Lactococcus lactis, microbial agent and preparation method and application thereof

Abstract

The present invention relates to the field of microorganisms, and in particular to Lactococcus lactis, a microbial agent, and a preparation method and application thereof. The present invention provides Lactococcus lactis JWA32 (Lactococcus lactis JWA32), and its deposit number is: CCTCC No.M 20221851. The present invention provides Lactococcus lactis, a microbial agent, and a preparation method and application thereof. The present invention provides a strain of Lactococcus lactis with excellent efficacy in preparing a skin microecological preparation, which can alleviate the oxidative damage of HaCaT cells and repair the epidermal barrier.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and in particular to Lactococcus lactis, a microbial agent, and a preparation method and application thereof. Background Art

[0002] The skin microecological system is composed of various microorganisms, tissue cells on the skin surface, various secretions, microenvironments, etc. They maintain the balance of the skin microecology, form the first biological barrier on the skin surface, and have important physiological functions. At present, the research on the efficacy of probiotics at home and abroad has become mature and is widely used in the field of cosmetics. With the development of bio-fermentation technology, the "microecological skin care era" of maintaining the balance of the skin "ecosystem", making the skin "wall" more solid, and repairing the skin microecology as a whole, thereby reshaping healthy skin has arrived. At the same time, anti-aging effects are becoming younger and more and more popular in the market. According to Euromonitor data, the scale of anti-aging skin care products in the Chinese skin care market in 2020 reached 64.6 billion yuan, accounting for 28.8% of the skin care market share. According to iResearch data, in terms of focusing on efficacy, the first efficacy of the overall sample is anti-aging. Consumers are more looking forward to slowing down the aging of the skin and maintaining a youthful state through daily skin care.

[0003] Many external factors related to the environment and lifestyle can affect skin aging. Ultraviolet radiation is the main factor leading to external skin aging. Ultraviolet rays can induce skin photoaging through a variety of signal pathways, such as causing oxidative stress, thereby increasing the production of free radicals, especially reactive oxygen free radicals (ROS). Excessive free radicals can cause toxic attacks on biological tissues such as chromosomes, mitochondria, cell membranes and connective tissue, causing damage to the body and leading to aging. Excessive free radicals in the skin can act on unsaturated fatty acids in the skin's lipid layer, reacting to form a lipid-protein complex, namely lipofuscin, which accumulates in cells. Therefore, removing excess free radicals is one of the effective ways to resist skin aging.

[0004] Existing probiotics for scavenging active oxygen free radicals are mainly used in the fields of food and medicine, but are rarely used in the field of cosmetics. Summary of the invention

[0005] In view of this, the present invention provides Lactococcus lactis, microbial agents, and preparation methods and applications thereof. The present invention provides a strain of Lactococcus lactis with excellent efficacy in preparing skin microecological preparations, which can alleviate the oxidative damage of HaCaT cells and repair the epidermal barrier.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides Lactococcus lactis JWA32 (Lactococcus lactis JWA32), and its preservation number is: CCTCC No.M 20221851.

[0008] The present invention also provides a microbial agent, comprising any one of the following and an acceptable adjuvant;

[0009] (I), the above-mentioned Lactococcus lactis JWA32; and / or

[0010] (II), inactivated bacteria of the above-mentioned Lactococcus lactis JWA32; and / or

[0011] (III) the fermentation broth, culture, exosomes, lysate or extract of the above-mentioned Lactococcus lactis JWA32.

[0012] In some embodiments of the present invention, the fermentation broth in the above-mentioned microbial agent includes fermentation product filtrate or bacterial fermentation lysate filtrate.

[0013] In some embodiments of the present invention, the fermentation product filtrate in the above-mentioned microbial agent is fermented and inoculated with the Lactococcus lactis to obtain a seed solution, then fermented and cultured, centrifuged, filtered, and the supernatant is collected to obtain the product.

[0014] In some embodiments of the present invention, the fermentation lysate filtrate of the bacterial body in the above-mentioned microbial agent is fermented and inoculated with the Lactococcus lactis to obtain the seed solution, then fermented and cultured, the bacterial body is broken, centrifuged and filtered to obtain the seed solution.

[0015] In some embodiments of the present invention, the dosage form of the microbial agent includes: one or more of an emulsion, an aqueous solution, an ointment, a film or a gel.

[0016] The present invention also provides a method for preparing the above-mentioned microbial agent, comprising the following steps:

[0017] S1: taking the lactococcus lactis and inoculating and culturing it to obtain a seed solution;

[0018] S2: taking the seed liquid for fermentation and culturing, first centrifuging and filtering, collecting the supernatant, and obtaining the microbial agent; or

[0019] The seed liquid is fermented and cultured, the bacterial bodies are broken, centrifuged and filtered for a second time, and the supernatant is collected to obtain the microbial agent.

[0020] In some embodiments of the present invention, the culturing time in the above preparation method S1 is 24 hours and the temperature is 37°C.

[0021] In some embodiments of the present invention, in the above-mentioned preparation method S1, the rotation speed of the first centrifugation is 6000 rpm and the time is 10 min.

[0022] In some embodiments of the present invention, the inoculation amount during the fermentation culture in the preparation method S2 is 10%, and the number of viable bacteria is 1×10 9 ~10 10 CFU / mL.

[0023] In some embodiments of the present invention, the fermentation culture time in the above preparation method S2 is 24 hours and the temperature is 37°C.

[0024] In some embodiments of the present invention, in the above-mentioned preparation method S1, the rotation speed of the second centrifugation is 6000 rpm and the time is 10 min.

[0025] The present invention also provides the use of the above-mentioned Lactococcus lactis, the above-mentioned microbial agent or the microbial agent obtained by the above-mentioned preparation method in preparing products that reduce ROS levels, inhibit hyaluronidase activity, increase ceramide secretion or increase SOD enzyme activity.

[0026] The present invention also provides the use of the above-mentioned Lactococcus lactis, the above-mentioned microbial agent or the microbial agent obtained by the above-mentioned preparation method in preparing a product for alleviating oxidative damage of HaCaT cells, repairing epidermal barriers or inhibiting harmful bacteria.

[0027] In some embodiments of the present invention, the harmful bacteria in the above application include Staphylococcus aureus or Streptococcus albus.

[0028] The present invention also provides the use of the above-mentioned Lactococcus lactis, the above-mentioned microbial agent or the microbial agent obtained by the above-mentioned preparation method in the preparation of antioxidant, anti-aging or anti-wrinkle products.

[0029] The present invention also provides a product, comprising the above-mentioned Lactococcus lactis, the above-mentioned microbial agent or the microbial agent obtained by the above-mentioned preparation method and acceptable auxiliary materials or additives.

[0030] In some embodiments of the present invention, the above-mentioned product includes: cosmetics.

[0031] The invention provides Lactococcus lactis JWA32, whose preservation number is CCTCC No.M 20221851. The invention also provides a microbial agent and a preparation method and application thereof.

[0032] The fermentation filtrate of Lactococcus lactis JWA32 provided by the present invention can alleviate the oxidative damage of HaCaT cells, has excellent antioxidant effect, and also has the effect of repairing the skin barrier.

[0033] Biological Deposit Description

[0034] Lactococcus lactis JWA32, the deposit date is November 30, 2022, the deposit number is CCTCC No.M 20221851, the name of the depository is: China Center for Type Culture Collection, and the address of the depository is: Wuhan University, Wuhan, China. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0036] Figure 1 Shows the cell survival rate detected by MTT method;

[0037] Figure 2 Shows the results of ROS scavenging;

[0038] Figure 3 Show Figure 2 The fluorescence intensity of the microscopic examination of the ROS scavenging results;

[0039] Figure 4 It was shown to promote the secretion rate of ceramide;

[0040] Figure 5 Shows superoxide dismutase SOD enzyme activity;

[0041] Figure 6 The results of inhibiting harmful bacteria are shown; the upper figure shows the inhibition rate of Staphylococcus aureus (%), and the lower figure shows the inhibition rate of Streptococcus albus (%);

[0042] Figure 7 Shows hyaluronidase inhibition rate. DETAILED DESCRIPTION

[0043] The invention discloses lactococcus lactis, a microbial agent and a preparation method and application thereof.

[0044] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0045] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0046] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0047] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0048] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0049] The invention provides a strain of Lactococcus lactis JWA32 (Lactococcus lactis JWA32), with a preservation number (CCTCC No.M 20221851), which has the functions of alleviating oxidative damage of HaCaT cells and secreting ceramide, namely, antioxidant function and skin barrier repair function, and inhibiting harmful bacteria such as Staphylococcus aureus and Candida albicans. The strain can be applied to skin microecological preparations, in particular to anti-aging preparations, preferably to anti-aging cosmetics, and can alleviate skin photoaging.

[0050] The skin microecological preparation provided by the present invention comprises a fermentation filtrate of Lactococcus lactis, and the fermentation filtrate may comprise a fermentation product filtrate or a bacterial fermentation lysate product filtrate.

[0051] The preparation method of the fermentation filtrate is as follows: inoculate Lactococcus lactis into a seed culture medium for culturing to obtain a seed solution; inoculate the seed solution into a fermentation culture medium for fermentation to obtain a fermentation solution; centrifuge the fermentation solution, filter and sterilize it to obtain a fermentation product filtrate.

[0052] The preparation method of the bacterial fermentation lysate filtrate is as follows: Lactococcus lactis is inoculated into a seed culture medium for culturing to obtain a seed solution; the seed solution is inoculated into a fermentation culture medium for fermentation, and after fermentation, the bacterial cells are crushed and centrifuged to obtain a bacterial fermentation lysate filtrate.

[0053] The skin microecological preparation provided by the present invention can be in the form of emulsion, aqueous solution, ointment, film or gel.

[0054] In Example 1, Example 2 and Verification Examples 1 to 6 of the present invention, all the raw materials and reagents used can be purchased from the market.

[0055] The present invention will be further described below in conjunction with embodiments:

[0056] Example 1 Isolation, purification and identification of strains (providing 16S)

[0057] The fecal samples were collected from college students in Wuhan. The collected fecal samples were diluted with sterile oxygen-free water, and the appropriate dilution was selected to be spread on MRS solid culture medium. The culture was anaerobically cultured at 37°C for 48 hours, and typical colonies were streaked on MRS solid culture medium 2-3 times to obtain pure colonies. The 16S rDNA molecular identification and the universal primers were used for the identification of the strains.

[0058] The upstream primer is 27F: AGAGTTTGATCCTGGCTCAG (as shown in SEQ ID NO: 1);

[0059] The downstream primer is 1492R:TACGGCTACCTTGTTACGACTT (as shown in SEQ ID NO: 2). After nucleotide sequence alignment in NCBI, the results showed a strain of Lactococcus lactis, named Lactococcus lactis JWA32 (Lactococcuslactis JWA32), which was deposited in the China Center for Type Culture Collection (CCTCC) on November 30, 2022.

[0060]

[0061] Example 2 Preparation of fermentation filtrate

[0062] The glycerol cryopreservation tube of the strain obtained in Example 1 was taken out of the -80°C refrigerator, placed at room temperature (25°C ± 5°C) to melt, and then the strain was picked up using an inoculation loop under a sterile environment, and streaked on an MRS solid plate, and cultured at 37°C for 48 hours. After observing the colony morphology on the plate to confirm that it was Lactococcus lactis and there was no contamination, a single bacterium on the plate was picked up and inoculated into the corresponding MRS liquid culture medium at a 10% inoculation amount, and placed in a 37°C incubator for static culture for 24h to 48h, until the bacterial solution grew turbid to obtain an activated bacterial solution (1×10 9 ~10 10 CFU / mL), the bacterial solution was transferred to the corresponding MRS fermentation medium at a 10% inoculation rate, placed in a 37°C incubator for 24 hours, and the lactococcus lactis culture was obtained after fermentation. The supernatant was obtained by centrifugation (speed 6000rpm, time 10min), and the supernatant was filtered and sterilized to obtain the fermentation filtrate. Verification Example 1 MTT method to detect the cell viability of the fermentation broth

[0063] After HaCaT cells were inoculated in a 96-well plate and cultured for 24 h, the supernatant was removed by aspiration, and different concentrations of fermentation filtrates of Lactococcus lactis JWA32 obtained in Example 2 were added and cultured for another 24 h. The cell survival rate was detected by the MTT method.

[0064] MTT method to detect cell survival rate: After cell treatment, discard the culture medium, add 100 μL of 5 mg / mL MTT working solution prepared in serum-free culture medium to each well, incubate at 37°C for 4 hours, discard the MTT working solution, add 100 μL DMSO to each well, shake at low speed for 10 minutes in the dark, and use an enzyme reader to measure the absorbance at 490 nm. Calculation formula: relative cell survival rate = An / A0 (Note: An is the absorbance value of the experimental group, and A0 is the absorbance value of the negative control group)

[0065] Table 1 Cell viability detected by MTT method

[0066] Group Cell viability Normal control (100 μL serum-free medium) 100％ 2.5% Fermentation filtrate 89.65％ 5% fermentation filtrate 92.27％ 7.5% Fermentation filtrate 109.58％ 10% fermentation filtrate 112.02％

[0067] Table 1 corresponds to Figure 1 data;

[0068] The results are as follows Figure 1 As shown in Table 1, according to the toxicity evaluation standard described in ISO 10993-5:2009, a cell survival rate higher than 70% can be defined as non-cytotoxic. After HaCaT cells were further cultured with fermentation filtrates of Lactococcus lactis JWA32 at different concentrations, there was no cytotoxicity, and at concentrations of 7.5% and 10%, the cell survival rate was higher than that of the control group, indicating that the fermentation filtrate at this concentration has a certain proliferation-promoting effect on HaCaT cells.

[0069] Verification Example 2 HaCaT keratinocyte ROS scavenging assay

[0070] Cells: Primary human keratinocytes HaCaT;

[0071] Materials: DCFH-DA, 3% hydrogen peroxide (H2O2) solution;

[0072] Stimulation conditions: Hydrogen peroxide (H2O2) induces an increase in the ROS content in keratinocytes. The concentration of hydrogen peroxide used is 120 μM and the treatment time is 1 hour. The quality standard that the test should meet is: the ROS content of the negative control under the action of the stimulant is increased by ≥30% compared with the ROS content of the blank / solvent control;

[0073] Positive control: 0.05% vitamin C (Vc).

[0074] Experimental method: 1×10 4 / well (200 μL) (the degree of fusion reaches 45%-60% 24 hours after inoculation) is inoculated into a 96-well plate. After the inoculation is completed, it is placed in a CO2 incubator for incubation for 24h±2h. The culture medium in each well of the well plate is discarded, and the experimental group is added with the culture medium containing the fermentation filtrate obtained in Example 2 of different concentrations prepared as above, the positive control well is added with the culture medium containing 0.05% concentration of Vc, and the blank control well and the model well are added with normal culture medium. After the addition of the sample is completed, the well plate is placed in a CO2 incubator for 24h±2h. After the incubation is completed, the liquid is not discarded. Except for the blank control, the remaining wells need to be induced with H2O2. The induction time of H2O2 is 1h, and the induction dose is 120μM. Discard the culture medium in the wells, wash three times with PBS, add 100 μL DCFH-DA working solution (sampling according to the instructions of the Bio-Tech Reactive Oxygen Detection Kit) to each well, incubate in a CO2 incubator for 30 minutes, and after the incubation, wash the cells in each well three times with serum-free DMEM. After the operation, place the 96-well plate on the detection platform of the fluorescent microplate reader, set the incident light wavelength to 525 nm, the excitation light wavelength to 488 nm, and read the readings.

[0075] Table 2 Reactive oxygen free radical ROS scavenging results (x±s, n=3)

[0076] Group ROS level (%) Blank control (DCFH-DA) 100％ <![CDATA[Model group (H2O2 induction + DCFH-DA)]]> <![CDATA[163.67±6.85% *** ]]> Positive control Vc 0.05% <![CDATA[131.33±3.30% ** ]]> 2.5% Experimental group <![CDATA[112.33±2.05% *** ]]> 5% experimental group <![CDATA[103.33±1.70% *** ]]> 10% experimental group <![CDATA[100.33±3.09% *** ]]>

[0077] Table 2 corresponds to Figure 2 data;

[0078] from Figure 2 and Table 2 and fluorescence microscope photography results Figure 3It can be seen that compared with the blank cell group, the ROS level in the model group was significantly increased, indicating that the H2O2-induced oxidative stress model of HaCaT cells was successfully established. Compared with the model group, the ROS level of the positive control group (Vc) was significantly weakened, indicating that the positive control group can reduce the excessive ROS free radicals in HaCaT cells. At the same time, the ROS level of HaCaT cells in the fermentation broth group of Lactococcus lactis JWA32 was also significantly weakened, indicating that it can reduce the ROS level of HaCaT cells in the oxidative stress model of HaCaT cells, thereby alleviating the oxidative damage of HaCaT cells.

[0079] Verification Example 3: Detection of Ceramide

[0080] (1) Cultivate Hacat cells: add 3×10 cells per well of a 96-well plate. 4 Cells were cultured in a volume of 200 μL / well at 37°C and 5% CO2 for 16 to 24 h (cell confluence reached 70%);

[0081] (2) Grouping and induction of cell models: Negative control: discard the supernatant and add 180 μL / well of fresh DMEM medium; Model group: discard the supernatant and add 180 μL / well of fresh medium containing 3 mg / mL SDS; Experimental group: discard the supernatant and add 180 μL / well of fresh medium containing 3 mg / mL SDS.

[0082] (3) Adding samples: negative control: adding 20 μL of PBS; model group: adding 20 μL of PBS; experimental group: adding 20 μL of the fermentation filtrate obtained in Example 2, and culturing at 37° C. and 5% CO 2 for 24 hours.

[0083] (4) Collect the cell culture supernatant by centrifugation at 7500 rpm for 10 min.

[0084] (5) ELISA kit to detect ceramide content

[0085] Standard sample addition: set standard sample wells and sample wells, add 50μL of standard sample of different concentrations to each standard sample well, and add 50μL of sample diluent to well 0;

[0086] Add sample: Set up blank wells (blank control wells do not add sample and enzyme-labeled reagent, and the rest of the steps are the same) and test sample wells. Add 50 μL of sample to the test sample well on the enzyme-labeled plate, add it to the bottom of the well, try not to touch the well wall, and gently shake to mix;

[0087] Add enzyme: add 100 μL of enzyme labeling reagent to each well, except for the blank well;

[0088] Incubation: Seal the plate with a sealing film and incubate at 37°C for 60 minutes;

[0089] Solution preparation: dilute the 20-fold concentrated washing solution with 20-fold distilled water for later use;

[0090] Washing: Carefully peel off the sealing film, discard the liquid, spin dry, fill each well with washing solution, let it stand for 60 seconds and then discard, repeat this 5 times, and pat dry;

[0091] Color development: First add 50 μL of color developer A to each well, then add 50 μL of color developer B, gently shake and mix, and develop color at 37°C in the dark for 15 minutes;

[0092] Stop: Add 50 μL of stop solution to each well to stop the reaction (the blue color immediately turns yellow);

[0093] Determination: Set the blank well to zero and measure the absorbance (OD value) of each well in sequence at a wavelength of 450 nm. The determination should be carried out within 15 minutes after adding the stop solution. 450 The values ​​were input into ELISA data processing software to obtain the data.

[0094] Table 3 Promotes ceramide secretion rate

[0095]

[0096] Table 3 corresponds to Figure 4 data;

[0097] The experimental results are as follows Figure 4 As shown in Table 3, compared with the model group, under the same culture conditions, the addition of the fermentation filtrate of Lactococcus lactis JWA32 of Example 2 can significantly promote the secretion of ceramide in HaCaT cells. Ceramide is an important component of human stratum corneum lipids, and has the effects of moisturizing, maintaining stratum corneum structure stability (adhesion), damage repair, etc. Its content affects the quality of skin barrier function, indicating that the fermentation filtrate prepared by the present invention can supplement skin stratum corneum lipids and enhance the epidermal barrier function of the skin barrier.

[0098] Verification Example 4 Determination of superoxide dismutase SOD

[0099] HaCaT cells in the logarithmic growth phase were cultured at 1×10 5The cells were inoculated with a density of 1 mL / mL in a 24-well plate, and then placed in a 5% CO2 incubator at 37°C for 24 hours. The culture medium was discarded, and the experiment was divided into a normal control group, a positive control group, a model group and a sample group. The fermentation filtrate obtained in Example 2 was added to the cell culture medium of each well of the sample group at a ratio of 10%, the positive control group added 1% Vc, and the normal control group and the model group added an equal volume of blank culture medium. After culturing for 24 hours, the cells were washed twice with PBS. A H2O2 solution with a final concentration of 60 μmol / L was added to the cell culture medium of the sample group, the positive control group and the H2O2 model group to induce oxidative stress damage in the cells. At the same time, an equal volume of DMEM medium without FBS was added to the cell culture medium of each well of the blank group and the normal control group. After continuing to cultivate for 1 hour, the cells were washed with PBS and repeated 3 times. The cells were lysed at 4°C for 10 minutes, the lysed cells were collected, and the supernatant was obtained according to the instructions of the kit. According to the operating method of the kit, the SOD activity was determined, and the protein concentration was determined by the BCA protein concentration determination method.

[0100] Table 4

[0101]

[0102] Table 4 corresponds to Figure 5 data;

[0103] From Table 4 and Figure 5 It can be seen that the 10% fermentation filtrate prepared in Example 2 has a significant difference compared with the normal control group, indicating that it can significantly increase the SOD enzyme activity in HaCaT cells compared with the normal control group.

[0104] Verification Example 5: Experiment on inhibiting harmful bacteria

[0105] Skin pathogens (10 7 -10 8 CFU / mL) was inoculated into a blank medium containing 10% of the test substance and cultured. After 24 hours, the number of pathogens in the medium or OD was detected. 600 The absorbance value at .

[0106] Test substance: Fermentation filtrate obtained in Example 2

[0107] Bacterial suspension 1: Take the Staphylococcus aureus culture solution that has been cultured to the logarithmic growth phase and dilute it with blank LB medium to obtain a suspension containing 10 6 CFU / mL of bacterial suspension.

[0108] Bacterial suspension 2: Take the bacterial suspension of Streptococcus albicans cultured to the logarithmic growth phase and dilute it with blank YPD medium to obtain a suspension containing 10 6 CFU / mL of bacterial suspension.

[0109] 10% of the test substance was added to bacterial suspensions 1 and 2 respectively, and the same volume of blank culture medium was added to the control group. The cells were cultured at 37°C, and the absorbance was measured at different time points of 0h, 15h, 19h, and 23h.

[0110] Inhibition rate (%) = 1-(OD 对照组 -OD 实验组 ) / OD 对照组 ×100%

[0111] like Figure 6 As shown, it is shown that the fermentation filtrate prepared in Example 2 has an effective inhibitory effect on Staphylococcus aureus and Candida albicans, and the inhibition rate after 23 hours can be maintained above 70%.

[0112] Verification Example 6 Inhibition of Hyaluronidase Activity

[0113] Hyaluronidase can indiscriminately hydrolyze the 1,4-bond between β-N-acetylglucosamine and D-glucuronate in hyaluronic acid to obtain β-N-acetylglucosamine. β-N-acetylglucosamine can condense with acetylacetone under alkaline conditions to generate the chromogen 2-methyl-3-diacetylpyrrole derivative. The chromogen reacts with p-dimethylaminobenzaldehyde in concentrated hydrochloric acid and ethanol to produce color.

[0114] Reagents: MRS, calcium chloride, citric acid, sodium citrate, hyaluronidase, sodium hyaluronate, acetylacetone, dopa, p-dimethylaminobenzaldehyde, calcium chloride, sodium hydroxide, concentrated hydrochloric acid, acetic acid, anhydrous ethanol. The reagents are configured as follows:

[0115] Prepare 0.2mol / L acetic acid and 0.2mol / L sodium acetate, take 4.8mL acetic acid and 45.2mL sodium acetate and mix them to prepare an acetate buffer (pH=5.6). Take 0.5mL of the fermentation filtrate prepared in Example 2 (10%) and 0.5mL hyaluronidase solution (hyaluronidase is dissolved in acetate buffer and prepared to a concentration of 500U / mL) and culture in a 37°C water bath for 20min; add 0.1mL of CaCl2 solution (2.5mol / L) and continue to keep warm at 37°C for 20min; add 0.5mL sodium hyaluronate (sodium hyaluronate is dissolved in acetate buffer and prepared to a concentration of 0.5mg / mL), continue to keep warm at 37°C for 40min, then take it out and place it at room temperature (25°C±5°C) for 10min; add 0.1mL NaOH solution (5 mol / L) and 0.5 mL of acetylacetone solution (3.5 mL of acetylacetone dissolved in 50 mL of 1 mol / L sodium carbonate) were placed in a boiling water bath for 15 min and then immediately transferred to an ice water bath for 10 min, and then placed at room temperature (25°C ± 5°C) for 10 min; 1.0 mL of P-DAB color developer (0.8 g of dimethylaminobenzaldehyde dissolved in 15 mL of concentrated hydrochloric acid, and then 15 mL of anhydrous ethanol was added and mixed evenly) was added dropwise, and diluted with 4.3 mL of anhydrous ethanol, and placed at room temperature (25°C ± 5°C) for 30 min to develop color, and the absorbance value at a wavelength of 530 nm was measured using a spectrophotometer.

[0116] Hyaluronidase inhibition rate (%) = [(CD) - (AB)] / (CD) × 100%

[0117] Among them, A is the absorbance value of the sample solution (hyaluronidase + sample + sodium hyaluronate), B is the absorbance value of the sample blank (acetate buffer + sample + acetate buffer), C is the absorbance value of the control solution (hyaluronidase + distilled water + sodium hyaluronate), and D is the absorbance value of the control blank (acetate buffer + distilled water + acetate buffer). The test results are shown in Tables 5 and Figure 7 As shown:

[0118] Table 5

[0119]

[0120] Table 5 corresponds to Figure 7 data;

[0121] Compared with the control MRS, the fermentation filtrate has significant hyaluronidase inhibition activity, with a hyaluronidase inhibition rate of up to about 94.71%, and can be used in anti-wrinkle functional daily chemical products.

[0122] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Lactococcus lactis JWA32, characterized in that Its deposit number is: CCTCCNo.M 20221851.

2. A microbial agent, characterized in that: Includes any of the following and acceptable adjuvants; (I), Lactococcus lactis JWA32 according to claim 1; and / or (II) the inactivated bacteria of Lactococcus lactis JWA32 according to claim 1; and / or (III) The fermentation broth, culture, exosomes, lysate or extract of Lactococcus lactis JWA32 according to claim 1.

3. The microbial agent according to claim 2, characterized in that The fermentation broth includes fermentation product filtrate or bacterial fermentation lysate filtrate.

4. The microbial agent according to claim 2 or 3, characterized in that The dosage form of the microbial agent includes: one or more of an emulsion, an aqueous solution, an ointment, a film or a gel.

5. The method for preparing the microbial agent according to any one of claims 2 to 4, characterized in that: The following steps are involved: S1: taking the lactococcus lactis and inoculating and culturing it to obtain a seed solution; S2: taking the seed liquid for fermentation and culturing, first centrifuging and filtering, collecting the supernatant, and obtaining the microbial agent; or The seed liquid is fermented and cultured, the bacterial bodies are broken, centrifuged and filtered for a second time, and the supernatant is collected to obtain the microbial agent.

6. Use of the Lactococcus lactis according to claim 1, the microbial agent according to any one of claims 2 to 4, or the microbial agent obtained by the preparation method according to claim 5 in preparing cosmetics that reduce ROS levels, inhibit hyaluronidase activity, increase ceramide secretion, or increase SOD enzyme activity.

7. Use of the Lactococcus lactis according to claim 1, the microbial agent according to any one of claims 2 to 4, or the microbial agent obtained by the preparation method according to claim 5 in preparing cosmetics for alleviating oxidative damage of HaCaT cells, repairing epidermal barriers or inhibiting harmful bacteria.

8. Use of the Lactococcus lactis according to claim 1, the microbial agent according to any one of claims 2 to 4, or the microbial agent obtained by the preparation method according to claim 5 in the preparation of antioxidant, anti-aging or anti-wrinkle cosmetics.

9. A cosmetic, characterized in that The method comprises the Lactococcus lactis according to claim 1, the microbial agent according to any one of claims 2 to 4, or the microbial agent obtained by the preparation method according to claim 5, and acceptable excipients or auxiliary agents.

Images