High-affinity nucleic acid aptamer that specifically recognizes CD8α molecules

By using SELEX technology, nucleic acid aptamers with high affinity and specific binding to CD8α molecules were screened out, which solved the defects of existing antibody technology, achieved efficient and specific binding to CD8α molecules, reduced production costs and improved detection efficiency.

CN115927342BActive Publication Date: 2025-09-23XINJIANG MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210800327.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-08
Publication Date
2025-09-23
Estimated Expiration
2042-07-08

AI Technical Summary

Technical Problem

Existing antibody technology has problems such as immunogenicity, poor stability, high cost and large batch-to-batch variability in the application of targeting CD8 molecules, and it is necessary to find alternative molecules to improve application efficiency.

Method used

The SELEX technology is used to screen out single-stranded DNA molecule nucleic acid aptamers that bind to human CD8α molecules with high affinity and specificity, and apply them to the kit. Through the nucleic acid aptamer sequence 1 provided in the patent specification, it is used to detect or capture CD8α protein and CD8-positive expressing cells.

Benefits of technology

It achieves efficient and specific binding to CD8α molecules, solves the technical problems of antibodies in the existing technology, realizes the technical problems of antagonism, provides high affinity and specific binding, reduces production costs, and improves detection and separation efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003737322610000071
    Figure BDA0003737322610000071
  • Figure HDA0003737322620000011
    Figure HDA0003737322620000011
  • Figure HDA0003737322620000012
    Figure HDA0003737322620000012
Patent Text Reader

Abstract

The present invention discloses a high-affinity nucleic acid aptamer that specifically recognizes CD8α molecules. The present invention provides a nucleic acid aptamer, which is as follows 1) or 2): 1) a single-stranded DNA molecule shown in sequence 1; 2) connecting a signal molecule and / or an active molecule and / or a functional group and / or a radioactive nuclide to one end or the middle of the single-stranded DNA molecule shown in 1) to obtain a nucleic acid aptamer with the same function as the nucleic acid aptamer. The present invention screens out a nucleic acid aptamer sequence that can bind to CD8α molecules with high affinity and specificity, and the sequence can bind to human CD8α molecules or CD8 + It binds to cells with high affinity and specificity. In practical applications, it can replace existing antibody technology for CD8 + Lymphocyte count, targeted CD8 + Construction of drug delivery system for lymphoma and isolation of high-purity CD8 from peripheral blood + Lymphocytes are used to construct CAR-T cell therapy and other applications.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a high-affinity nucleic acid aptamer that specifically recognizes CD8α molecules. Background Art

[0002] CD8 (Clusters of Differentiation 8), also known as T lymphocyte differentiation antigen 8, is a glycoprotein mainly expressed on the surface of cytotoxic T lymphocytes and some natural killer (NK) cells. It is one of the key molecules that regulates the development, maturation and activation of lymphocytes. + Cytotoxic T lymphocytes are an important cell subset in the body's cellular immune system to fight against tumors, chronic infections and other diseases. + Lymphocyte dysfunction can also lead to autoimmune diseases.

[0003] The natural CD8 molecule is a dimer, consisting of an α subunit (molecular weight approximately 34-37 kDa) and a β subunit (molecular weight approximately 32 kDa) to form a homodimer (CD8αα) or heterodimer (CD8αβ). In addition to being a marker for lymphocyte typing, the important biological function of the CD8 molecule is that when the TCR on the surface of T lymphocytes recognizes the MHC-I:peptide complex (pMHC), it binds to the α3 subunit of the MHC molecule as a co-receptor, enhancing the affinity and stability of the binding between the TCR and the MHC-I:peptide complex (pMHC). At the same time, the intracellular region of the CD8 molecule α subunit can recruit p56 lck Tyrosine kinase, which induces T cell activation and proliferation through tyrosine phosphorylation of the TCR / CD3 complex. This process is the CD8 + The molecular biological basis of cytotoxic T lymphocyte activation, proliferation, and subsequent specific killing function.

[0004] At present, the application of CD8 molecules mainly focuses on the following aspects: (1) CD8 + Lymphocyte count (usually combined with CD4 + Lymphocytes) to evaluate the body's immune status and the effects of anti-tumor or anti-infection drugs or treatments; (2) autoimmune diseases or transplant rejection reactions; and one of the current research hotspots, (3) using CD8 antibody immunomagnetic beads to separate human peripheral blood CD8+ lymphocytes and construct CAR-T (Chimeric Antigen Receptor T-Cell) cells through in vitro genetic engineering methods for the treatment of tumors or related diseases. This therapy has achieved remarkable results in blood tumors.

[0005] At the technical level, current research on CD8 molecules and their positively expressing cells primarily utilizes antibody technology. Although antibodies, as star products in the field of molecular targeting technology, have been widely used in many fields, antibody technology itself has some inherent shortcomings, such as immunogenicity, poor physical and chemical stability, difficulty in chemical modification, high variability between product batches, and high production costs. Therefore, the search for new targeting molecules (technologies) that can replace antibodies remains an urgent need in biological and medical applications.

[0006] Aptamers generally refer to a ssDNA or RNA sequence with a 3D structure that can bind to a target with high affinity and specificity. Aptamers are oligonucleotide fragments obtained from a large-capacity random nucleic acid molecule library using an in vitro screening technology, namely, systematic evolution of ligands by exponential enrichment (SELEX). Compared with antibodies, aptamers have many advantages in application, such as high affinity and high specificity when binding to the target; aptamers have a small molecular weight, can easily penetrate tissues and be quickly internalized into cells; aptamers obtained by screening are easy to synthesize in large quantities in vitro, with good reproducibility, high stability, easy storage and low production cost; at the same time, aptamers are easy to chemically modify and their activity is not affected. In summary, aptamers are a type of targeting molecule with great clinical application value. Summary of the Invention

[0007] One object of the present invention is to provide a nucleic acid aptamer.

[0008] The nucleic acid aptamer provided by the present invention is as follows 1) or 2):

[0009] 1) The single-stranded DNA molecule shown in Sequence 1;

[0010] 2) Connecting a signal molecule and / or an active molecule and / or a functional group and / or a radioactive nuclide to one end or the middle of the single-stranded DNA molecule shown in 1) to obtain a nucleic acid aptamer having the same function as the nucleic acid aptamer.

[0011] Among the above-mentioned nucleic acid aptamers, the nucleic acid aptamer shown in 2) is a single-stranded DNA molecule shown in sequence 1, with the 5' end or 3' end thereof labeled with a fluorescent group, a biotin group or a radioactive nuclide.

[0012] The application of the above-mentioned nucleic acid aptamer in any of the following or in the preparation of a product having any of the following functions is also within the scope of protection of the present invention:

[0013] 1) Detecting or capturing CD8α protein;

[0014] 2) Specific binding to CD8α protein;

[0015] 3) detecting or capturing cells expressing CD8 positively;

[0016] 4) Specific binding to cells expressing CD8;

[0017] 5) detecting or capturing cells expressing CD8 positively in lymphocytes;

[0018] 6) Detecting or capturing cells expressing CD8 positive in the sample to be tested.

[0019] In the above application, the sample to be tested is peripheral blood or lymphocytes derived from peripheral blood.

[0020] Another object of the present invention is to provide a kit.

[0021] The kit provided by the present invention includes the above-mentioned nucleic acid aptamer and may also include a CD8 protein antibody.

[0022] The above kit has any of the following functions:

[0023] 1) Detecting or capturing CD8α protein;

[0024] 2) Specific binding to CD8α protein;

[0025] 3) detecting or capturing cells expressing CD8 positively;

[0026] 4) Specific binding to cells expressing CD8;

[0027] 5) detecting or capturing cells expressing CD8 positively in lymphocytes;

[0028] 6) Detecting or capturing cells expressing CD8 positive in the sample to be tested.

[0029] In the above kit, the sample to be tested is peripheral blood or lymphocytes derived from peripheral blood.

[0030] The present invention uses human CD8α molecule as the target and uses SELEX technology to screen out a nucleic acid aptamer sequence (named Sequence 1 (Seq 1)) that can bind to CD8α molecule with high affinity and specificity. Its sequence information and secondary structure characteristics are shown in Figure 1 ), which can interact with human CD8α molecule or CD8 + It binds to cells with high affinity and specificity. In practical applications, it can replace existing antibody technology for CD8 + Lymphocyte count (immune status assessment), targeted CD8 + Construction of drug delivery system for lymphoma and isolation of high-purity CD8 from peripheral blood +Lymphocytes are used to construct CAR-T cell therapy and other applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The sequence information and secondary structure characteristics of Seq 1 (predicted by mFold online analysis software).

[0032] Figure 2 Flow cytometry and dot blot were used to identify the binding of Seq 1 and CD8α protein.

[0033] Figure 3 Flow cytometry was used to identify the binding of Seq 1 to CD8-positive cells.

[0034] Figure 4 Seq 1 for peripheral blood CD8 + Detection of lymphocytes.

[0035] Figure 5 A3 aptamer for peripheral blood CD8 + Detection of lymphocytes. DETAILED DESCRIPTION

[0036] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0037] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0038] Example 1. Screening and identification of nucleic acid aptamers that bind to CD8α molecules with high affinity and specificity

[0039] 1. Screening of CD8α nucleic acid aptamers by SELEX method and sequence feature analysis

[0040] Recombinant human CD8α protein (Sino Biological, Cat: 10980-H08H) was used as the screening target. The nucleic acid starting screening library was 5'-CCTTGGGCGTCTATCGTGAG-N40-GATGCCTCAGAACTACCACGG-3' (10 nmol, synthesized by Shanghai Sangon Biotechnology Co., Ltd.). After five rounds of screening, the enriched library was sent to Shanghai Sangon Biotechnology Co., Ltd. for high-throughput sequencing, and the sequencing results were arranged according to abundance.

[0041] The results showed that the abundance of one sequence was as high as 35.9%, which was named sequence 1. Its sequence information is as follows (the underlined parts are the 5' and 3' constant region sequences, and the rest are the core region sequences):

[0042] Sequence 1:

[0043] CCTTGGGCGTCTATCGTGAGCGGGCGCCTTCGCGTGAGGAGCTTGAAATCCAGGCACACG GATGCCTC AGAACTACCACGG ( Figure 1 As shown, the figure shows seq1, the horizontal line is the constant region, and the others are core regions)

[0044] At the same time, the nucleic acid sequence of sequence 1 was compared with other sequences in the sequencing library, and a 19-nt consensus sequence (consensus sequence) was found in a few sequences (abundance <0.2%), which also existed in sequence 1: CGTGAGGAGCTTGAAATCC (sequence 3). A low-abundance sequence (sequence 2, abundance of 0.04%) was selected as a research control.

[0045] Sequence 2:

[0046] CCTTGGGCGTCTATCGTGAG ATAAAAGCGTGAGGAGCTTGAAATTCGGATTCCATTTAGT GATGCCTC AGAACTACCACGG .

[0047] At the same time, a negative control sequence was designed to serve as a negative control in subsequent experiments. Based on the sequence 1, its core sequence (40 nt) was replaced with a reverse sequence and named Ctrl sequence: Ctrl sequence (sequence 4):

[0048] CCTTGGGCGTCTATCGTGAGGCACACGCACCTAAAGTTCGAGGAGTGCGCTTCCGCGGGCGATGCCTCAGAACTACCACGG

[0049] II. Analysis of the binding specificity between the nucleic acid aptamer shown in SEQ ID NO: 1 and CD8α protein

[0050] 1. Flow cytometry analysis

[0051] First, flow cytometry was used to analyze whether the nucleic acid aptamer shown in sequence 1 could specifically bind to the CD8α protein. At the same time, the control sequence shown in sequence 2, the consensus sequence shown in sequence 3, and the negative control sequence (Ctrl sequence) shown in sequence 4 were also analyzed to see whether they could bind to the CD8α protein.

[0052] The nucleic acid aptamer shown in sequence 1, the control sequence shown in sequence 2, the consensus sequence shown in sequence 3, and the negative control sequence shown in sequence 4 were all synthesized by Shanghai Sangon Biotechnology Co., Ltd. and modified with biotin at the 5' end.

[0053] Each of the biotin-modified sequences synthesized above was dissolved in PBS containing 1 mM magnesium ions, denatured at 95° C. for 5 min, and then rapidly cooled on ice for 10 min to obtain the denatured nucleic acid sequence for later use.

[0054] The PBS buffer containing 1 mM magnesium ions is a solution obtained by adding magnesium chloride to a PBS solution of pH 7.4 to adjust the magnesium ion concentration to 1 mM.

[0055] 5 μg of 6×histidine-tagged CD8α protein (product of Sino Biological) was incubated with 10 μL of Ni-sepharose agarose beads (34 μm diameter, product of Cytiva) for 30 minutes and then washed twice with PBS (containing 1 mM magnesium ions) as the detection target, namely the CD8α protein-immobilized Ni-sepharose agarose beads.

[0056] The denatured nucleic acid sequences prepared above were adjusted to a working concentration of 10 nM using PBS containing 1 mM magnesium ions. The beads were reacted with 1 μL of CD8α protein-immobilized Ni-sepharose agarose beads for 30 minutes, washed twice with PBS containing 1 mM magnesium ions, and streptavidin-PE (CST) was added to continue the reaction for 15 minutes. The beads were washed twice with PBS containing 1 mM magnesium ions, and the fluorescence signal was detected by flow cytometry (BD bioscience, FACS Verse).

[0057] See the results Figure 2 a. As can be seen from the figure, compared to the blank control (Ni-sepharose agarose beads immobilized with CD8α protein only), the nucleic acid aptamer represented by biotin modified sequence 1 binds to CD8α protein and displays a high fluorescence intensity value (MFI). The control sequence represented by biotin modified sequence 2 also binds to CD8α protein with a certain fluorescence signal, but it is significantly lower than the nucleic acid aptamer represented by biotin modified sequence 1. The consensus sequence represented by biotin modified sequence 3 and the negative control sequence represented by biotin modified sequence 4 do not produce any fluorescence signal when bound to CD8α protein. This indicates that the nucleic acid aptamer represented by sequence 1 can bind to CD8α protein with high affinity. Although the control sequence represented by sequence 2 can also bind to CD8α protein, the affinity is significantly lower. Neither the consensus sequence represented by sequence 3 nor the negative control sequence represented by sequence 4 can bind to CD8α protein.

[0058] 2. Dot Blot Analysis

[0059] The specificity of binding of the nucleic acid aptamer represented by biotin modified sequence 1 and the negative control sequence represented by biotin modified sequence 4 to CD8α protein was analyzed.

[0060] The experiment is divided into four reaction systems:

[0061] (1) Nucleic acid group: The reaction system was 20 μL, containing a final concentration of 1 nM of the biotin-modified nucleic acid aptamer represented by sequence 1 or the negative control sequence represented by sequence 4, and the balance was PBS containing 1 mM magnesium ions;

[0062] (2) Nucleic acid + CD8α group: The reaction system was 20 μL, containing a final concentration of 1 nM of the nucleic acid aptamer represented by biotin-modified sequence 1 or the negative control sequence represented by biotin-modified sequence 4, 1 μg of recombinant protein CD8α, and the balance of PBS containing 1 mM magnesium ions;

[0063] (3) Nucleic acid + human serum albumin (HSA) group: The reaction system was 20 μL, containing a final concentration of 1 nM of the biotin-modified nucleic acid aptamer represented by sequence 1 or the negative control sequence represented by biotin-modified sequence 4, 1 μg of human serum albumin (HAS, Sino Biological, cat. no. 13500-H08H), and the balance was PBS containing 1 mM magnesium ions;

[0064] (4) Nucleic acid + PD-L1 group: The reaction system was 20 μL, containing a final concentration of 1 nM of the nucleic acid aptamer shown in sequence 1 modified with biotin or the negative control sequence shown in sequence 4 modified with biotin, 1 μg of PD-L1 (product of Sino Biological, cat no. 10084-H08H), and the remainder was PBS containing 1 mM magnesium ions.

[0065] The above reaction systems were reacted at room temperature for 30 minutes to obtain reaction products.

[0066] After the reaction was completed, all the reaction products were transferred to the NC membrane (product of Cytiva) using a dot blot instrument. The NC membrane was blocked and reacted with streptavidin-HRP (product of Aibixin), and finally developed with ECL (product of Biyuntian) and exposed.

[0067] See the results Figure 2As shown in Figure 2, four reaction systems were set up for sequence 1 and sequence 4 respectively. Group (1) is a simple nucleic acid group without protein (marked as 0), which is mainly used to verify whether the nucleic acid aptamer shown in sequence 1 and the negative control sequence shown in sequence 4 will be non-specifically adsorbed on the NC membrane and cause false positive color development; Group (2) is a CD8α protein group, which is used to verify that the nucleic acid aptamer shown in sequence 1 can specifically bind to CD8α protein, while the negative control sequence shown in sequence 4 should not bind to CD8α as a negative control sequence; HSA (the most abundant protein in the human body) in group (3) and PD-L1 protein in group (4) are used as non-specific targets to verify whether the nucleic acid aptamer shown in sequence 1 and the negative control sequence shown in sequence 4 will bind to non-specific target proteins; it can be seen that except for the color development signal of sequence 1+CD8α protein, there is no color development signal in other groups, which also confirms that the binding of the nucleic acid aptamer shown in sequence 1 to CD8α protein is specific, and further confirms that sequence 4 will not non-specifically bind to other proteins and can be used as a negative control for subsequent experiments.

[0068] 3. Analysis of binding of nucleic acid aptamer sequence 1 to CD8-positive cells

[0069] Although the above experimental section has confirmed that the screened nucleic acid aptamer shown in sequence 1 can specifically bind to human recombinant CD8α protein, in actual applications, CD8-positive expressing cells are often used as research objects. Moreover, compared with recombinant proteins, the physical and chemical environment of the cell membrane surface is more complex, and higher requirements are placed on the specificity and affinity of the binding of nucleic acid aptamers to target molecules. Therefore, two tumor cell lines, MOLT-4 (CD8+) and HEL (CD8-), were selected to use flow cytometry to verify whether sequence 1 can bind to CD8 molecules in their natural state. At the same time, the control sequence shown in sequence 2, the consensus sequence shown in sequence 3, and the negative control sequence shown in sequence 4 were further analyzed to see whether they can bind to CD8-expressing cells.

[0070] The nucleic acid aptamer shown in sequence 1, the control sequence shown in sequence 2, the consensus sequence shown in sequence 3, and the negative control sequence shown in sequence 4 were all synthesized by Shanghai Sangon Biotechnology Co., Ltd. and modified with biotin at the 5' end.

[0071] The details are as follows:

[0072] MOLT-4 cells (human acute lymphoblastic leukemia cell line, ATCC product, CRL-1582) and HEL cells (human erythroblastic leukemia cell line, ATCC product, TIB-180) in the logarithmic growth phase (detected by flow cytometry with FITC-labeled human CD8α antibody (Thermofisher Scientific product, cat no. 11-0088-42); MOLT-4 cells are a CD8α-high expression cell line, while HEL cells are a CD8α-negative expression cell line).

[0073] MOLT-4 cells and HEL cells were washed twice with PBS (containing 1 mM magnesium ions) and then added into the following reaction system (total system was 200 μL): 5×10 4 MOLT-4 cells or HEL cells, the nucleic acid aptamer shown in biotin-modified sequence 1, the control sequence shown in biotin-modified sequence 2, the consensus sequence shown in biotin-modified sequence 3, or the negative control sequence shown in biotin-modified sequence 4 (final concentration of 10 nM), and the balance being PBS buffer containing 1 mM magnesium ions, and the reaction was carried out for 30 minutes;

[0074] The reaction product was then washed twice with PBS buffer containing 1 mM magnesium ions, and then streptavidin-PE (CST product) was added at a ratio of 1:3000 (volume ratio) and the reaction was continued for 15 minutes. After washing twice with PBS buffer containing 1 mM magnesium ions, the binding of the above nucleic acid sequence to the two cells was detected by flow cytometry (BD bioscience, FACS Verse).

[0075] See the results Figure 3 As shown, in this experiment, the CD8 positive expression cell line MOLT-4 ( Figure 3 a) and CD8 negative expression cell line HEL ( Figure 3 b) As detection targets, the binding and binding specificity of the nucleic acid aptamer represented by sequence 1, the control sequence represented by sequence 2, the consensus sequence represented by sequence 3, and the negative control sequence represented by sequence 4 to CD8-expressing cells were analyzed respectively; the results showed that the nucleic acid aptamer represented by sequence 1 could bind well to the CD8-positive cell line MOLT-4, displaying high fluorescence density values, but did not bind to the CD8-negative cell line HEL; whereas the nucleic acid aptamer represented by sequence 2, the consensus sequence represented by sequence 3, and the negative control sequence represented by sequence 4 did not bind to either MOLT-4 or HEL cells, with fluorescence density values ​​close to the cell background (Blank).

[0076] This further illustrates that the screened nucleic acid aptamer sequence 1 can specifically bind to the natural CD8 molecule and be used to screen or identify CD8-positive expression cells. At the same time, sequence 4 can be used as a negative control for subsequent experiments.

[0077] IV. Determination of the binding affinity (Kds) of the nucleic acid aptamer shown in sequence 1 to CD8α protein and CD8+ expressing cells

[0078] The mean fluorescence intensity (MFI) of the nucleic acid aptamer shown in sequence 1 at different concentrations binding to CD8α protein or CD8 positive expression cells was determined by flow cytometry, and the binding affinity of the nucleic acid aptamer shown in sequence 1 to CD8α protein or CD8 positive expression cells was calculated. + Express cell binding affinity (Kds). Details are as follows:

[0079] To determine the binding affinity between the nucleic acid aptamer shown in Sequence 1 and the CD8α protein, 5 μg of 6×histidine-tagged CD8α protein (product of Sino Biological Shenzhou Co., Ltd.) was incubated with 10 μL of Ni-sepharose agarose beads (34 μm diameter, product of Cytiva) for 30 minutes. The beads were then washed twice with PBS buffer containing 1 mM magnesium ions to serve as the detection target, i.e., CD8α protein-immobilized Ni-sepharose agarose beads.

[0080] To determine the binding affinity between the nucleic acid aptamer shown in sequence 1 and CD8 positive cells, 5×10 6 MOLT-4 cells in the logarithmic growth phase were washed twice with PBS (containing 1 mM magnesium ions) and used as detection targets.

[0081] The biotin-modified aptamer represented by sequence 1 was adjusted to a working concentration of 25, 12.5, 6.25, 3.125, 1.6, 0.8, 0.4, 0.2, 0.1, and 0.05 (nM) using PBS buffer containing 1 mM magnesium ions, and then mixed with 0.8 μL of the CD8α protein-immobilized Ni-sepharose beads prepared above, or 3×10 4 MOLT-4 cells were reacted for 30 minutes, washed twice with PBS buffer containing 1 mM magnesium ions, and then streptavidin-PE (CST product) was added at a ratio of 1:3000 and continued to react for 15 minutes. After washing twice with PBS buffer containing 1 mM magnesium ions, the mean fluorescence density was detected by flow cytometry (BD bioscience, FACSVerse). Kds was calculated using the formula Y = Bmax X / (Kd + X). The experiment was repeated three times.

[0082] Table 1 shows the sequence 1 and CD8α protein or CD8 + Expressing cell binding affinity

[0083]

[0084] The results are shown in Table 1, and it can be seen that the nucleic acid aptamer shown in Sequence 1 has high affinity to both CD8α protein and MOLT-4 cells expressing CD8α protein.

[0085] 5. The nucleic acid aptamer shown in sequence 1 is used for peripheral blood CD8+ lymphocyte detection

[0086] In order to further verify whether the nucleic acid aptamer shown in sequence 1 can be used in human peripheral blood CD8 + For lymphocyte detection, 10 mL of human peripheral blood (normal human peripheral blood, with the informed consent of the subjects) was separated with human lymphocyte separation solution (product of Tianjin Haoyang Biological Products Technology Co., Ltd.) to obtain total lymphocytes, which were then washed twice with PBS (containing 1 mM magnesium ions) as the detection specimen.

[0087] Flow cytometry was used to detect the proportion of CD8+ lymphocytes in human peripheral blood, which were divided into five groups:

[0088] (1) FITC-labeled CD8 antibody (product of Thermo Fisher Scientific) was used as a positive control: the reaction system was 200 μL, with 3×10 total lymphocytes. 4 FITC-labeled CD8 antibody was added at a dilution of 1:2000, and the remainder was PBS (containing 1 mM magnesium ion) as the reaction buffer;

[0089] (2) Negative control sequence 4 single staining group (5' end biotin modified, final concentration of 10nM): the reaction system was 200μL, with 3×10 total lymphocytes 4 The negative control shown in sequence 4 was prepared by adding biotin modified with a final concentration of 10 nM, and the remainder was PBS buffer containing 1 mM magnesium ions;

[0090] (3) CD8 antibody + negative control sequence 4 double staining group: the reaction system is 200 μL, with 3×10 total lymphocytes 4 A negative control shown in sequence 4, FITC-labeled CD8 antibody was added at a dilution of 1:2000 to a final concentration of 10 nM biotin-modified, and the remainder was PBS buffer containing 1 mM magnesium ions;

[0091] (4) Sequence 1 single staining group (5' end biotin modified, final concentration of 10 nM): The reaction system was 200 μL, with 3×10 total lymphocytes 4The final concentration is 10 nM biotin-modified nucleic acid aptamer of sequence 1, and the remainder is PBS buffer containing 1 mM magnesium ion;

[0092] (5) CD8 antibody + sequence 1 double staining group: the reaction system is 200 μL, with 3×10 total lymphocytes 4 FITC-labeled CD8 antibody was added at a dilution of 1:2000 to a final concentration of 10 nM biotin-modified nucleic acid aptamer of sequence 1, and the remainder was PBS buffer containing 1 mM magnesium ions;

[0093] After the five groups reacted for 30 minutes, they were washed twice with PBS buffer containing 1 mM magnesium ions. Except for group (1), streptavidin-PE was added to the other four groups at a ratio of 1:3000 and the reaction was continued for 15 minutes. After washing twice with PBS buffer containing 1 mM magnesium ions, the proportion of CD8+ lymphocytes was detected by flow cytometry (BD bioscience, FACS Verse).

[0094] See the results Figure 4 The total human peripheral blood lymphocytes were detected by FITC-labeled CD8 antibody (group (1)). + Lymphocytes account for about 36.9% ( Figure 4 -(1)). As negative controls (Group (2) and (Group (3)), the Ctrl sequence barely binds to human peripheral blood lymphocytes ( Figure 4 -(2), Figure 4 -(3)), while sequence 1 single staining group (group (4)) can separate CD8 + The proportion of lymphocytes was 42.5%, and the detection efficiency was higher than that of CD8 antibody ( Figure 4 -(4)), and the ratio of CD8+ lymphocytes separated from the sequence 1+CD8 antibody double staining group (group (5)) was 35.7% ( Figure 4 -(5)), which is close to the separation ratio of the CD8 antibody single staining group. At the same time, this result also suggests that the binding site of sequence 1 with CD8α protein is different from that of CD8 antibody, and there is no epitope competition relationship.

[0095] Based on the above results, it can be concluded that sequence 1 has the same (or better) clinical application potential as CD8 antibodies, can replace CD8 antibodies for human peripheral blood CD8+ lymphocyte analysis, and can also be used in existing CD8 molecule or cell-based related research and applications.

[0096] Comparative Example: CD8 nucleic acid aptamer disclosed in the prior art

[0097] The control A3 aptamer sequence was artificially synthesized (its sequence information is as follows: ATCCAGAGTGACGCAGCAACAGAGGTGTAGAAGTACACGTGAACAAGCTTGAAATTGTCTCTGACAGAGG TGGACACGGTGGCTTAGT (SEQ ID NO: 5) ) and biotin-modified at the 5' end.

[0098] (1) A3 aptamer single staining group (5' end biotin modified, final concentration of 10 nM): The reaction system was 200 μL, in which the total lymphocytes obtained above were 3×10 4 The final concentration was 10 nM biotin-modified nucleic acid aptamer A3 of sequence 5, and the remainder was PBS (containing 1 mM magnesium ion) as the reaction buffer;

[0099] (2) CD8 antibody + A3 aptamer double staining group: The reaction system was 200 μL, with 3×10 total lymphocytes 4 FITC-labeled CD8 antibody was added at a dilution of 1:2000, with a final concentration of 10 nM biotin-modified nucleic acid aptamer A3 shown in sequence 5, and the remainder was PBS (containing 1 mM magnesium ion) as the reaction buffer;

[0100] After 30 minutes of reaction, the cells were washed twice with PBS buffer containing 1 mM magnesium ions, and then streptavidin-PE was added at a ratio of 1:3000 to continue the reaction for 15 minutes. After washing twice with PBS buffer containing 1 mM magnesium ions, the proportion of CD8+ lymphocytes was detected by flow cytometer (BD bioscience, FACS Verse).

[0101] See the results Figure 5 It can be seen that the proportion of CD8+ lymphocytes in human peripheral blood detected by A3 aptamer single staining group is 34.8%, which is lower than Figure 4 Sequence 1 (42.5%) in the double staining group with CD8 antibody detected the proportion of human peripheral blood CD8+ lymphocytes to be 24.8%, which is also lower than Figure 4 The sequence 1 and CD8 antibody double staining group (35.7%), which shows that the working efficiency of sequence 1 is higher than that of A3 aptamer.

Claims

1. A nucleic acid aptamer, comprising: 1) The single-stranded DNA molecule shown in Sequence 1; 2) The 5' end or 3' end of the single-stranded DNA molecule shown in sequence 1 is labeled with a fluorescent group, a biotin group or a radioactive nuclide to obtain a nucleic acid aptamer.

2. Use of the nucleic acid aptamer according to claim 1 in the preparation of a product having any of the following functions: 1) Detecting or capturing CD8α protein; 2) Specific binding to CD8α protein; 3) detecting or capturing cells expressing CD8 positively; 4) Specific binding to cells expressing CD8; 5) detecting or capturing cells expressing CD8 positively in lymphocytes; 6) Detecting or capturing cells expressing CD8 positive in the sample to be tested.

3. The use according to claim 2, characterized in that: The sample to be tested is peripheral blood or lymphocytes derived from peripheral blood. A kit comprising the nucleic acid aptamer according to claim 1 .

5. The kit according to claim 4, wherein: The kit also includes a CD8 protein antibody.

6. The kit according to claim 4 or 5, characterized in that: The kit has any of the following functions: 1) Detecting or capturing CD8α protein; 2) Specific binding to CD8α protein; 3) detecting or capturing cells expressing CD8 positively; 4) Specific binding to cells expressing CD8; 5) detecting or capturing cells expressing CD8 positively in lymphocytes; 6) Detecting or capturing cells expressing CD8 positive in the sample to be tested.

7. The kit according to claim 6, wherein: The sample to be tested is peripheral blood or lymphocytes derived from peripheral blood.