli can be W3110.

[0110] In the above text, the sequence of the protein described in Sequence 2 may be as shown in Sequence 2.

[0111] In the above text, the introduced sequence is the gene encoding the protein of sequence 2, which increases the yield of L-threonine, L-tryptophan, L-arginine and L-valine in the target microorganism.

[0112] In the above text, the introduction can be chromosomal integration or as an extrachromosomal genetic element. The chromosomal integration site can be the yaiT gene region. The extrachromosomal genetic element can be a plasmid. The plasmid can be pET28(a).

[0113] In the above text, the microorganisms may be any of the following: threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402, and L-valine-producing bacteria CGMCC22721.

[0114] In the above text, the E2) knockout, downregulation, weakening or reducing the expression of the target microorganism pyrG gene can be achieved by gene knockout or gene silencing.

[0115] In the above text, the gene knockout gene refers to: knockout is a foreign DNA introduction technology that uses a DNA fragment containing a certain known sequence to undergo homologous recombination with a gene in the recipient cell's genome that has the same or similar sequence, integrates into the recipient cell's genome, and is expressed. It can change the organism's genetic material, causing specific genes to lose their function, thereby shielding some functions.

[0116] In the above text, gene silencing refers to: gene silencing, also known as gene silencing, is a special physiological phenomenon in the process of gene expression regulation in eukaryotic cells. It refers to the phenomenon that some segments of a gene become "silent" due to the combined effects of various factors during the expression process, thereby losing transcriptional activity and not being expressed or having reduced expression.

[0117] The method for altering E3 mentioned above can be to obtain the protein through site-directed mutagenesis in genetic engineering.

[0118] In the above text, the nucleotide encoding the protein region of sequence 2 can be the nucleotide shown in sequence 1. Changing the aspartic acid at position 450 of the encoded amino acid sequence to histidine can be achieved by mutating guanine (G) at position 1348 of sequence 1 to cytosine (C).

[0119] 10. A recombinant microorganism, characterized in that the recombinant microorganism may be any of the following:

[0120] In addition to containing an endogenous pyrG gene, the recombinant microorganism described in K1 also contains an exogenous gene encoding the protein described in claim 1 or 2 or the gene encoding the protein of sequence 2.

[0121] In the recombinant microorganism described in K2), the 450th aspartic acid residue of the protein encoded by the endogenous pyrG gene is changed to histidine.

[0122] In the above text, the gene encoding the exogenous protein of claim 1 or 2 described in K1) may be the gene encoding a protein with isoleucine at position 450 of sequence 2 mutated to histidine (H), a protein with isoleucine at position 450 of sequence 2 mutated to serine (S), a protein with isoleucine at position 450 of sequence 2 mutated to glycine (G), a protein with isoleucine at position 450 of sequence 2 mutated to alanine (A), a protein with isoleucine at position 450 of sequence 2 mutated to valine (V), a protein with isoleucine at position 450 of sequence 2 mutated to phenylalanine (F), or the gene encoding the protein of sequence 2. The manner in which it exists may be as described above.

[0123] To address the aforementioned technical problems, this application provides a method for preparing L-amino acids.

[0124] The method for preparing L-amino acids provided in this application includes producing L-amino acids using the proteins, biological materials, or recombinant microorganisms described above.

[0125] In the above-mentioned proteins, biological materials, uses, methods, or recombinant microorganisms, the microorganism is any one of the following:

[0126] C1) Kingdom Bacteria;

[0127] C2) Enterobacteriaceae;

[0128] C3) Escherichia coli;

[0129] C4) Escherichia coli.

[0130] The *Escherichia coli* may be W3110, threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402, or L-valine-producing bacteria.

[0131] In this application, the amino acid may be at least one of L-threonine, L-tryptophan, L-arginine, and L-valine.

[0132] The recombinant microorganisms described above can be used to produce a variety of products, including but not limited to lysine, glutamic acid, and valine in the examples. The products produced may also include glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutarate, citric acid, ornithine, citrulline, etc.

[0133] The present invention also provides a method for producing amino acids, the method comprising: introducing the above-mentioned biological material into biological cells capable of synthesizing the target amino acid to obtain recombinant biological cells; and culturing the recombinant biological cells to obtain the target amino acid.

[0134] In the above method, the biological cell can be yeast, bacteria, algae, fungi, plant cells, or animal cells capable of synthesizing the target amino acid. The biological cell can be any biological cell capable of synthesizing the target amino acid. The bacteria can be *Escherichia coli*, *Corynebacterium glutamicum*, *Brevibacterium flavum*, *Corynebacterium pekinense*, *Brevibacterium ammonia-eating*, *Corynebacterium obliterans*, or *Pantoea*.

[0135] Beneficial effects:

[0136] This application constructs the plasmid expression vector pET28(a)-pyrG D450H pET28(a)-pyrG D450S pET28(a)-pyrG D450G pET28(a)-pyrG D450V pET28(a)-pyrG D450A and pET28(a)-pyrG D450F Importing them into W3110 respectively shows that importing pET28(a)-pyrG will result in importing pET28(a)-pyrG. D450HFollowing plasmidization, the production of L-threonine, L-tryptophan, L-arginine, and L-valine in the recombinant strains significantly changed. Specifically, as mentioned above, the gene encoding a protein with the introduced sequence of isoleucine at position 450 of sequence 2 mutated to histidine (H) resulted in increased production of L-glutamic acid, L-arginine, L-threonine, L-lysine, and L-isoleucine in the target microorganisms, while decreasing production of L-valine and L-methionine. Conversely, the gene encoding a protein with the introduced sequence of isoleucine at position 450 of sequence 2 mutated to serine (S) also resulted in increased production of L-arginine, L-threonine, L-valine, and L-isoleucine in the target microorganisms, while decreasing production of L-glutamic acid, L-lysine, and L-methionine. The introduced sequence is the gene encoding a protein in which isoleucine at position 450 of sequence 2 is mutated to glycine (G). In the target microorganisms, the production of L-glutamic acid, L-arginine, and L-threonine increases, while the production of L-lysine, L-methionine, and L-isoleucine decreases. The introduced sequence is the gene encoding a protein in which isoleucine at position 450 of sequence 2 is mutated to alanine (A). In the target microorganisms, the production of L-arginine and L-threonine increases, while the production of L-glutamic acid, L-lysine, L-valine, and L-methionine decreases. The introduced sequence is the gene encoding a protein in which isoleucine at position 450 of sequence 2 is mutated to valine (V). In the target microorganisms, the production of L-glutamic acid, L-arginine, L-threonine, L-lysine, L-valine, L-methionine, and L-cysteine ​​decreases. The introduced sequence is the gene encoding a protein in which isoleucine at position 450 of sequence 2 is mutated to phenylalanine (F). The target microorganism exhibits increased production of L-arginine, L-threonine, and L-lysine, while the production of L-glutamic acid, L-valine, L-methionine, and L-isoleucine decreases.

[0137] Furthermore, gene knockout technology was used to replace the pyrG gene in L-threonine-producing strain CGMCC25404 (high L-threonine production), L-tryptophan-producing strain CGMCC25403 (high L-tryptophan production), L-arginine-producing strain CGMCC25402 (high L-arginine production), and L-valine-producing strain CGMCC 22721 (high L-valine production) with pyrG. D450H Gene. The results showed that replacing the pyrG gene with pyrG... D450H The above-mentioned high-yielding strains of the gene showed a significant increase in the production of L-threonine, L-tryptophan, L-arginine, and L-valine.

[0138] Furthermore, the pyrG gene and pyrG were constructed. D450H The genome overexpression vector of the gene, which combines the pyrG gene and pyrG D450HGene insertion into the yaiT gene region of the aforementioned high-yielding strain yielded a pyrG genome overexpressing strain. The results indicate that overexpression of the pyrG gene and pyrG genome via staining integration... D450H The gene can significantly increase the production of L-threonine, L-tryptophan, L-arginine and L-valine in the above-mentioned high-yielding strains.

[0139] Furthermore, a pyrG gene knockout vector was constructed and introduced into high-yielding strains of L-threonine, L-tryptophan, L-arginine, and L-valine (L-threonine-producing strain CGMCC25404, L-tryptophan-producing strain CGMCC25403, L-arginine-producing strain CGMCC25402, and L-valine-producing strain CGMCC 22721). The results showed that the production of L-threonine, L-tryptophan, L-arginine, and L-valine in the aforementioned high-yielding strains with the pyrG gene knocked out was significantly reduced.

[0140] Furthermore, the pyrG gene and pyrG were constructed. D450H The plasmid overexpression vector of the gene will express the pyrG gene and pyrG. D450H The gene was integrated into pET28(a) and introduced into the L-threonine-producing strain CGMCC25404 (high L-threonine production), the L-tryptophan-producing strain CGMCC25403 (high L-tryptophan production), the L-arginine-producing strain CGMCC25402 (high L-arginine production), and the L-valine-producing strain CGMCC 22721 (high L-valine production), to obtain pyrG plasmid overexpression strains and pyrG. D450H Genome overexpression strains. Results showed that plasmid overexpression of the pyrG gene and pyrG... D450H The gene can significantly increase the production of L-threonine, L-tryptophan, L-arginine and L-valine in the above-mentioned high-yielding strains.

[0141] The results showed that the production of L-amino acids such as L-threonine, L-tryptophan, L-valine, and L-arginine was significantly increased. As mentioned above, for both high-producing L-amino acid strains and the model strain W3110, replacing the aspartic acid at position 450 of the amino acid sequence encoded by the pyrG gene (shown in Sequence 2) with histidine helps to increase the production of L-threonine, L-tryptophan, L-arginine, and L-valine. For high-producing L-amino acid strains, the wild-type pyrG gene and the mutant pyrG gene... D450H Overexpression of these genes all contribute to increased production of L-threonine, L-tryptophan, L-arginine, and L-valine, while knockout of the pyrG gene is detrimental to their production.

[0142] Depositing Instructions

[0143] 1. Bacterial strain name: Escherichia coli

[0144] Latin name: Escherichiacoli

[0145] Classification and nomenclature: Escherichia coli

[0146] Strain number: YP045

[0147] Preservation institution: China General Microbiological Culture Collection Center, China Microbial Culture Collection Committee.

[0148] Abbreviation of depositary institution: CGMCC.

[0149] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0150] Date of preservation: June 15, 2021.

[0151] Registration number at the Preservation Center: CGMCCNo.22721.

[0152] 2. Bacterial strain name: Escherichia coli

[0153] Latin name: Escherichiacoli

[0154] Classification and nomenclature: Escherichia coli

[0155] Strain number: YP004-8

[0156] Preservation institution: China General Microbiological Culture Collection Center, China Microbial Culture Collection Committee.

[0157] Abbreviation of depositary institution: CGMCC.

[0158] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0159] Date of preservation: July 25, 2022.

[0160] Registration number at the Preservation Center: CGMCCNo.25402.

[0161] 3. Bacterial strain name: Escherichia coli

[0162] Latin name: Escherichiacoli

[0163] Classification and nomenclature: Escherichia coli

[0164] Strain number: YP006D

[0165] Preservation institution: China General Microbiological Culture Collection Center, China Microbial Culture Collection Committee.

[0166] Abbreviation of depositary institution: CGMCC.

[0167] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0168] Date of preservation: July 25, 2022.

[0169] Registration number at the Preservation Center: CGMCCNo.25403.

[0170] 4. Bacterial strain name: Escherichia coli

[0171] Latin name: Escherichiacoli

[0172] Classification and nomenclature: Escherichia coli

[0173] Strain number: YP0158

[0174] Preservation institution: China General Microbiological Culture Collection Center, China Microbial Culture Collection Committee.

[0175] Abbreviation of depositary institution: CGMCC.

[0176] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0177] Date of preservation: July 25, 2022.

[0178] Registration number at the Preservation Center: CGMCCNo.24504. Detailed Implementation

[0179] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0180] Example 1: Construction of the pyrG gene mutant strain W3110

[0181] I. Construction of pyrG gene mutant plasmid

[0182] For ease of study, the wild-type pyrG gene (sequence as shown in SEQ ID No. 1) and its promoter were first cloned into the expression vector pET28(a). Using the Escherichia coli W3110 genome sequence published by NCBI as a template, the wild-type pyrG gene fragment was amplified by PCR using primers pET28-PF / pET28-PR. After recovery, it was ligated with the expression vector pET28(a) (purchased from TaKaRa, containing kanamycin resistance) recovered by EcoRI / Hind III digestion using NEBuilder enzyme (purchased from NEB) at 50°C for 30 min. The ligation product was transformed into DH5α and plated on 2-YT agar plates containing kanamycin (50 mg / L) and cultured at 37°C to obtain the pET28(a) transformant pET28(a)-pyrG (sequence as shown in SEQ ID No. 3). The cultured single clones were identified by primers T7-F / T7-R and r Taq PCR. The PCR amplification of the fragment containing a size of 1933bp (sequence as shown in SEQ ID No. 4) was the pET28(a) positive transformant pET28(a)-pyrG containing the pyrG gene.

[0183] To obtain a mutant encoding the cytidine triphosphate synthase gene pyrG, a pyrG mutant gene plasmid was prepared using a random mutagenesis kit (Agilent Technologies, USA). Using plasmid pET28(a)-pyrG as a template, PCR amplification was performed with primers pET28-PF / pET28-PR, yielding a 1638 bp pyrG gene fragment containing a random point mutation. The pET28(a)-pyrG-MT transformant (sequence shown in SEQ ID No. 3, but with a random point mutation in the pyrG coding region) was also obtained.

[0184] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10 μL, dNTP Mixture (10 mM) 1.5 μL, primers (10 pM) 1.6 μL each, KAPA HiFi HotStart (1 U / μL) 0.5 μL, add ddH2O to a total volume of 50 μL.

[0185] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 60 s; 30 cycles), 72℃ over-extension for 5 min.

[0186] The recovered DNA fragment was ligated with the expression vector pET28(a) (purchased from TaKaRa, containing kanamycin resistance) recovered by EcoRI / Hind III digestion using NEBuilder enzyme (purchased from NEB) at 50°C for 30 min. The ligation product was transformed into DH5α and plated onto 2-YT agar plates containing kanamycin (50 mg / L) and incubated at 37°C. The cultured single clones were identified by primers T7-F / T7-R and rTaq PCR. PCR amplification of a fragment of 1933 bp (sequence as shown in SEQ ID No. 4, but with a random point mutation in the pyrG coding region) was identified as a pET28(a) positive transformant containing a random pyrG mutation.

[0187] PCR amplification system: 12.5 μL of 2×Premix r Taq, 1 μL of each primer (10 pM), and ddH2O added to a total volume of 25 μL.

[0188] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0189] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0190] pET28-PF:5'- TAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCC atgacaacgaactatatttttgtga-3' (the underlined nucleotide sequence is the pET28(a) homologous arm sequence)

[0191] pET28-PR:5'- CGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGTGCGGCCGC ttacttcgcctgacgtttctg-3' (The underlined nucleotide sequence is the pET28(a) homologous arm sequence).

[0192] T7-R:5'-TAATACGACTCACTATAGGG-3'

[0193] T7-F:5'-GCTAGTTATTGCTCAGCGG-3'

[0194] II. Construction of pyrG gene mutant strains

[0195] To identify the L-amino acid production performance of the mutant vector constructed in step one, specifically, the pyrG random mutant plasmid constructed in step one was transformed into *E. coli* strain W3110 (its genome sequence is shown in Genebank: AP009048.1) (transformation and identification were the same as in step one). Positive transformants were passaged three times on 2-YT agar plates containing kanamycin (50 mg / L), and then inoculated into 500 mL Erlenmeyer flasks containing 30 mL of rich culture medium for shake-flask fermentation at 37°C until the bacterial cells reached OD0.05. 600 When the concentration of IPTG reaches 0.1, a final concentration of 0.1 mM is added to induce CTP synthase overexpression. Fermentation is then stopped after 24 hours of shake-flask fermentation.

[0196] After fermentation, the concentration of L-amino acids was analyzed by high-performance liquid chromatography (HPLC), as shown in Table 1. Strains exhibiting superior L-amino acid production capacity compared to the W3110 control were selected; these were designated as the W3110-pET-28a-pyrG mutant strain.

[0197] Enriched culture medium: The solvent is water, and the solutes and their concentrations are as follows: glucose 30 g / L, (NH4)2SO4 2 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.05 g / L, MnSO4·H2O 0.05 g / L, FM902 yeast extract 1.5 g / L, corn steep liquor 5 g / L, molasses 17 g / L, betaine 0.5 g / L, citric acid 2 g / L, vitamin H 20 mg / L, vitamin B1 1.5 mg / L, vitamin B3 1.5 mg / L. 12 1.5 g / L, pH adjusted to 7.0 with sodium hydroxide.

[0198] Ultimately, five candidate strains were obtained, named mutant strain 1, mutant strain 2, mutant strain 3, mutant strain 4, and mutant strain 5 (as shown in Table 1). The disclosed *E. coli* W3110-pyrG mutant strain possesses the ability to produce some L-amino acids, with mutant strain 2 exhibiting superior abilities to produce L-threonine, L-arginine, and L-valine. This indicates that mutant strain pyrG 2 has the activity to synthesize L-threonine, L-arginine, and L-valine.

[0199] Table 1. Results of L-amino acid analysis by high performance liquid chromatography in the W3110-pyrG mutant strain.

[0200]

[0201]

[0202] Sequencing of the pyrG gene using a plasmid extracted from the W3110-pyrG mutant strain 2 confirmed that the guanine (G) at position 1348 of the pyrG mutant nucleotide sequence was mutated to cytosine (C), and the aspartic acid (D) at position 450 of the mutant protein pyrG was mutated to histidine (H). This plasmid is pET28(a)-pyrG. D450H (The sequence is shown in SEQ ID No. 3, with a mutation of C at position 1348. The DNA sequence shown in SEQ ID No. 1 is the wild-type pyrG gene, and the amino acid sequence encoding the protein is shown in SEQ ID No. 2 (the protein is named wild-type pyrG protein); the DNA sequence shown in SEQ ID No. 5 is the mutant pyrG gene.) D450H The gene, the mutant pyrG D450H The guanine (G) at position 1348 of the gene sequence (SEQ ID No. 5) is mutated to cytosine (C), encoding a protein with the amino acid sequence of SEQ ID No. 6 (the name of the mutated protein is mutant pyrG). D450H (protein), the mutant protein pyrG D450H The histidine (H) at position 450 in the amino acid sequence (SEQ ID No. 6) is derived from aspartic acid (D) by mutation.

[0203] III. Construction of pyrG gene mutant plasmids

[0204] W3110-pyrG mutant strain 2 was obtained from wild-type Escherichia coli W3110 using a random mutation approach. To obtain more pyrG mutants and improve their L-amino acid production capacity, mutants were constructed with different amino acid substitutions at the pyrG mutation position. Specifically, using the plasmid sequenced in step two as a template, five mutants were constructed with different amino acid substitutions at position 450 of pyrG. The substituted amino acids and the primer names used in each mutant are shown in Table 2.

[0205] Table 2. Amino acids substituted by pyrG mutants and the names of primers used in each mutant.

[0206]

[0207] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0208] S-PR:5'-atcgCTaaccaactggcactgctgtgcgccgagacgcatg-3',

[0209] S-PF: 5'-catgcgtctcggcgcacagcagtgccagttggttAGcgat-3',

[0210] G-PR: 5'-atcCCcaaccaactggcactgctgtgcgccgagacgcatg-3',

[0211] G-PF: 5'-catgcgtctcggcgcacagcagtgccagttggttgGGgat-3',

[0212] V-PR: 5'-atcAAcaaccaactggcactgctgtgcgccgagacgcatg-3',

[0213] V-PF: 5'-catgcgtctcggcgcacagcagtgccagttggttgTTgat-3',

[0214] A-PR: 5'-atcgGcaaccaactggcactgctgtgcgccgagacgcatg-3',

[0215] A-PF: 5'-catgcgtctcggcgcacagcagtgccagttggttgCcgat-3',

[0216] F-PR: 5'-atcgAAaaccaactggcactgctgtgcgccgagacgcatg-3',

[0217] F-PF: 5'-catgcgtctcggcgcacagcagtgccagttggttTTcgat-3',

[0218] Using the plasmid pET28(a)-pyrG sequenced in Step 2 D450HUsing the templates, PCR amplification was performed with the primers in Table 2 and KAPAHiFi HotStart, yielding two DNA fragments: an Up DNA fragment of 1417 bp and a Down DNA fragment of 393 bp, each containing a pyrG mutant base. After the PCR reaction, the Up and Down DNA fragments were recovered by agarose gel electrophoresis using a column DNA gel recovery kit. The recovered DNA fragments were ligated with the expression vector pET28(a) recovered by EcoRI / HindIII digestion using NEBuilder enzyme (purchased from NEB) at 50°C for 30 min. The ligation product was transformed into DH5α and plated onto 2-YT agar plates containing kanamycin (50 mg / L) and incubated at 37°C. The cultured single clones were identified by primer T7-F / T7-R PCR. The positive transformant containing a 1933bp fragment, pET28(a) with pyrG mutation, was amplified by rTaq PCR. The five pyrG mutant vectors with the threonine at position 450 replaced by the amino acids in Table 2 were named as listed in Table 2.

[0219] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0220] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 60 s; 30 cycles), 72℃ over-extension for 5 min.

[0221] PCR amplification system: 12.5 μL of 2×Premix r Taq, 1 μL of each primer (10 pM), and 25 μL of ddH2O.

[0222] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0223] IV. Construction of CTP synthase mutant strains

[0224] To determine the L-amino acid production performance of the mutant vector constructed in step three, specifically, the plasmid constructed in step three was transformed into *E. coli* strain W3110 (transformation and identification were the same as in step one). Positive transformants were passaged three times on 2-YT agar plates containing kanamycin (50 mg / L), and then inoculated into 500 mL Erlenmeyer flasks containing 30 mL of rich culture medium. The culture was then shake-fermented at 37°C for 24 h until the bacterial cells reached an OD value. 600 IPTG was added at a final concentration of 0.1 mM when the concentration was 0.2 to induce overexpression of cytidine triphosphate synthase (CTP).

[0225] After fermentation, the concentrations of L-amino acids were analyzed by high-performance liquid chromatography (HPLC), as shown in Table 3. The mutant strain W3110-pET28(a)-D450H showed superior ability to produce L-threonine, L-arginine, and L-valine compared to W3110-pET28(a)-D450S, W3110-pET28(a)-D450G, W3110-pET28(a)-D450A, W3110-pET28(a)-D450V, and W3110-pET28(a)-D450F.

[0226] Table 3. Results of L-amino acid analysis by high performance liquid chromatography in the W3110-pyrG mutant strain.

[0227]

[0228]

[0229] Example 2: Constructing the genome pyrG D450H Mutant engineered strains

[0230] Based on the genome sequence of Escherichia coli W3110 published by NCBI, point mutations were performed on the pyrG gene of a high-yielding L-amino acid strain using CRISPR / Cas9 gene editing technology. This allowed for further in-depth research on the pyrG gene and mutant pyrG in high-yielding strains. D450H The effect of genes on the production of L-amino acids such as L-threonine, L-tryptophan, L-valine, and L-arginine.

[0231] A point mutation was introduced into the coding region of the pyrG gene (SEQ ID No. 1), wherein the point mutation was to mutate guanine (G) to cytosine (C) at position 1348 of the nucleotide sequence of the pyrG gene (SEQ ID No. 1) to obtain the DNA molecule shown in SEQ ID No. 5 (mutant pyrG gene, named mutant pyrG). D450H Gene).

[0232] The DNA molecule shown in SEQ ID No. 1 encodes a protein with the amino acid sequence of SEQ ID No. 2 (the protein is named wild-type pyrG protein). The DNA molecule shown in SEQ ID No. 5 encodes a protein with the amino acid sequence of SEQ ID No. 6 (the mutant protein is named mutant pyrG). D450H (protein), the mutant protein pyrG D450H The histidine (H) at position 450 in the amino acid sequence (SEQ ID No. 6) is derived from aspartic acid (D) by mutation.

[0233] I. Construction of sgRNA

[0234] Based on the Escherichia coli W3110 genome sequence published by NCBI, sgRNA target sequences were designed using CRISPRRGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting a suitable sgRNA target sequence, linearized pGRB cloning vector terminal sequences were added to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0235] Amplifying the sgRNA fragment requires no template; only a PCR annealing process is needed. The system and procedure are as follows: PCR reaction system: sgRNA-1F 10 μL, sgRNA-1R 10 μL; PCR reaction procedure: denaturation at 95℃ for 5 min, annealing at 50℃ for 1 min. After annealing, the target fragment is recovered using a DNA purification kit, its DNA concentration is determined, and the concentration is diluted to 100 ng / μL.

[0236] pGRB plasmid was extracted and digested with Spe I and dephosphorylated to prevent self-ligation of the pGRB plasmid (addgene website #71539). The digestion system consisted of 5 μL 10x Buffer, 2.5 μL Spe I, 3000-5000 ng pGRB plasmid DNA, and ddH2O to a final volume of 50 μL. After digestion at 37°C for 3 h, the DNA was recovered by agarose gel electrophoresis and then dephosphorylated. The dephosphorylation system consisted of 5 μL 10x Buffer, 1000-2000 ng linearized pGRB plasmid DNA, 2.5 μL CIAP, and ddH2O to a final volume of 50 μL. After treatment at 37°C for 1 h, the linearized pGRB plasmid was recovered using a DNA purification kit. Recombination of sgRNA and pGRB plasmid was then performed using a Gibson Assembly kit (New England Biosciences). Recombinant system: 2.5 μL NEB assembly enzyme, 2 μL linearized cloning vector, and 0.5 μL sgRNA. After assembly at 50℃ for 30 min, the product was transformed into DH5α competent cells, plasmid was extracted, and identified by sequencing using sgRNA-PF / sgRNA-PR primers. The constructed plasmid was named pGRB-sgRNA-1.

[0237] The primers used in this experiment were designed as follows (synthesized by Invitrogen Shanghai). Underlined bases are the homologous arm sequences of the pGRB cloning vector, and bases in lowercase are the sgRNA sequences:

[0238] sgRNA-1F:5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT cggcgcacagcagtg

[0239] ccagt GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG -3'

[0240] sgRNA-1R:5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC actggcactgc

[0241] tgtgcgccg ACTAGTATTATACCTAGGACTGAGCTAGCTGTCA -3''

[0242] sgRNA-PF:5'-GTCTCATGAGCGGATACATATTTG-3'

[0243] sgRNA-PR:5'-ATGAGAAAGCGCCACGCT-3'

[0244] II. pyrG gene mutation D450H DNA amplification

[0245] Using W3110 genomic DNA as a template, PCR amplification was performed with primers P1 / P2, P3 / P4, and KAPA HiFi HotStart, respectively, yielding two DNA sequences, each containing a mutated base and measuring 563 bp (pyrG). D450H Up) and 310bp (pyrG) D450H Down) pyrG D450H DNA fragments were recovered by agarose gel electrophoresis after the PCR reaction. D450H Up and pyrG D450H Down. The recovered DNA was used to obtain the point-mutated integrated homologous arm DNA fragment Up-pyrG by primer P1 / P4 overlap PCR. D450H -Down(SEQ ID No.17)853bp.

[0246] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0247] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 60 s; 30 cycles), 72℃ over-extension for 5 min.

[0248] Primer design is as follows (synthesized by Invitrogen Shanghai). Underlined and bolded bases indicate mutation sites:

[0249] P1:5'-ACGATTCAGCTTAAACTGCCCG-3',

[0250] P2:5'-CTGGCGAACCAGGCTATCGT G AACCAACTGGCACTGCTGT-3',

[0251] P3:5'-ACAGCAGTGCCAGTTGGTT C ACGATAGCCTGGTTCGCCAG-3',

[0252] P4:5'-TTACTTCGCCTGACGTTTCTGGAA-3',

[0253] III. Preparation and Transformation of Competent Behaviors

[0254] The pREDCas9 plasmid (Addgene, catalog number #7154, containing a spectinomycin resistance gene) was extracted and transformed into competent cells of L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402, and L-valine-producing bacteria CGMCC22721, respectively. The cells were then plated onto 2-YT agar plates containing spectinomycin (100 mg / L) and incubated at 32°C. Single colonies resistant to spectinomycin (100 mg / L) were selected and identified by rTaq PCR using primers pRedCas9-PF / pRedCas9-PR, yielding a 943 bp (SEQ ID) plasmid. No. 18) consists of L-threonine CGMCC25404-Cas9, L-tryptophan CGMCC25403-Cas9, L-arginine CGMCC25402-Cas9 and L-valine CGMCC22721-Cas9 transformants containing the pREDCas9 plasmid.

[0255] L-threonine CGMCC25404-Cas9, L-tryptophan CGMCC25403-Cas9, L-arginine CGMCC25402-Cas9, and L-valine CGMCC22721-Cas9 competent cells were prepared, and the cells were grown to OD200. 600 =0.1mM IPTG was added to induce λ-Red-mediated homologous recombination. When OD 600 When the concentration was 0.4, bacterial cells were collected to prepare competent cells, which were then transformed with pGRB-sgRNA-1 plasmid and the point-mutated recombinant DNA fragment Up-pyrG. D450H -Down, spread onto 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and incubate at 32°C. Transformants were identified by PCR using primers P5 / P6 and rTaq. The resulting 933 bp (SEQ ID No. 19) PCR product was denatured at 95°C for 10 min, followed by an ice bath for 5 min, and then subjected to SSCP (Single-Strand Conformation Polymorphism) electrophoresis (using Up-pyrG). D450H -Down amplified PCR fragment is the positive control, W3110 amplified PCR fragment is the negative control, and water is the blank control. Due to the different fragment structures, the electrophoretic positions are different. Therefore, strains whose PCR fragment electrophoretic positions are inconsistent with the negative control fragment positions but consistent with the positive control fragment positions are strains with successful allelic substitution.

[0256] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0257] P5:5'-CCGGGCCTGTTGAAATCTCA-3',

[0258] P6:5'-TACCCAGGGTACGCGTTGC-3',

[0259] pRedCas9-PF:5'-GCAGTGGCGGTTTTCATG-3'

[0260] pRedCas9-PR:5'-CCTTGGTGATCTCGCCTTTC-3'

[0261] PCR amplification system: 12.5 μL of 2×Premix r Taq, 1 μL of each primer (10 pM), and 25 μL of ddH2O.

[0262] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0263] Preparation and electrophoresis conditions for SSCP electrophoresis: 8 mL of 40% acrylamide, 4 mL of glycerol, 2 mL of 10×TBE, 40 μL of TEMED, 600 μL of 10% APS, and 26 mL of ddH2O; place the electrophoresis tank in ice and electrophore in 1×TBE buffer at 120V for 10 h.

[0264] Transformants that successfully underwent point mutation were inoculated into 2-YT medium containing spectinomycin (100 mg / L) and a final concentration of 0.2% arabinose to eliminate the pGRB-sgRNA-1 plasmid. Colonies that grew on spectinomycin (100 mg / L) but not on ampicillin (100 mg / L) were selected. These colonies were then transferred to 2-YT medium and cultured at 42°C to eliminate the pREDCas9 plasmid. Colonies that did not grow on spectinomycin (100 mg / L) but grew on antibiotic-free 2-YT medium were selected. The point mutation sequence was amplified again by primer P3 / P4 PCR and sequenced for identification. The sequencing results were compared with the W3110 genome sequence to confirm that the mutation at base C to base G at position 1350 of the pyrG gene was the pyrG mutant. D450H Positive transformants. The pyrG gene mutant... D450H The L-threonine producing strains CGMCC25404, L-tryptophan producing strain CGMCC25403, L-arginine producing strain CGMCC25402, and L-valine producing strain CGMCC22721 were named YPThr-pyrG001, YPTrp-pyrG001, YPR-pyrG001, and YPV-pyrG001, respectively.

[0265] Example 3: Constructing genome-overexpressing pyrG gene and pyrG D450H engineered strains of genes

[0266] Based on the genome sequence of Escherichia coli W3110 published by NCBI, CRISPR / Cas9 gene editing technology was used to integrate wild-type pyrG and mutant pyrG genes into the coding regions of the yaiT gene in L-threonine-producing strains CGMCC25404, L-tryptophan-producing strain CGMCC25403, L-arginine-producing strain CGMCC25402, and L-valine-producing strain CGMCC22721 (sequencing confirmed that these amino acid-producing strains retain wild-type yaiT and pyrG genes on their chromosomes), respectively. D450H This will allow for further research into the pyrG gene and mutant pyrG in high-yielding strains. D450H The influence of genes on the synthesis of L-amino acids such as L-threonine, L-tryptophan, L-valine, and L-arginine.

[0267] I. Construction of sgRNA

[0268] Based on the Escherichia coli W3110 genome sequence published by NCBI, sgRNA target sequences were designed using CRISPRRGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting a suitable sgRNA target sequence, linearized pGRB cloning vector terminal sequences were added to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0269] Amplifying the sgRNA fragment requires no template; only a PCR annealing process is needed. The system and procedure are as follows: PCR reaction system: sgRNA-2F 10 μL, sgRNA-2R 10 μL; PCR reaction procedure: denaturation at 95℃ for 5 min, annealing at 50℃ for 1 min. After annealing, the target fragment is recovered using a DNA purification kit, its DNA concentration is determined, and the concentration is diluted to 100 ng / μL.

[0270] pGRB plasmid was extracted and digested with Spe I and dephosphorylated to prevent self-ligation. The digestion system consisted of 5 μL 10x Buffer, 2.5 μL Spe I, 3000-5000 ng pGRB plasmid DNA, and ddH2O to a final volume of 50 μL. After digestion at 37°C for 3 h, the plasmid was recovered by agarose gel electrophoresis and then dephosphorylated. The dephosphorylation system consisted of 5 μL 10x Buffer, 1000-2000 ng pGRB plasmid DNA, 2.5 μL CIAP, and ddH2O to a final volume of 50 μL. After treatment at 37°C for 1 h, the linear pGRB plasmid was recovered using a DNA purification kit. Recombination of sgRNA and pGRB plasmid was then performed using a Gibson Assembly kit (New England Biotechnology). The recombination system consisted of 2.5 μL NEB assembly enzyme, 2 μL linearized cloning vector, and 0.5 μL sgRNA. After assembly at 50℃ for 30 min, the product was transformed into DH5α competent cells, plasmid was extracted, and identified by sequencing using sgRNA-PF / sgRNA-PR primers. The constructed plasmid was named pGRB-sgRNA-2.

[0271] The primers used in this experiment were designed as follows (synthesized by Invitrogen Shanghai). Underlined bases are the homologous arm sequences of the pGRB cloning vector, and bases in lowercase highlighted text are the sgRNA sequences:

[0272] sgRNA-2F:5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT ggcaactatg taaactatag G TTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG -3'

[0273] sgRNA-2R:5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC ctatagttta catagttgcc A CTAGTATTATACCTAGGACTGAGCTAGCTGTCA -3''

[0274] sgRNA-PF:5'-GTCTCATGAGCGGATACATATTTG-3'

[0275] sgRNA-PR:5'-ATGAGAAAGCGCCACGCT-3'

[0276] II. PCR amplification of overexpressed genomic DNA sequences

[0277] Based on the Escherichia coli W3110 genome sequence published by NCBI, four pairs of amplified upstream and downstream homologous arm sequences and pyrG or pyrG were designed and synthesized. D450HPrimers for the gene coding region and promoter region were used to introduce the pyrG gene or pyrG gene into the coding region of the L-amino acid producing bacterium yaiT using CRISPR / Cas9 gene editing. D450H Gene.

[0278] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0279] P7:5'-AAGAGAATGG AAGAGAGGCC-3',

[0280] P8:5'-CGCTTGACCGCGTAATTCCCCCCAATCAAGTGCTGTAACG-3',

[0281] P9:5'-CGTTACAGCACTTGATTGGGGGGAATTACGCGGTCAAGCG-3',

[0282] P10:5'-TCACAAAAATATAGTTCGTTGTCATGCTGAACCTGAGAAGTTAGGTTGA-3',

[0283] P11:5'-TCAACCTAACTTCTCAGGTTCAGCATGACAACGAACTATATTTTGTGA-3',

[0284] P12:5'-CGGTAGTGTAGGTTTCGTTGTAGGTTTTCCTCAAGTCACTAGTTA-3',

[0285] P13:5'-TAACTAGTGACTTGAGGAAAACCTACAACGAAAACCTACACTACCG-3',

[0286] P14:5'-CGACCTGTAG TATCCCATTC-3'.

[0287] Using W3110 genomic DNA as a template, primers P7 / P8 and P13 / P14 and KAPA HiFi HotStart PCR were used to amplify the upper homologous arm (590 bp, SEQ ID No. 201-590) and the lower homologous arm (610 bp, SEQ ID No. 202498-3107). Using W3110 genomic DNA as a template, primers P9 / P10 and KAPA HiFi HotStart PCR were used to amplify the pyrG promoter fragment (227 bp, SEQ ID No. 20571-797). The pyrG promoter fragment was amplified using W3110 genomic DNA and plasmid pET28(a)-pyrG. D450H Using primers P11 / P12 and KAPA HiFi HotStart, pyrG (SEQ ID No. 20774-2542) and pyrG were amplified by PCR. D450H The gene (SEQ ID No. 21774-2542) is 1769 bp. After the PCR reaction, the DNA was recovered by agarose gel electrophoresis using a column DNA extraction kit. The recovered DNA was then used with primers P7 and P14 overlap PCR to obtain the overexpressed DNA recombinant fragments Up-pyrG-Down (SEQ ID No. 20) and Up-pyrG, respectively. D450H -Down(SEQ ID No.21)3107bp.

[0288] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0289] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 60 s; 30 cycles), 72℃ over-extension for 5 min.

[0290] III. Preparation and Transformation of Competent Behaviors

[0291] When the bacteria grow to OD 600 =0.1mM IPTG was added to induce λ-Red-mediated homologous recombination. When OD 600 When the concentration of the bacterial cell was 0.4, competent cells were collected and transformed into pGRB-sgRNA-2 plasmid and the genomic overexpression DNA fragments Up-pyrG-Down and Up-pyrG, respectively. D450H-Down, spread onto 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and incubate at 32°C. Single colonies produced are identified by r Taq PCR using primers P15 / P16. Positive transformants are those that amplify a fragment of 1282 bp (the sequence without point mutations is as shown in SEQ ID No. 22; the sequence with point mutations has a C at position 210, and the rest is as shown in SEQ ID No. 22). Transformants that do not amplify the fragment are the original bacteria.

[0292] Positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg / L) and arabinose to a final concentration of 0.2% to eliminate plasmid pGRB-sgRNA-2. Colonies that grew on spectinomycin (100 mg / L) but not on ampicillin (100 mg / L) were selected. These colonies were then transferred to 2-YT medium and cultured at 42°C to eliminate pREDCas9 plasmid. Colonies that grew on antibiotic-free 2-YT medium but not on spectinomycin (100 mg / L) were selected. They were identified by rTaq PCR using primers P17 / P18. Transformants containing a 2371 bp fragment (the sequence without point mutations is shown in SEQ ID No. 23; the sequence with point mutations has a C at position 2225, and the rest is as shown in SEQ ID No. 23) were considered positive transformants. Transformants that could not be amplified were considered original bacteria.

[0293] Wild-type and mutant pyrG genes were overexpressed in the genomes of L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402, and L-valine-producing bacteria CGMCC22721. D450H The genes were named YPThr-pyrG002 (without mutation) and YPThr-pyrG003 (with mutation), YPTrp-pyrG002 (without mutation) and YPTrp-pyrG003 (with mutation), YPR-pyrG002 (without mutation) and YPR-pyrG003 (with mutation), and YPV-pyrG002 (without mutation) and YPV-pyrG003 (with mutation).

[0294] The recombinant bacteria YPThr-pyrG002, YPTrp-pyrG002, YPR-pyrG002, and YPV-pyrG002 contain double copies of the pyrG gene shown in SEQ ID No. 1. Specifically, these recombinant bacteria are obtained by replacing the yaiT coding region in the genomes of *Escherichia coli* L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402, and L-valine-producing bacteria CGMCC22721 with the pyrG gene and its promoter, while keeping other nucleotides in their genome unchanged. The recombinant bacteria containing double copies of the pyrG gene can significantly and stably increase the expression level of the pyrG gene.

[0295] Recombinant bacteria YPThr-pyrG003, YPTrp-pyrG003, YPR-pyrG003, and YPV-PYRG003 contain the mutated pyrG shown in SEQ ID No. 3. D450H Genes; specifically, the recombinant strains YPThr-pyrG003, YPTrp-pyrG003, YPR-pyrG003, and YPV-pyrG003 are formed by replacing the yaiT coding region in the genomes of Escherichia coli L-threonine-producing strains CGMCC25404, L-tryptophan-producing strains CGMCC25403, L-arginine-producing strains CGMCC25402, and L-valine-producing strain CGMCC22721 with the mutant pyrG gene. D450H Recombinant bacteria obtained by keeping the gene and its promoter unchanged, while maintaining other nucleotides in the genome. Containing two copies of pyrG. D450H Recombinant bacteria can significantly and stably increase the expression level of the pyrG gene.

[0296] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0297] P15:5'-TGGGTATGCAGGTGGCGT-3',

[0298] P16:5'-CAATGTTCAGCGAAGAACCGTTAG-3',

[0299] P17:5'-GATGTTTGTGGAATCGAGGG-3',

[0300] P18:5'-GACCAACTGATCATCCCCGG3'.

[0301] PCR amplification system: 12.5 μL of 2×Premix r Taq, 1 μL of each primer (10 pM), and 25 μL of ddH2O.

[0302] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0303] Example 4: Construction of an engineered strain with the pyrG gene deleted from its genome

[0304] Based on the genome sequence of Escherichia coli W3110 published by NCBI, the pyrG gene of L-threonine-producing strains CGMCC25404, L-tryptophan-producing strain CGMCC25403, L-arginine-producing strain CGMCC25402, and L-valine-producing strain CGMCC22721 (sequencing confirmed that these amino acid-producing strains retain the wild-type pyrG gene on their chromosomes) was knocked out using CRISPR / Cas9 gene editing technology. This allowed for a more in-depth study of the impact of the E. coli pyrG gene on the synthesis of L-amino acids such as L-threonine, L-tryptophan, L-valine, and L-arginine in high-yielding strains.

[0305] I. Construction of sgRNA

[0306] Based on the Escherichia coli W3110 genome sequence published by NCBI, sgRNA target sequences were designed using CRISPRRGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting a suitable sgRNA target sequence, linearized pGRB cloning vector homologous arm sequences were added to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0307] Amplifying the sgRNA fragment requires no template; only a PCR annealing process is needed. The system and procedure are as follows: PCR reaction system: sgRNA-3F 10 μL, sgRNA-3R 10 μL; PCR reaction procedure: denaturation at 95℃ for 5 min, annealing at 50℃ for 1 min. After annealing, the target fragment is recovered using a DNA purification kit, its DNA concentration is determined, and the concentration is diluted to 100 ng / μL.

[0308] pGRB plasmid was extracted and digested with Spe I and dephosphorylated to prevent self-ligation. The digestion system consisted of 5 μL 10x Buffer, 2.5 μL Spe I, 3000-5000 ng pGRB plasmid DNA, and ddH2O to a final volume of 50 μL. After digestion at 37°C for 3 h, the DNA was recovered by agarose gel electrophoresis and then dephosphorylated. The dephosphorylation system consisted of 5 μL 10x Buffer, 1000-2000 ng linearized pGRB plasmid DNA, 2.5 μL CIAP, and ddH2O to a final volume of 50 μL. After treatment at 37°C for 1 h, the linearized pGRB plasmid was recovered using a DNA purification kit. Recombination of sgRNA and pGRB plasmid was then performed using a Gibson Assembly kit (New England Biotechnology). The recombination system consisted of 2.5 μL NEB assembly enzyme, 2 μL linearized cloning vector, and 0.5 μL sgRNA. After assembly at 50℃ for 30 min, the product was transformed into DH5α competent cells, plasmid was extracted, and identified by sequencing using sgRNA-PF / sgRNA-PR primers. The constructed plasmid was named pGRB-sgRNA-3.

[0309] The primers used in this experiment were designed as follows (synthesized by Invitrogen Shanghai). Underlined bases are the homologous arm sequences of the pGRB cloning vector, and bases in lowercase highlighted text are the sgRNA sequences:

[0310] sgRNA-3F:5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT agcttcggtctgaaagctgt GT TTTAGAGCTAGAAATAGCAAGTTAAAATAAGG -3'

[0311] sgRNA-3R:5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC acagctttcagaccgaagct A CTAGTATTATACCTAGGACTGAGCTAGCTGTCA -3''

[0312] sgRNA-PF:5'-GTCTCATGAGCGGATACATATTTG-3'

[0313] sgRNA-PR:5'-ATGAGAAAGCGCCACGCT-3'

[0314] II. PCR amplification of DNA recombination fragments missing from the genome

[0315] Based on the genome sequence of Escherichia coli W3110 published by NCBI, two pairs of primers were designed and synthesized to amplify the upstream and downstream homologous arm sequences, and the pyrG gene of L-amino acid producing bacteria was knocked out by CRISPR / Cas9 gene editing.

[0316] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0317] P19:5'-AATGACAAGCGCTTGATTTGCG-3',

[0318] P20:5'-TGACGTTCTGCGTAAAGAACGCCCAACATGGAGAACGCCAACTCT-3',

[0319] P21:5'-AGAGTTGGGCGTTCTCCATGTTGGGCGTTCTTTACGCAGAACGTCA-3',

[0320] P22:5'-ACAACGCGTACCCAGGTACGCG-3'.

[0321] Using W3110 genomic DNA as a template, PCR amplification was performed using primers P19 / P20, P21 / P22, and KAPA HiFi HotStart to obtain upper and lower homologous arm fragments of 523 bp and 524 bp, respectively. After the PCR reaction, the DNA was recovered by agarose gel electrophoresis using a column DNA gel recovery kit. The recovered DNA was then subjected to primer P19 / P22 overlap PCR to obtain a 1022 bp recombinant DNA fragment ΔpyrG-Up-Dwon (SEQ ID No. 24) that lacks the pyrG gene.

[0322] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0323] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 60 s; 30 cycles), 72℃ over-extension for 5 min.

[0324] III. Preparation and Transformation of Competent Behaviors

[0325] L-threonine CGMCC25404-Cas9, L-tryptophan CGMCC25403-Cas9, L-arginine CGMCC25402-Cas9, and L-valine CGMCC22721-Cas9 competent cells were prepared, and the cells were grown to OD200. 600=0.1mM IPTG was added to induce λ-Red-mediated homologous recombination. When OD 600 When the concentration of bacteria reached 0.4, competent cells were collected and transformed into pGRB-sgRNA-3 plasmid and the recombinant DNA fragment ΔpyrG-Up-Dwon (with the pyrG genome deleted), respectively. These cells were then plated onto 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and incubated at 32°C. Single colonies were identified by rTaq PCR using primers P19 / P22. Transformants containing a 1002 bp fragment (SEQ ID No. 24) were considered positive, while those containing an 1870 bp fragment were considered the original bacteria.

[0326] Positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg / L) and a final concentration of 0.2% arabinose to eliminate plasmid pGRB-sgRNA-3. Colonies that grew on spectinomycin (100 mg / L) but not on ampicillin (100 mg / L) were selected. These colonies were then transferred to 2-YT medium and incubated at 42°C to eliminate pREDCas9 plasmid. Colonies that did not grow on spectinomycin (100 mg / L) but grew on antibiotic-free 2-YT were selected. They were then identified again by r Taq PCR using primers P19 / P22. PCR amplification of transformants containing a size of 1002 bp (SEQ ID No. 24) was considered positive transformant.

[0327] Positive transformants lacking the pyrG gene in the genomes of L-threonine-producing strain CGMCC25404, L-tryptophan-producing strain CGMCC25403, L-arginine-producing strain CGMCC25402, and L-valine-producing strain CGMCC22721 were named YPThr-pyrG004, YPTrp-pyrG004, YPR-pyrG004, and YPV-pyrG004, respectively.

[0328] PCR amplification system: 12.5 μL of 2×Premix r Taq, 1 μL of each primer (10 pM), and 25 μL of ddH2O.

[0329] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0330] Example 5: Construction of pyrG gene and pyrG overexpression via plasmid D450H engineered strains of genes

[0331] Based on the Escherichia coli (E. coli) W3110 genome sequence published by NCBI, the wild-type pyrG gene and the mutant pyrG gene were expressed using the E. coli expression vector pET28(a) (purchased from TaKaRa, containing kanamycin resistance). D450H The coding and promoter regions of L-threonine-producing strains CGMCC25404, L-tryptophan-producing strain CGMCC25403, L-arginine-producing strain CGMCC25402, and L-valine-producing strain CGMCC 22721 (sequencing confirmed that these amino acid-producing strains retain the wild-type pyrG gene on their chromosomes) were introduced to further investigate multi-copy pyrG genes and mutant pyrG genes in high-yielding strains. D450H The effect of genes on the production of L-amino acids such as L-threonine, L-tryptophan, L-valine, and L-arginine.

[0332] Competent cells containing L-threonine (CGMCC25404), L-tryptophan (CGMCC25403), L-arginine (CGMCC25402), and L-valine (CGMCC22721) were prepared. When OD... 600 When the concentration of the bacterial cell was 0.6, the bacterial cells were collected to prepare competent cells, which were then transformed into the plasmids pET28(a)-pyrG and pET28(a)-pyrG constructed in Example 1, respectively. D450H The culture was spread onto 2-YT agar plates containing kanamycin (50 mg / L) and incubated at 37°C. Single colonies produced were identified by primers T7-F / T7-R and rTaq PCR. Positive transformants were those that amplified a fragment of 1874 bp (the sequence without point mutations is shown in SEQ ID No. 4; the sequence with point mutations has a T at position 824, and the rest is as shown in SEQ ID No. 4); the original bacteria were those that could not amplify the fragment.

[0333] PCR amplification system: 12.5 μL of 2×Premix r Taq, 1 μL of each primer (10 pM), and 25 μL of ddH2O.

[0334] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0335] Wild-type and mutant pyrG genes were overexpressed in plasmids from L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402, and L-valine-producing bacteria CGMCC22721. D450HThe genes were named YPThr-pyrG005 (without mutation point) and YPThr-pyrG006 (with mutation point), YPTrp-pyrG005 (without mutation point) and YPTrp-pyrG006 (with mutation point), YPR-pyrG005 (without mutation point) and YPR-pyrG006 (with mutation point), and YPV-pyrG005 (without mutation point) and YPV-pyrG006 (with mutation point).

[0336] Recombinant bacteria YPThr-pyrG005, YPTrp-pyrG005, YPR-pyrG005, and YPV-pyrG005, containing the pET28(a)-pyrG overexpressed pyrG gene shown in SEQ ID No. 1, were obtained by maintaining their genomic sequence unchanged. The pET28(a)-pyrG overexpression recombinant bacteria significantly and stably increased the expression level of the pyrG gene.

[0337] Recombinant bacteria YPThr-pyrG006, YPTrp-pyrG006, YPR-pyrG006, and YPV-pyrG006 contain pET28(a)-pyrG D450H Overexpression of the mutant pyrG shown in SEQ ID No. 5 D450H The gene, obtained by preserving its genomic sequence, is a recombinant bacterium. pET28(a)-pyrG D450H Overexpression of recombinant bacteria can significantly and stably increase pyrG. D450H Gene expression levels.

[0338] Example 6: Fermentation Experiment

[0339] I. L-Threonine Fermentation Experiment

[0340] Fermentation experiments were conducted using L-threonine fermentation medium and conditions on Escherichia coli strains W3110, W3110-pET28(a)-D450H, CGMCC25404, and engineered pyrG strains YPThr-pyrG001, YPThr-pyrG002, YPThr-pyrG003, YPThr-pyrG004, YPThr-pyrG005, and YPThr-pyrG006, respectively, in a 5L fermenter of BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.). Each strain was replicated three times.

[0341] YPThr-pyrG005 and YPThr-pyrG006 are strains that overexpress pET28(a). They require IPTG induction during fermentation, and the fermentation culture cells grow to OD0.05. 600nm IPTG was added at a final concentration of 0.1 mM when the concentration was 0.1. After fermentation, the L-threonine content was detected by high performance liquid chromatography (HPLC). The results were the average of three replicates, as shown in Table 4.

[0342] L-Threonine fermentation medium: The solvent is water, and the solutes and their concentrations are as follows: glucose 13 g / L, (NH4)2SO4 1 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.01 g / L, MnSO4·H2O 0.01 g / L, FM902 yeast extract 1.5 g / L, corn steep liquor 5 g / L, molasses 17 g / L, and the pH is adjusted to 7.0 by ammonia.

[0343] L-threonine fermentation culture conditions:

[0344] Calibrate DO 100%: Temperature 37℃, air volume 5L / min, speed 800rpm, tank pressure 0MPa, calibrate after 5min;

[0345] Inoculation dose: 10%;

[0346] Initial conditions: pH 7.0, culture temperature 37℃, tank pressure 0 MPa, air volume 0.5 L / min, rotation speed 400 rpm;

[0347] Full process control: 1. When dissolved oxygen < 30%, increase the rotation speed by 500 rpm → 600 rpm → air volume by 1 L / min → 700 rpm → 800 rpm in sequence; 2. Increase the tank pressure by 0.01 MPa after 8 hours of fermentation; increase the tank pressure by 0.02 MPa → 0.03 MPa → 0.04 MPa → 0.05 MPa after 12 hours;

[0348] Residual sugar control: 0.1-0.5% before F12h; after F12h, control residual sugar to 0.1-0.3% in conjunction with DO requirements;

[0349] Feeding materials: 25% ammonia water, 55% concentrated sugar, 10% foaming agent;

[0350] IPTG addition: Add IPTG to a final concentration of 0.1 mM when the fermentation culture cells reach an OD of 600 nm = 0.1.

[0351] Fermentation cycle: about 30 hours. The process is controlled by adjusting the air volume based on dissolved oxygen of 20-30%.

[0352]

[0353] The fermentation results above show that, for both the high-L-threonine-producing strain and the model strain W3110, replacing the aspartic acid at position 450 of the pyrG gene with histidine helps increase L-threonine production. For high-L-threonine-producing strains, both the wild-type and mutant pyrG genes... D450H Overexpression of the gene helps increase L-threonine production, while knocking out the pyrG gene is not conducive to increasing L-threonine production.

[0354] II. L-Tryptophan Fermentation Experiment

[0355] Escherichia coli strains W3110, W3110-pET28(a)-D450H, CGMCC25403, and mutant strains YPTrp-pyrG001, YPTrp-pyrG002, YPTrp-pyrG003, YPTrp004, YPTrp-pyrG005, and YPTrp-pyrG006 were inoculated into a 5L BLBIO-5GC-4-H fermenter (Shanghai Bailun Biotechnology Co., Ltd.) and fermented under L-tryptophan fermentation medium and conditions. Each strain was repeated three times. YPTrp-pyrG005 and YPTrp-pyrG006 were strains overexpressing pET28(a) and required IPTG induction during fermentation. The fermentation culture reached OD200. 600nm IPTG was added at a final concentration of 0.1 mM when the concentration was 0.1. After fermentation, the L-tryptophan content was determined by high performance liquid chromatography (HPLC), and the results were the average of three replicates, as shown in Table 5.

[0356] L-Tryptophan fermentation medium: The solvent is water, and the solutes and their concentrations are as follows: glucose 7g / L, FM902 yeast extract 1g / L, (NH4)2SO4 1.2g / L, citric acid 1.2g / L, MgSO4·7H2O 1.5g / L, K2HPO4·3H2O 5.5g / L, antifoaming agent 0.2mL / L, and pH adjusted to 7.0 by ammonia.

[0357] L-Tryptophan culture conditions:

[0358] Calibrate DO 100%: Temperature 35℃, Rotation speed 800rpm, Air volume 5L / min, Tank pressure 0.00Mpa;

[0359] Inoculation dose: 10%;

[0360] Initial conditions: temperature 35℃, pH 7.0, air volume 1.0L / min, rotation speed 350rpm;

[0361] Full process control: When dissolved oxygen is ≤20% before the base sugar is depleted, increase the speed sequentially to 400rpm and then 450rpm; when the base sugar is depleted, replenish sugar and control dissolved oxygen to 15-30%; pH 7.0 before 24h and 6.7 after 24h.

[0362] Residual sugar control: 0.1-0.5% before F12h; after F12h, control residual sugar to 0.1-0.3% in conjunction with DO requirements;

[0363] Feeding materials: 25% ammonia water, 55% concentrated sugar, 10% foaming agent;

[0364] IPTG addition: Fermentation culture cells grow to OD. 600nm Add IPTG to a final concentration of 0.1 mM when the concentration is 0.1.

[0365] Fermentation cycle: about 34 hours. The process is controlled by adjusting the air volume based on dissolved oxygen of 15-30%.

[0366]

[0367] The fermentation results above show that, for both the high-L-tryptophan-producing strain and the model strain W3110, replacing the aspartic acid at position 450 of the pyrG gene with histidine contributes to increased L-tryptophan production. For high-L-tryptophan-producing strains, both the wild-type and mutant pyrG genes... D450H Overexpression of the gene helps increase L-tryptophan production, while knocking out the pyrG gene is not conducive to increasing L-tryptophan production.

[0368] III. L-Arginine Fermentation Experiment

[0369] Escherichia coli strains W3110, W3110-pET28(a)-D450H, CGMCC25402, and engineered pyrG strains YPR-pyrG001, YPR-pyrG003, YPR-pyrG004, YPR-pyrG005, and YPR-pyrG006 were inoculated into a 5L BLBIO-5GC-4-H fermenter (Shanghai Bailun Biotechnology Co., Ltd.) and fermented under L-arginine fermentation medium and conditions. Each strain was repeated three times. YPR-pyrG005 and YPR-pyrG006 were strains overexpressing pET28(a) and required IPTG induction during fermentation. After fermentation, the L-arginine content was determined by high-performance liquid chromatography (HPLC), and the results were the average of the three replicates, as shown in Table 6.

[0370] L-Arginine fermentation medium: The solvent is water, and the solutes and their concentrations are as follows: glucose 8 g / L, FM902 yeast extract 3 g / L, K2HPO4·3H2O 6 g / L, MgSO4·7H2O 1 g / L, FeSO4·7H2O 0.05 g / L, betaine 0.5 g / L, VB 12 0.005 g / L, defoamer 0.3 mL / L, ammonium sulfate 3 g / L, pH 7.2.

[0371] L-arginine fermentation culture conditions: Corrected DO 100%: temperature 35℃, pH 7.2, rotation speed 100rpm, air volume 6L / min, tank pressure 0.01Mpa;

[0372] Inoculation dose: 10%;

[0373] Initial conditions: temperature 35℃, pH 7.2, tank pressure 0.01 MPa, air volume 1.5 L / min, rotation speed 350 rpm;

[0374] Full-process control: Control DO at 20-30%; when dissolved oxygen ≤25%, increase the rotation speed by 300rpm→400rpm→2.0L / min→500rpm→0.02Mpa→600rpm→3.0L / min→0.03Mpa→700rpm→3.5L / min→0.04Mpa→800rpm→900rpm→4.0L / min→0.05Mpa→1000rpm;

[0375] Residual sugar control: Residual sugar content is controlled at 0.05-0.1% throughout the entire process;

[0376] Feeding materials: 25% ammonia water, 80% concentrated sugar, 10% foaming agent;

[0377] IPTG addition: Fermentation culture cells grow to OD. 600nm Add IPTG to a final concentration of 0.1 mM when the concentration is 0.1.

[0378] Fermentation cycle: about 50 hours. The process is controlled by adjusting the air volume based on dissolved oxygen of 20-30%.

[0379]

[0380]

[0381] As shown by the fermentation results above, for both the high-L-arginine-producing strain and the model strain W3110, the aspartic acid at position 450 of the pyrG gene amino acid sequence is histidine-treated.

[0382] + Acid substitution all contribute to increased L-arginine production; for high-yielding L-arginine strains, both the wild-type pyrG gene and the mutant pyrG gene... D450H Overexpression of the gene helps increase L-arginine production, while knocking out the pyrG gene is not conducive to increasing L-arginine production.

[0383] IV. L-valine fermentation experiment

[0384] Escherichia coli W3110, Escherichia coli W3110-pET28(a)-D450H, Escherichia coli CGMCC22721, and pyrG engineered strains YPV-pyrG001, YPV-pyrG002, YPV-pyrG003, YPV-pyrG004, YPV-pyrG005, and YPV-pyrG006 were inoculated into a 5L BLBIO-5GC-4-H fermenter (Shanghai Bailun Biotechnology Co., Ltd.) and fermented under L-arginine fermentation medium and conditions. Each strain was repeated three times. YPV-pyrG005 and YPV-pyrG006 were strains overexpressing pET28(a) and required IPTG induction during fermentation. After fermentation, the L-valine content was determined by high-performance liquid chromatography (HPLC), and the results were the average of the three replicates, as shown in Table 7.

[0385] L-valine fermentation medium: The solvent is water, and the solutes and their concentrations are as follows: yeast extract 4 g / L, corn steep liquor powder 2 g / L, peptone 4 g / L, methionine 2 g / L, KH₂PO₄·3H₂O 7 g / L, MgSO₄·7H₂O 2 g / L, CoCl₂ 20 mg / L, (NH₄)₂SO₄ 3 g / L, citric acid 2 g / L, FeSO₄·7H₂O 50 mg / L, MnSO₄·7H₂O 30 mg / L, VH 20 mg / L, VB₁ 1.5 mg / L, VB₃ 1.5 mg / L. 12 1.5 g / L, defoamer 0.3 mL / L, (NH4)2SO4 3 g / L, pH 7.0.

[0386] L-valine fermentation culture conditions: Corrected DO 100%: temperature 37℃, pH 7.2, rotation speed 100rpm, air flow rate 6L / min, tank pressure 0.00Mpa;

[0387] Inoculation dose: 10%;

[0388] Initial conditions: temperature 37℃, pH 7.2, tank pressure 0.01 MPa, air volume 1.5 L / min, rotation speed 350 rpm;

[0389] Aerobic phase: Control DO at 20-30%; when dissolved oxygen ≤25%, increase the rotation speed by 300rpm→400rpm→2.0L / min→500rpm→0.02Mpa→600rpm→3.0L / min→0.03Mpa→700rpm→3.5L / min→0.04Mpa→800rpm→900rpm→4.0L / min→0.05Mpa→1000rpm;

[0390] Anaerobic stage: When the OD reaches 50-60, the rotation speed is reduced to 400 rpm and the air volume is reduced to 2 L / min.

[0391] Residual sugar control: Residual sugar content is controlled at 0.1-0.2% throughout the entire process;

[0392] Feeding materials: 25% ammonia water, 60% concentrated sugar, 10% foaming agent;

[0393] IPTG addition: During the aerobic phase, when the fermentation culture cells grow to OD... 600nm Add IPTG to a final concentration of 0.1 mM when the concentration is 0.1.

[0394] Fermentation cycle: approximately 50 hours.

[0395] L-valine fermentation involves a two-stage aerobic-aerobic fermentation process. Cells are first cultured under aerobic conditions, with airflow, rotation speed, and sugar supplementation rate adjusted in the early stages to maintain dissolved oxygen at approximately 25%. Once the OD (oxidative stress) is reached... 600 When the value reaches 50-60, the rotation speed is reduced to 400 rpm and the air volume is reduced to 2L / min; and the aerobic fermentation is switched to the anaerobic fermentation.

[0396]

[0397]

[0398] The fermentation results showed that, for both high-yielding L-valine strains and the model strain W3110, the substitution of histidine at position 450 of the pyrG gene amino acid sequence with aspartic acid contributed to increased L-valine production. For high-yielding L-valine strains, both the wild-type and mutant pyrG genes... D450H Overexpression of the gene helps increase L-valine production, while knocking out the pyrG gene is not conducive to increasing L-valine production.

[0399] The fermentation results above show that, for both the high-yielding L-amino acid strain and the model strain W3110, the substitution of histidine at position 450 of the pyrG gene amino acid sequence with aspartic acid contributes to the increased production of L-threonine, L-tryptophan, L-arginine, and L-valine. For the high-yielding L-amino acid strain, both the wild-type and mutant pyrG genes... D450H Overexpression of these genes all contribute to increased production of L-threonine, L-tryptophan, L-arginine, and L-valine, while knockout of the pyrG gene is detrimental to their production.

[0400] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0401] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0402] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The use of any of the following biomaterials in increasing the amino acid production of Escherichia coli or in the preparation of products that increase the amino acid production of Escherichia coli: C1) A protein with the amino acid sequence SEQ ID No. 6; C2) A substance that enhances the expression of the gene encoding the protein described in C1); said substance is any one of the following: D1) A nucleic acid molecule encoding the protein described in C1); D2) An expression cassette containing the nucleic acid molecules described in D1); D3) A recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2); D4) Recombinant Escherichia coli containing the nucleic acid molecule described in D1), or recombinant Escherichia coli containing the expression cassette described in D2), or recombinant Escherichia coli containing the recombinant vector described in D3); The amino acids are L-threonine, L-tryptophan, L-arginine, and / or L-valine.

2. A method for increasing the amino acid production of Escherichia coli, characterized in that, The method includes increasing the amino acid production of the target Escherichia coli by increasing the expression of the gene encoding the protein with the amino acid sequence SEQ ID No. 6 in the target Escherichia coli; the amino acid is L-threonine, L-tryptophan, L-arginine and / or L-valine.

3. The method as described in claim 2, characterized in that, The method for increasing the expression of the gene encoding the protein with the amino acid sequence SEQ ID No. 6 in the target Escherichia coli is any one of the following: E1) The gene encoding the protein whose amino acid sequence is SEQ ID No. 6 is introduced into the target Escherichia coli; E2) The gene encoding the protein shown in SEQ ID No. 2 in the genome of the target Escherichia coli is altered so that the aspartic acid at position 450 of the encoded amino acid sequence is mutated to histidine.

4. A method for preparing L-amino acids, characterized in that, The method includes producing L-amino acids in Escherichia coli using the biomaterials described in claim 1; wherein the L-amino acids are L-threonine, L-tryptophan, L-arginine, and / or L-valine.