A method for detecting miRNA using photonic crystal chip and recombinase polymerase amplification

Through photonic crystal chips and recombinase polymerase amplification technology, the complex and time-consuming problem of existing miRNA detection methods is solved, and high-throughput, high-sensitivity serum miRNA detection is achieved, suitable for rapid and flexible cancer diagnosis.

CN115927554BActive Publication Date: 2025-08-08WUHAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210815346.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-08
Publication Date
2025-08-08
Estimated Expiration
2042-07-08

AI Technical Summary

Technical Problem

In clinical applications, existing miRNA detection methods have expensive equipment, complex preprocessing, time-consuming and cannot achieve fast, flexible and economical testing. Especially in the detection of low-level miRNAs in body fluids, it is difficult to achieve high sensitivity and cannot meet the needs of cancer diagnosis.

Method used

Using photonic crystal chips and recombinase polymerase amplification technology, the photonic crystal chips were prepared, and the probe was used to pair with the target miRNA complementarily and then the SplintR ligase was ligated, combined with the recombinase amplification reaction, and detected in the fluorescence measurement device using Super GelBlue dye to achieve signal amplification.

Benefits of technology

High-throughput and high-sensitivity miRNA detection is achieved, with a detection limit as low as 0.24aM. It can complete quantitative detection of circulating miRNA in serum within 2 hours. It has ultra-high sensitivity and rapidity, and is suitable for direct detection of actual samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115927554B_ABST
    Figure CN115927554B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for detecting miRNA by using a photonic crystal chip and recombinase polymerase amplification, which belongs to the field of nucleic acid detection. The method of the present invention comprises the following steps: preparing a photonic crystal chip; using two probes to complementarily pair with the target miRNA and then connecting them using SplintR ligase; using the connection product as a template, introducing primers, and causing a recombinase amplification reaction under the action of the recombinase; adding Super GelBlue dye to the recombinase amplification product, dropping it on the photonic crystal chip, and detecting it using a fluorescence measurement device. The method of the present invention has ultra-high sensitivity. Under optimal experimental conditions, the detection limit of miRNA in this method is as low as 0.24aM. The present invention does not require the separation and extraction of circulating miRNA and can be directly used for high-throughput rapid quantitative detection of circulating miRNA in serum samples.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of nucleic acid detection, and in particular relates to a method for rapid detection of miRNA using a photonic crystal chip and recombinase polymerase amplification for high throughput and high sensitivity. Background Art

[0002] miRNA is a short (approximately 20 bases) non-coding RNA. Studies have shown that changes in its content in the body are closely associated with the development of cancer. These changes have been observed in tumors at various locations, making it a recognized therapeutic target and a relatively new class of disease biomarkers and diagnostic markers. Traditional miRNA detection methods, such as RT-PCR, microarrays, and second-generation sequencing, are often limited to expensive and sophisticated laboratory instruments, complex pre-processing, and time-consuming processes. These methods fail to meet the simple, portable, flexible, rapid, and cost-effective diagnostic requirements of clinical applications.

[0003] Clinical cancer diagnosis still relies heavily on direct sampling from tumor tissue. While this diagnostic method guarantees accuracy, its high invasiveness and irreversible damage to living organisms limit its practical clinical application. In contrast, body fluids (plasma, serum, sweat, and urine) are easily collected and present in large quantities, allowing for the diagnosis of specific pathological conditions. Therefore, the use of circulating miRNAs in serum as cancer biomarkers for diagnosis has garnered widespread attention. However, the low levels of miRNAs in body fluids and their difficulty in extraction mean that this detection method is fraught with challenges.

[0004] Recombinase polymerase amplification (RPA) is considered a nucleic acid detection technology that can replace PCR. The protein-DNA complex formed by the combination of recombinase and primers can search for homologous sequences in double-stranded DNA. Once the primers locate the homologous sequence, a strand exchange reaction occurs, initiating DNA synthesis. The target region on the template is amplified by constant temperature, achieving signal amplification. While maintaining sensitivity, the reaction time is shortened to 5 minutes, enabling rapid detection of miRNAs with minimal equipment. Although RPA-based detection methods are widely used due to their short reaction time and high performance, they are still limited in detecting trace amounts of miRNA in body fluids and cannot accurately detect samples with concentrations below the femtoliter level. Therefore, research on highly sensitive RPA detection of low-level miRNAs in serum is imperative for the diagnosis of diseases such as cancer.

[0005] Photonic crystals are nanomaterials with an artificial periodic dielectric structure that exhibits a photonic bandgap (PBG) characteristic. This bandgap, also known as a "forbidden band" in the structure, prevents waves within a certain frequency range from propagating through the periodic structure, resulting in total reflection of light, which can improve the optical intensity of the optical material. Consequently, they have garnered widespread attention and research. Simply put, when the wavelength of light blocked by this "bandgap" matches the wavelength of light emitted by an added fluorescent group, the group's emitted light is prevented from propagating, resulting in total reflection. The resulting reflected signal overlaps with the fluorescent group's emitted signal, significantly increasing the intensity of the fluorescent signal. Summary of the Invention

[0006] The purpose of the present invention is to overcome the shortcomings and deficiencies of the existing technology and provide a method for rapid detection of miRNA using a photonic crystal chip and recombinase polymerase amplification with high throughput and high sensitivity.

[0007] The purpose of the present invention is achieved by adopting the following technical solutions:

[0008] A method for rapid detection of miRNA using a photonic crystal chip and recombinase polymerase amplification for high throughput and high sensitivity comprises the following steps:

[0009] (1) Preparation of photonic crystal chip: drop microsphere dispersion onto a polydimethylsilane (PDMS) substrate and heat until completely dry to form a photonic crystal chip. The particle size of the microspheres is preferably 270 nm.

[0010] (2) Probe 1 and probe 2 are paired with the target miRNA and then ligated using SplintR ligase. Probe 1 is complementary to the 3' end of the target miRNA, and probe 2 is complementary to the 5' end of the target miRNA. The 5' end of probe 2 is phosphorylated and can be ligated to the 3' end of probe 1 using ligase.

[0011] (3) Using the ligation product as a template, primers are introduced, and a recombinase amplification reaction occurs under the action of the recombinase.

[0012] (4) Super GelBlue dye is added to the recombinase amplification product, dropped onto the photonic crystal chip, and detected using a fluorescence measurement device.

[0013] In step (1), the microspheres are preferably carboxylated silica microspheres, polymethyl methacrylate microspheres or polystyrene microspheres. The concentration of the microsphere dispersion is preferably 2% (mass to volume ratio).

[0014] In step (1), the PDMS substrate is preferably obtained by a method comprising the following steps: mixing PDMS with a curing agent, evenly spin-coating the mixture on a glass slide, and drying the mixture to obtain a hydrophobic PDMS substrate with a PDMS coating.

[0015] In step (2), the probes 1 and 2 are designed and synthesized according to the target miRNA, the 3' end sequence of probe 1 and the 5' end sequence of probe 2 are complementary to the target miRNA and have no secondary structure. The primers are used to amplify the ligation product.

[0016] Preferably, step (2) comprises adding probe 1 and probe 2, ligase buffer, a sample to be detected, SplintR ligase, and enzyme-free water to a ligation system for a ligation reaction, and then inactivating the enzyme after the reaction. The ligation reaction is preferably performed at 20-30° C. for 1-2 hours, and the inactivation is preferably performed at 60-70° C. for 10-20 minutes.

[0017] Preferably, step (3) is: adding the ligation reaction product, TwistAmp TM A recombinase amplification reaction is performed using basic recombinase buffer, primers, enzyme-free water, and Mg(OAc)2. After completion of the reaction, the enzyme is inactivated. The recombinase amplification reaction is preferably performed at 30-37°C for 5-20 minutes, and the inactivation reaction is preferably performed at 60-70°C for 10-20 minutes.

[0018] In step (4), the fluorescence measuring device includes a fluorescence spectrometer, a living body imager, etc.

[0019] Preferably, step (4) comprises adding Super GelBlue dye to the recombinase amplification product, incubating in the dark, and then adding the product to the photonic crystal chip. The fluorescence intensity is measured at an emission wavelength of 610 nm using a fluorescence measuring device. The fluorescence intensity increases in the presence of the target miRNA, and the fluorescence intensity increases with increasing miRNA concentration. The incubation in the dark is preferably performed at 25-37° C. for 10-15 minutes.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] (1) The photonic crystal effect is used to regulate luminescence and enhance fluorescence intensity, thereby increasing detection sensitivity and reducing the detection limit. Combined with recombinase amplification technology to detect circulating miRNA in blood, the established method has ultra-high sensitivity. Under optimal experimental conditions, the linear range of this method is 0.1aM-1pM, and the detection limit of miRNA is as low as 0.24aM.

[0022] (2) The present invention does not require separation and extraction of circulating miRNA and can be directly used for quantitative detection of circulating miRNA in actual samples.

[0023] (3) The present invention can rapidly detect circulating miRNA in serum with high throughput, and the entire detection process only takes about 2 hours. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Schematic diagram of the principle of detecting miRNA in the present invention.

[0025] Figure 2 UV spectrophotometer measurement diagram of photonic crystal chips of different sizes.

[0026] Figure 3 This is a diagram showing the effect of nucleic acid fluorescent dyes amplifying fluorescence signals through a 270nm photonic crystal chip. (a) The upper figure shows the fluorescence images of the dyes SolarGreen-DNA, GelRed-DNA, Goldview-DNA, SYBRGreen I-DNA, and Super GelBlue-DNA on the surface of the photonic crystal chip obtained using a live imager. The two rows of fluorescence are repeated experiments; (a) The lower figure is a quantitative analysis of the fluorescence enhancement effect of the 270nm photonic crystal chip on SolarGreen, GelRed, Goldview, SYBRGreen I, and Super GelBlue; (b) The figure shows the fluorescence images and fluorescence intensity of the fluorescent dye Super GelBlue and DNA on the surfaces of PDMS (middle) and 230nm (left) and 270nm (right) photonic crystal chips under blue light irradiation obtained using a live imager.

[0027] Figure 4 Fluorescence graphs at different let-7a concentrations, the upper and lower rows are repeated experiments.

[0028] Figure 5 This is the working curve of let-7a, the abscissa is the logarithm of concentration, and the ordinate is the normalized fluorescence intensity.

[0029] Figure 6 This is a comparison of the fluorescence intensities of different miRNAs at the same concentration. The upper and lower rows in the left figure are repeated experiments. The horizontal axis of the right figure is the miRNA type, the vertical axis is the fluorescence enhancement ratio, F is the sample fluorescence intensity, and F0 is the blank sample fluorescence intensity.

[0030] Figure 7Comparison of the fluorescence intensity response values of let-7a in the serum of four healthy donors (samples 1-4) and four non-small cell lung cancer (NSCLC) patient samples (5-8), and comparison with the qRT-PCR method. The ordinate is the fluorescence enhancement ratio, F is the sample fluorescence intensity, and F0 is the blank sample fluorescence intensity.

[0031] Figure 8 (a) Fluorescence images of let-7a RPA products in sera from 24 healthy donors and 24 NSCLC patients on the surface of a photonic crystal chip. The bottom row is a repeat of the top row. (b) Fluorescence intensity was analyzed to obtain the (F-F0) / F0 value, where F and F0 are the fluorescence intensities in the presence and absence of serum samples, respectively.

[0032] Figure 9 for Figure 8 The test results of 48 groups of serum were obtained using the patented method "A method for detecting miRNA by branched rolling circle amplification combined with photonic crystals". DETAILED DESCRIPTION

[0033] The following specific examples are used to further illustrate the technical solutions of the present invention, but should not be construed as limiting the present invention. Unless otherwise specified, the raw materials used in the examples are commercially available, and the technical means used are conventional means well known to those skilled in the art.

[0034] A method for detecting miRNA using a photonic crystal chip and recombinase polymerase amplification, the principle of which is as follows Figure 1 As shown, two single-stranded DNA probes, probe 1 and probe 2, are complementary paired using miRNA as a template and then ligated using SplintR ligase. The ligated probes 1 and 2 serve as templates for recombinase polymerase amplification, which is performed using two primers, primer 1 and primer 2, to produce exponentially growing double-stranded DNA (dsDNA). Super GelBlue double-stranded DNA nucleic acid dye is then added to the resulting dsDNA, emitting a fluorescent signal after binding to the minor groove region of the dsDNA. The red fluorescence emitted by the Super GelBlue dye is then enhanced by the total internal reflection of the photonic crystal chip, greatly enhancing the sensitivity of miRNA detection and thereby increasing the possibility of ultrasensitive detection of extremely low levels of circulating miRNAs in body fluids.

[0035] Using let-7a (sequence 5'-UGAGGUAGUAGGUUGUAUAGUU-3') as the detection target, the method for detecting miRNA using a photonic crystal chip and recombinase polymerase amplification specifically comprises the following steps:

[0036] (1) Preparation of photonic crystal substrate: Dow Corning polydimethylsilane (PDMS) and curing agent were mixed in a mass ratio of 10:1, stirred vigorously for more than 30 minutes, and then placed in a vacuum environment to remove bubbles. The mixture was then evenly spin-coated on a glass slide using a spin coater and placed in a 60°C oven for two days to dry, resulting in a hydrophobic PDMS substrate with a PDMS coating.

[0037] (2) Fabrication of photonic crystal chips: 5% (mass-to-volume ratio) of monodisperse carboxyl polystyrene microspheres (particle size 270 nm) (Shanghai Kunao Materials Center) was diluted with water to a 2% working solution. The heating plate was adjusted to 60°C. An 8-channel gun was used to batch-pick 10 μL of the carboxyl polystyrene microsphere working solution and vertically dripped onto the PDMS substrate and heated until completely dry to obtain a photonic crystal chip. The surface of each circular photonic crystal point reflected a metallic luster.

[0038] (3) miRNA-mediated ligation reaction: 10 pM probe 1 (5-TTTGTCCGAAACGACGTACAGCCATTTAACCTT AACTATACAAC ) and phosphorylated probe 2 (5-phos / CTA CTACCTCA CTTTTCCAGCTAGTAAATACCCCGACGTAGAA), 1 μL let-7a, 1 μL 10× SplintR ligase buffer (50 mM Tris-HCl, 10 mM DTT, 10 mM MgCl2, 1 mM ATP, pH 7.5 at 25°C), 20 U RNase inhibitor, and DNase / RNase-free deionized water to 10 μL. The mixture was then heated at 65°C for 5 minutes, slowly cooled (-1°C / min) to 25°C, and then 2.5 U SplintR ligase was added and incubated at 25°C for 60 minutes. After ligation, the enzyme was inactivated by heating at 65°C for 20 minutes, and then the temperature was slowly cooled (-1°C / min) to 25°C.

[0039] (4) Recombinase amplification reaction: a recombinase (Murray Bio TwistAmp TM 24 pM of two primers (forward and backward) of recombinase primer 1 (5-TTTGTCCGAAACGACGTACAGCCATT) and primer 2 (5-TTCTACGTCGGGGTATTTACTAGCTG) were added to the transparent tube of the Basic Kit, 29.5 μL of TwistAmp TMPrepare the Basic Kit recombinase buffer with DNase / RNase-Free Deionized Water to make up to 40 μL as the working solution. Then, add 8 μL of the above working solution, 1 μL of the ligation product from the previous step, and 1 μL of 140 mM Mg(OAc)2 (the reaction begins the moment Mg(OAc)2 is added) to the 10 μL system. Incubate at 39°C for 5 minutes. After amplification, heat at 80°C for 20 minutes to inactivate the enzyme.

[0040] (5) Fluorescence intensity detection: Add 1 μL of 10× Super GelBlue dye to the product amplified in the previous step, mix well, and incubate at room temperature in the dark for more than 5 min. Then, take 4 μL and drop it on the center of the circular spot on the photonic crystal. Then, use a live imaging device (Cellgentek Fluorescence Imaging System) to capture fluorescence images at a wavelength of 610 nm using a green-red filter and green light. Use the instrument software to quantitatively analyze the average fluorescence intensity of each spot for further analysis.

[0041] Example 1

[0042] According to the above method, carboxyl polystyrene microspheres of different particle sizes (230nm, 240nm, 250nm, 260nm, 270nm, 280nm) were selected to prepare photonic crystal chips to detect let-7a, and the ultraviolet absorption spectrum of the photonic crystal chip was measured. The results are as follows Figure 2 As shown, the ultraviolet absorption of the 270nm photonic crystal chip is significantly stronger.

[0043] Example 2

[0044] According to the above method, in the fluorescence intensity detection step, different dyes (SolarGreen, Gelred, Goldview, SYBRGreen I, Super GelBlue) were added to the amplified product for incubation, and then dropped on the photonic crystal chip at 230nm and 270nm to detect let-7a. The results are as follows Figure 3 As shown, the fluorescence emitted by the double-stranded DNA-binding nucleic acid dye SuperGelBlue is the strongest when combined with the 270nm photonic crystal chip.

[0045] Example 3

[0046] According to the above method, let-7a with initial concentrations of 0.1aM, 1aM, 10aM, 100aM, 1fM, 10fM, 100fM, and 1pM were added to the connection system for detection of photonic crystal chip combined with recombinase polymerase amplification, and images were taken using a whole-body fluorescence imager. Figure 4 As shown, the upper and lower rows are repeated for two groups. The fluorescent images taken were numerically analyzed, and the results are shown in Figure 5 As shown, the concentration of let-7a showed a good linear relationship, the linear regression equation was F = 0.07999 × lgC + 1.859 (C is the molar concentration), the correlation coefficient R2 = 0.9943, and the detection limit of the system was calculated to be 0.24aM.

[0047] Example 4

[0048] According to the above method, the same probe and primers were used to add 1nM let-7a, let-7c (5-UGAGGUAGUAGGUUGUAUGGUU), and let-7f (5-UGAGGUAGUAGAUUGUAUAGUU) to the ligation system for detection. Both let-7c and let-7f have only a single base difference from let-7a. The results are as follows Figure 6 As shown, the method of the present invention can effectively distinguish miRNAs of the same family and has good specificity.

[0049] Example 5

[0050] In this example, eight groups of serum samples (including four groups of healthy donors and four groups of serum samples from non-small cell lung cancer (NSCLC) patients) were compared using the detection method of the present invention and the qRT-PCR method, which is the gold standard method in miRNA detection technology.

[0051] Let-7a needs to be reverse transcribed into cDNA first. The RT primer sequence used is (5-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACTAT). Then, using cDNA as a template, a qRT-PCR one-step kit (New England Biolab) was used. Let-7a, Forward primer (5-CGTCGTGAGGTAGTAGGTTG), Reverse primer (5-CTCAACTGGTGTCGTGGA), and the buffer required for the reaction were added together. The reaction was then placed in a PCR instrument and the program was set to 45°C for 5 minutes, 94°C for 30 seconds, 94°C for 5 seconds, 55°C for 15 seconds, and 72°C for 10 seconds for 45 cycles. The results are shown in the figure. Figure 7As shown, the detection results of the method of the present invention are consistent with the results of the qRT-PCR method.

[0052] Example 6

[0053] In this example, 48 groups of serum (including 24 groups of healthy donors and 24 groups of serum samples from patients with non-small cell lung cancer (NSCLC)) were tested using the method of the present invention. The test results are as follows: Figure 8 As shown, healthy people and non-small cell lung cancer patients can be completely distinguished with an accuracy of 100%.

[0054] Example 7

[0055] The 48 groups of serum in Example 6 were tested using the method described in the patent "A method for detecting miRNA by branched rolling circle amplification combined with photonic crystals" (CN201810129724.4). The test results are as follows: Figure 9 As shown, the accuracy of judging healthy people and patients with non-small cell lung cancer is less than 90%.

[0056] The above embodiments are used to further illustrate the present invention. The implementation methods of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A method for detecting miRNA using a photonic crystal chip and recombinase polymerase amplification, characterized by: The following steps are involved: (1) Preparation of a photonic crystal chip: drop a microsphere dispersion onto a polydimethylsilane substrate and heat until completely dry to form a photonic crystal chip; the particle size of the microspheres is 270 nm; (2) Probe 1 and probe 2 are complementary to the target miRNA and then ligated using SplintR ligase; wherein probe 1 is complementary to the 3' end of the target miRNA, probe 2 is complementary to the 5' end of the target miRNA, and the 5' end of probe 2 is phosphorylated; (3) Using the ligation product as a template, primers are introduced, and a recombinase amplification reaction occurs under the action of the recombinase; (4) Add Super GelBlue dye to the recombinase amplification product, drop it on the photonic crystal chip, and detect it using a fluorescence measurement device.

2. The method according to claim 1, wherein: In step (1), the microspheres are carboxyl-modified silica microspheres, polymethyl methacrylate microspheres or polystyrene microspheres.

3. The method according to claim 1, wherein: In step (2), the probe 1 and probe 2 are designed and synthesized according to the target miRNA, and the 3' end sequence of probe 1 and the 5' end sequence of probe 2 are complementary to the target miRNA and have no secondary structure.

4. The method according to claim 1, wherein: Step (2) is: adding probe 1 and probe 2, ligase buffer, the sample to be detected, SplintR ligase and enzyme-free water to the ligation system to carry out a ligation reaction, and inactivating the enzyme after the reaction is completed.

5. The method according to claim 4, characterized in that: The conditions for the ligation reaction are incubation at 20-30° C. for 1-2 h.

6. The method according to claim 1, wherein: Step (3) is: adding the ligation reaction product, TwistAmp™ Basic recombinase buffer, primers, enzyme-free water, and Mg(OAc)2 to the amplification system to carry out the recombinase amplification reaction, and inactivating the enzyme after the reaction is completed.

7. The method according to claim 6, characterized in that: The recombinase amplification reaction is carried out at 30-37° C. for 5-20 minutes.

8. The method according to claim 1, wherein: In step (4), the fluorescence measuring device includes a fluorescence spectrometer and a living body imager.

9. The method according to claim 1, wherein: Step (4) is: adding Super GelBlue dye to the recombinase amplification product, incubating in the dark and then adding it to the photonic crystal chip, using a fluorescence measuring device to test the fluorescence intensity at an emission wavelength of 610 nm. The fluorescence intensity is enhanced in the presence of target miRNA, and the fluorescence intensity is enhanced as the miRNA concentration increases.

Citation Information

Patent Citations

  • A method for detecting miRNA using branched rolling circle amplification combined with photonic crystals

    CN108384832B

  • Method for detecting miRNA through branched rolling cycle amplification in combination with photonic crystal

    CN108384832A