Targeted approach to eliminate bacterial resistance

Abstract

The present invention discloses a method for targeted elimination of bacterial drug resistance, which comprises the following steps: assembling a nucleic acid molecule targeting an antibiotic resistance gene with a nanocarrier with sharp edges to obtain a targeting complex, wherein the nucleic acid molecule comprises a first sequence encoding a CRISPR-associated nuclease and a second sequence generating an sgRNA targeting an antibiotic resistance gene; contacting the targeting complex with bacteria, delivering the nucleic acid molecule into the bacteria through the physical puncture of the nanocarrier, and knocking out the antibiotic resistance gene of the bacteria. Considering that the rigidity of the bacterial cell wall is weaker than that of the plant cell wall, nanoparticles with sharp edges are used as carriers to physically puncture the bacterial cell wall and cell membrane, thereby realizing the transmembrane transport of exogenous nucleic acid molecules on bacteria, thereby realizing the delivery of the exogenous CRISPR system, and presenting ARG‑CRISPR in this way to target and eliminate bacterial drug resistance.

Description

Technical Field

[0001] The present application relates to the field of resistance gene technology, and in particular to a method for targeted elimination of bacterial drug resistance. Background Art

[0002] Antibiotics play an important role in inhibiting bacterial infections, but their widespread use also causes antibiotic selection pressure on bacteria, inducing a large number of antibiotic-resistant bacteria (ARBs) and antibiotic resistance genes (ARGs). The drug resistance of bacteria (especially pathogenic bacteria) has increased, and ARGs have also spread among human pathogens, causing global health problems. Unlike traditional chemical pollutants, ARGs not only continue to remain, transfer and spread in different environmental media (easy to obtain, difficult to remove), but also have explosive characteristics. Once out of control, they will seriously threaten public safety. Therefore, finding ways to curb the spread of drug resistance has become a hot issue at home and abroad. At present, the methods for removing ARGs include biological, chemical, physical and combined treatments, such as ionizing radiation, low-temperature heat treatment, advanced oxidation, disinfection, aerobic composting, anaerobic digestion and other broad-spectrum sterilization methods. Although these methods can significantly reduce the overall ARGs abundance level of the community, they lack specificity for drug-resistant bacteria and cannot completely kill drug-resistant bacteria. They may even aggravate the horizontal gene transfer (HGT) of ARGs due to their killing effect on beneficial microorganisms and the selection pressure exerted on the entire microbial community, ultimately promoting the spread of ARGs.

[0003] The emerging CRISPR-Cas gene editing technology has highly sequence-specific recognition and editing capabilities, and is expected to be used for targeted elimination of ARGs carried by drug-resistant bacteria. The main bottleneck of this technology is how to efficiently introduce the ARG-CRISPR system into the cells of drug-resistant bacteria. Currently, the two feasible ways to present ARG-CRISPR are mainly plasmid transformation and mild phage infection. However, the former relies on the experimental method of bacterial exogenous DNA transformation, which cannot achieve the active entry of ARG-CRISPR and is difficult to carry out outside the laboratory environment; the latter also has problems such as phage host specificity, cumbersome preparation steps, and potential spread of drug resistance. The shortcomings of the above-mentioned presentation system significantly limit the application of ARG-CRISPR in eliminating bacterial resistance. Therefore, a new type of ARG-CRISPR presentation system is needed to break the host specificity of drug-resistant bacteria and achieve the active entry of ARG-CRISPR.

[0004] Nanoparticles (NPs) have a large specific surface area and good biocompatibility, and can efficiently load and protect nucleic acids. Therefore, NPs-based delivery systems have been designed in plant genetic engineering methods. Some studies have shown that the instantaneous transformation of plasmids into plant cells can be achieved simply by spraying NPs-plasmid complexes on the surface of untreated plant leaves. However, there are many differences between plant cells and bacteria. For example, plant cells are generally 10 to 20 μm in size, while bacterial cells are usually less than 5 μm, which leads to a sharp decrease in the amount of NPs that can attach to the cell surface. More importantly, endocytosis is the main mechanism for plant cells to take up NPs and complete presentation, but there are huge differences in the structure of bacteria and plant cells, and there is no structure on their surface that can be endocytosed. Therefore, it is necessary to design an ARG-CRISPR delivery system to efficiently achieve targeted elimination of bacterial resistance. Summary of the invention

[0005] The present application aims to solve at least one of the technical problems existing in the prior art. To this end, the present application proposes a method for targeted elimination of bacterial resistance, which utilizes the ARG-CRISPR presentation system to efficiently eliminate ARGs.

[0006] In a first aspect of the present application, a method for targeted elimination of bacterial drug resistance is provided, the method comprising the following steps:

[0007] Assembling a nucleic acid molecule targeting an antibiotic resistance gene with a nanocarrier with a sharp edge to obtain a targeting complex, wherein the nucleic acid molecule includes a first sequence encoding a CRISPR-associated nuclease and a second sequence generating an sgRNA targeting the antibiotic resistance gene;

[0008] The targeting complex is brought into contact with bacteria, and the nucleic acid molecule is delivered into the bacteria through the physical puncture of the nanocarrier, thereby knocking out the antibiotic resistance gene of the bacteria.

[0009] The method according to the embodiment of the present application has at least the following beneficial effects:

[0010] Considering that the rigidity of bacterial cell walls is weaker than that of plant cell walls, nanoparticles with sharp edges are used as carriers to physically puncture the bacterial cell walls and cell membranes, achieving transmembrane transport of exogenous nucleic acid molecules on bacteria, thereby achieving the delivery of exogenous CRISPR systems, and presenting ARG-CRISPR in this way to target and eliminate bacterial resistance. Moreover, these nanoparticles with sharp edges can not only serve as gene carriers, but also have the ability to inhibit the horizontal gene transfer of ARGs between bacteria, which can become a potential means to resist multi-drug resistant bacteria, thereby eliminating drug resistance while preventing the spread of drug resistance, achieving the effect of killing two birds with one stone.

[0011] In some embodiments of the present application, the sharp edge satisfies that the edge of the nanocarrier has 1 to 100 atomic layers outward. Further, it can be 1 to 50 atomic layers, 1 to 30 atomic layers, 1 to 20 atomic layers, 1 to 10 atomic layers, 1 to 5 atomic layers, 1 to 3 atomic layers, 1 to 2 atomic layers, or a single atomic layer. The outward direction refers to the direction away from the center of the nanocarrier at the edge.

[0012] In some embodiments of the present application, the nanocarrier is selected from at least one of carbon-based nanocarriers (such as carbon nanotubes, carbon dots, graphene), etc. Among them, carbon nanotubes include but are not limited to single-walled carbon nanotubes (SWCNTs) and multi-walled carbon nanotubes (MWCNTs); carbon dots include but are not limited to carbon quantum dots (CQDs), graphene quantum dots (GQDs), etc.; graphene includes but is not limited to graphene, graphene oxide, reduced graphene oxide, etc., and according to the number of layers, it can be divided into single-layer graphene, double-layer graphene, few-layer graphene (3 to 10 layers), and multi-layer graphene (more than 10 layers and less than 10 nm).

[0013] In some embodiments of the present application, the size of the nanocarrier does not exceed 5 μm, and further the size does not exceed 3 μm, 2 μm, 1 μm, for example, 0.1-5 μm, 0.1-3 μm, 0.1-2 μm, 0.1-1 μm. Wherein, the size refers to the maximum value of the distance between the two ends of the nanocarrier in any direction, for example, when it is tubular or sheet-shaped, the size is its length.

[0014] In some embodiments of the present application, the nanocarrier and the nucleic acid molecule are assembled under electrostatic force. Usually, nucleic acid molecules such as DNA have negative charges, so the nanocarrier with positive charge can be selected so that the two can attract each other under electrostatic force for assembly.

[0015] In some embodiments of the present application, the assembling comprises the following steps:

[0016] Activating the surface of the nanocarrier and then connecting a cationic material to obtain a cationic nanocarrier;

[0017] The cationic nanocarrier is mixed with the nucleic acid molecule and incubated, and the nucleic acid molecule is assembled onto the cationic nanocarrier under electrostatic force to obtain a targeting complex.

[0018] In some embodiments of the present application, the activation uses EDC (N-(3-dimethylpropyl)-3-ethylcarbodiimide hydrochloride) and NHS (N-hydroxysuccinimide) to perform carboxyl activation treatment.

[0019] In some embodiments of the present application, the molar ratio of EDC to NHS is 1:(0.25-4), and further the molar ratio of EDC to NHS is 1:(0.5-2), 1:(0.66-1.5).

[0020] In some embodiments of the present application, the mass ratio of the nanocarrier to EDC is 1:(1-10), and further the mass ratio of the nanocarrier to EDC is 1:(3-8).

[0021] In some embodiments of the present application, the mass ratio of the nanocarrier to the cationic material is 1:(0.1-10), further the mass ratio of the nanocarrier to the cationic material is 1:(0.2-5), further 1:(0.3-3).

[0022] In some embodiments of the present application, the mass ratio of the nanocarrier to the nucleic acid molecule is 1:(0.1-10), further the mass ratio of the nanocarrier to the nucleic acid molecule is 1:(0.2-5), further 1:(0.3-3).

[0023] In some embodiments of the present application, the cationic material is selected from at least one of polyethyleneimine, polypropyleneimine, spermine, spermidine, polyhistidine, polyarginine, polylysine, chitosan, and imidazolium.

[0024] In some embodiments of the present application, the CRISPR-associated nuclease is selected from at least one of Cas (such as Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12a~i, Cas13a~d, Cas14a~c), Csa (Csa1~5), Csb (Csb1~3), Csc (Csc1~2), Cse (Cse1~2), Csf (Csf1~4), Csm (Csm1~6), Csn, Csx (Csx1~20), Csy (Csy1~3), and Cmr (Cmr1~6).

[0025] In some embodiments of the present application, the antibiotic resistance gene is selected from at least one of the following: aac, aad, acc, act, ant, aph, bel, cat, cit, cmy, ctx-M, dfr, ere, ebc, fex, floR, fox, ges, gim, gyr, imi, imp, kpc, mcr, mir, mox, mph, ndm, nmc, oqx, oxa, par, per, pse, qnr, rmt, sfc, shv, sim, sme, spm, str, sul, tem, tet, tla, van, veb, and vim.

[0026] In some embodiments of the present application, in some embodiments of the present application,The antibiotic resistance genes are selected from at least one of the following: aac(3)-I, aac(3)-II, aac(3)-IV, aac(6')-I, aac(6')-II, aadA3 to A24, acc-1, acc-3, act-1, act-5, ant(2″)-Ia, ant(3″)-I, ant(3″)-II, aph(3')-I, aph(3')-II, aph(3')-III, aph(3')-VI, aph(3')-XV, aph(4)-I, aph(6)-I, armA, bel-1, bes-1, catA, catB, cfe-1, cmy-1, cmy-2, cmy-41, cmy-70, ctx-m-1, ctx-m-2, ctx-m-8 / 25, ctx-m-9, dfr19 / dfrA18, dfrA1, dfrA12, dfrA14, dfrA15, dfrA16, dfrA17, dfrA23, dfrA27, dfrA5, dfrA7, dfrA8, dfrB1 / dfr2a, dfrB2, DHA, dhfrB5, gyrA, parC, ere(A), ere(B), erm(B), fexA, fexB, floR, fox-1, ges-1, gim-1, imi-1, imp-1, imp-2, imp-5, kpc-1, mcr-1, mir-1, mox-1, mox-5, mph(A), mph(D), mph(E), msr(E), ndm-1, nmc-a, oqxa, oqxb, oxa-1, oxa-10, oxa-18, oxa-2, oxa-23, oxa-24, oxa-45, oxa-48, oxa-50, oxa-50, oxa-51, oxa-54, oxa-55, oxa-58, oxa-60, oxa-62, oxa-9, per-1, pse-1, qnrA, qnrB, qnrD, qnrS, qnrV, rmtb, rmtf, sfc-1, shv-g25, shv-g26, sim-1, sme-1, spm-1, stra, strb, sul1, sul2, sul3, sulA, tem-1, tem-10, tem104, tem-105, tem-128, tem-129, tem-141, tetA, tetB, tetC, tetG, tetL, tetM, tetO, tetQ, tetS, tetT, tetW, tetX, tla-1, vanA, vanB, vanC, veb-1, vim-1, vim-13, vim-2, vim-5.,

[0027] In some embodiments of the present application, the antibiotic resistance gene mediates resistance to at least one of the following antibiotics: aminoglycosides, β-lactams, quinolones, polypeptides, macrolides, bacitracins, sulfonamides, tetracyclines, streptogramins, chloramphenicol, and lincosamides.

[0028] Among them, aminoglycoside antibiotics include but are not limited to streptomycin, kanamycin, tobramycin, neomycin, spectinomycin, gentamicin, sisomicin, nomicin, amikacin, netilmicin, ethimicin, isopamicin, paromomycin, kasugamycin, rivamycin, ribostamycin, fortinomycin, arbekacin, etc.

[0029] β-lactam antibiotics include, but are not limited to, penicillins (e.g., penicillin, phenoxyethyl penicillin, oxacillin, cloxacillin, dicloxacillin, flucloxacillin, ampicillin, amoxicillin, pivampicillin, carbenicillin, sulbenicillin, ticarcillin, furicellin, azlocillin, piperacillin), cephalosporins (e.g., cephalexin, cephradine, cefazolin, cefuroxime, cefamandole, cefixime), The main types of antibiotics include cephalosporins (such as cefotaxime, ceftazidime, cefotaxime, ceftriaxone, cefoperazone, ceftizoxime, cefepime, cefpirome), cephalosporins (such as cefoxitin, cefmetazole, cefotetan, cefminox, cefbuperome), thiomycins, carbapenems (such as imipenem, meropenem, panipenem, faropenem, ertapenem, biapenem), monocyclic β-lactams (such as aztreonam, carumonam), etc.

[0030] Quinolone antibiotics include but are not limited to nalidixic acid, pyrrolac, pipemidic acid, neofloxacin, methoxolinic acid, norfloxacin, ofloxacin, levofloxacin, pefloxacin, enoxacin, ciprofloxacin, lomefloxacin, fleroxacin, sparfloxacin, mefloxacin, enrofloxacin, gatifloxacin, trovafloxacin, clinafloxacin, moxifloxacin, gemifloxacin, pazufloxacin, etc.

[0031] Polypeptide antibiotics include, but are not limited to, polymyxins (such as polymyxin B, polymyxin E), bacitracins (bacitracin, gramicidin), and glycopeptides (such as vancomycin, norvancomycin, teicoplanin).

[0032] Macrolide antibiotics include, but are not limited to, 14-membered macrolides (such as erythromycin, oleandomycin, clarithromycin, roxithromycin, dirithromycin, telithromycin, and quiniramicin), 15-membered macrolides (such as azithromycin), 16-membered macrolides (such as midecamycin, acetyl midecamycin, kitasamycin, acetyl kitasamycin, josamycin, spiramycin, acetylspiramycin, and rotamycin), etc.

[0033] Sulfonamide antibiotics include but are not limited to sulfisoxazole, sulfadiazine, sulfamethoxazole, sulfamethoxazole, sulfadoxine, sulfasalazine, silver sulfadiazine, mafenide, sulfacetamide, and the like.

[0034] Tetracycline antibiotics include but are not limited to doxycycline, minocycline, tetracycline, chlortetracycline, oxytetracycline, demeclocycline, doxycycline, minocycline, tigecycline, etc.

[0035] Streptogramin antibiotics include but are not limited to pristinamycin, sinamycin, virginiamycin, etc.

[0036] Lincosamide antibiotics include but are not limited to lincomycin, clindamycin, etc.

[0037] In some embodiments of the present application, the resistance gene is mcr-1, and the nucleic acid sequence of sgRNA is as shown in SEQ ID No.1-2, and / or, as shown in SEQ ID No.3-4.

[0038] The second aspect of the present application provides a targeted complex for eliminating bacterial resistance, comprising:

[0039] Nanocarriers, nanocarriers have sharp edges;

[0040] The nucleic acid molecule is assembled in the nanocarrier, and the nucleic acid molecule includes a first sequence encoding a CRISPR-associated nuclease and a second sequence generating a sgRNA targeting an antibiotic resistance gene.

[0041] In some embodiments of the present application, the nucleic acid sequence of sgRNA is shown as SEQ ID No. 1 to 2, and / or, as shown as SEQ ID No. 3 to 4.

[0042] In some embodiments of the present application, the nucleic acid molecules are assembled to the nanocarrier under electrostatic forces.

[0043] In some embodiments of the present application, the nanocarrier is a cationized nanocarrier.

[0044] In some embodiments of the present application, the nanocarrier is complexed with at least one cationic material selected from the group consisting of polyethyleneimine, polypropyleneimine, spermine, spermidine, polyhistidine, polyarginine, polylysine, chitosan, and imidazolium to form a cationic nanocarrier.

[0045] In some embodiments of the present application, the nanocarrier is activated and then complexed with a cationic material to form a cationized nanocarrier.

[0046] In some embodiments of the present application, the nanocarrier is activated by EDC and NHS to form a cationic material.

[0047] The third aspect of the present application provides a method for preparing a targeting complex, the preparation method comprising the following steps:

[0048] Activating the surface of the nanocarrier and then connecting the cationic material to obtain a cationic nanocarrier;

[0049] The cationic nanocarrier is mixed with the nucleic acid molecule and incubated, and the nucleic acid molecule is assembled onto the cationic nanocarrier under the electrostatic force to obtain a targeting complex.

[0050] In some embodiments of the present application, the cationic material is selected from at least one of polyethyleneimine, polypropyleneimine, spermine, spermidine, polyhistidine, polyarginine, polylysine, chitosan, and imidazolium.

[0051] In some embodiments of the present application, the nanocarrier is activated by EDC and NHS to form a cationic material.

[0052] Additional aspects and advantages of the present application will be given in part in the description below, and in part will become apparent from the description below, or will be learned through the practice of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 It is a flow chart of a method for targeted elimination of bacterial resistance provided in an embodiment of the present application.

[0054] Figure 2 This is the experimental result of the transformation efficiency of wild drug-resistant bacteria by different concentrations of NPs-CRISPR targeting complexes using plasmid as a control in Example 1 of the present application.

[0055] Figure 3 This is the experimental result of the shearing efficiency of different concentrations of NPs-CRISPR targeting complexes on wild resistant bacteria using plasmid as a control in Example 1 of the present application. DETAILED DESCRIPTION

[0056] The following will clearly and completely describe the concept of the present application and the technical effects produced in combination with the embodiments, so as to fully understand the purpose, features and effects of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of them. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present application.

[0057] The embodiments of the present application are described in detail below. The described embodiments are exemplary and are only used to explain the present application, and should not be understood as limiting the present application.

[0058] In the description of this application, "several" means more than one, "many" means more than two, "greater than", "less than", "exceed", etc. are understood to exclude the number itself, and "above", "below", "within", etc. are understood to include the number itself. If there is a description of the first and the second, it is only for the purpose of distinguishing the technical features, and it cannot be understood as indicating or implying the relative importance or implicitly indicating the number of the indicated technical features or implicitly indicating the order of the indicated technical features. If a logical order is described in the flowchart, in some cases, the steps described or shown can be performed in a different order from that in the flowchart.

[0059] In the description of the present application, the description with reference to the terms "one embodiment", "some embodiments", "illustrative embodiments", "examples", "specific examples" or "some examples" means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present application. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner.

[0060] Example 1

[0061] refer to Figure 1 , is a schematic diagram of a method for targeted elimination of bacterial drug resistance in an embodiment of the present application, wherein nanocarriers with sharp edges and recombinant ARG-CRISPR plasmids are prepared separately, and assembled into NPs-CRISPR targeting complexes, and then the targeting complexes are co-cultured with drug-resistant bacteria so that the two are in contact with each other, thereby delivering plasmid DNA molecules to drug-resistant bacteria under physical puncture, and CRISPR-related nucleases and corresponding sgRNAs are expressed inside the bacteria, and gene editing is performed on the antibiotic resistance genes of the corresponding bacteria to knock them out, and then the proportion of bacteria that have not been knocked out to the total amount of bacteria can be screened through resistance plates, thereby determining the effect of targeted elimination of bacterial drug resistance. The specific process is as follows:

[0062] 1. Construction of NPs-CRISPR complex for targeted elimination of ARGs

[0063] 1.1 Preparation of nanocarriers

[0064] 10 mg of single-walled carbon nanotubes SWCNTs (Sigma-Aldrich, product number 652490, diameter × length: 4-5 nm × 0.5-1.5 μm) were ultrasonically dispersed in nuclease-free water, and the supernatant was collected by centrifugation. 30 mg of N-hydroxysuccinimide (NHS) and 30 mg of N-(3-dimethylpropyl)-3-ethylcarbodiimide hydrochloride (EDC) were added. After ultrasonication for 10 min, the carboxyl groups were activated by shaking at 180 rpm for 1 h. After the reaction, the 100 KD ultrafiltration centrifugation was performed for washing. Subsequently, the activated SWNTs were added to a solution containing 100 mg of polyethyleneimine (PEI, MW = 25000), incubated at room temperature at 180 rpm overnight, and the cationic nanocarrier PEI-SWNTs was obtained after ultrafiltration centrifugation for washing.

[0065] 1.2 Construction of ARG-CRISPR plasmid for targeted elimination of mcr-1

[0066] Using two sgRNA sequences targeting the mcr-1 gene reported in the literature, a targeted cleavage experiment of the polymyxin resistance gene mcr-1 in wild resistant bacteria was carried out. The sgRNA template sequences are as follows:

[0067] sgRNA1-F:TTTGCTATTAATCATGGGC (SEQ ID No. 1),

[0068] sgRNA1-R: CGCCCATGATTAATAGCAAA (SEQ ID No. 2),

[0069] sgRNA2-F: AAACAAAGCTGTTTGATGTCACCGG (SEQ ID No. 3),

[0070] sgRNA2-R:AAAACCGGTGACATCAAACAGCTTT (SEQ ID No. 4).

[0071] According to the above sgRNA template sequence, a pair of complementary DNA Oligos were synthesized, and the synthesized Oligos were annealed into a double-stranded chain of the second sequence by a step-by-step cooling method, and then digested and ligated with the CRISPR plasmid containing the first sequence encoding the Cas9 protein purchased from the laboratory, and then transformed into Escherichia coli, plated for identification, and positive colonies were inoculated into LB liquid culture medium. After overnight culture, the plasmid of Escherichia coli was extracted to obtain the ARG-CRISPR plasmid, which was stored at -20°C for later use.

[0072] 1.3 Construction of NPs-CRISPR complex

[0073] The cationic nanocarriers were diluted with morpholinoethanesulfonic acid buffer (10 mM MES, pH 7.0) to obtain nanocarrier solutions of different concentrations. The nanocarrier solutions and ARG-CRISPR plasmids were mixed at different concentrations and incubated at room temperature for 30 minutes to obtain NPs-ARG-CRISPR complexes. The loading efficiency was tested by gel electrophoresis, and the optimal mixing ratio (the mass ratio of nanocarriers to plasmid DNA was 3:1) was determined for subsequent experiments.

[0074] 2. Test the effect of NPs–CRISPR targeting complex on targeted elimination of mcr-1 gene

[0075] The NPs-CRISPR targeting complex with different concentrations was mixed with the mcr-1 resistant bacteria and incubated at room temperature. The drug resistance of the wild resistant bacteria was measured every 0.5 h, and the ARG-CRISPR plasmid was used as the control group of the NPs-CRISPR targeting complex. The above bacterial suspension was evenly spread on the LB solid screening medium containing different antibiotics, and the number of colony growth was calculated after overnight culture at 37 ° C. The efficiency of the NPs-CRISPR targeting complex in eliminating drug resistance in mcr-1 resistant bacteria was determined according to the number of colonies on different antibiotic plates.

[0076] The results are as follows Figure 2 and 3 As shown, the conversion efficiency of the NPs-CRISPR targeting complex constructed in this example for drug-resistant bacteria is 100 times higher than that of direct transformation with plasmids, and the targeted shearing efficiency of the resistance gene mcr-1 is also maintained at more than 60%. Among them, conversion efficiency = number of bacteria containing plasmids / total number of bacteria; shearing efficiency = number of bacteria that have lost drug resistance / number of bacteria containing plasmids.

[0077] Example 2

[0078] This embodiment provides a method for targeted elimination of bacterial resistance, which differs from Example 1 in that the carrier is replaced by a single-walled carbon nanotube with an equal mass of multi-walled carbon nanotubes (Sigma-Aldrich, product number 755125, diameter × length: 9.5 nm × 1.5 μm), and the sgRNA ultimately expressed by the plasmid DNA targets the tetW gene that mediates tetracycline resistance.

[0079] Example 3

[0080] This embodiment provides a method for targeted elimination of bacterial resistance, which differs from Example 1 in that the carrier is replaced by single-walled carbon nanotubes with an equal mass of graphene oxide (Sigma-Aldrich, product number 777676), and the cationic material is replaced by polyethyleneimine with chitosan.

[0081] Example 4

[0082] This embodiment provides a method for targeted elimination of bacterial resistance, which differs from Example 1 in that the carrier is replaced by single-walled carbon nanotubes with graphene quantum dots (Sigma-Aldrich, product number 900708) of equal mass, and the sgRNA ultimately expressed by the plasmid DNA targets the sul1 gene that mediates sulfonamide resistance.

[0083] The methods for targeted elimination of bacterial drug resistance provided in Examples 2 to 4 can also improve the transformation efficiency of CRISPR plasmids for drug-resistant bacteria and the targeted cleavage efficiency of resistance genes.

[0084] At present, the method of using CRISPR plasmids to eliminate bacterial drug resistance is relatively mature, and the bottleneck of this technology is how to realize the presentation of CRISPR plasmids into bacterial cells. It can be seen from the above embodiments that in this application, by constructing a presentation system of ARG-CRISPR plasmids to drug-resistant bacteria based on specific nanocarriers, which is different from the traditional bacterial plasmid presentation method of phage infection and plasmid transformation, the presentation and application of CRISPR nanocarriers on bacteria are realized for the first time. Its main principle is to use the excellent physical and chemical properties (including sharp edges and the ability to gain and lose electrons) of the surface of these nanocarriers to penetrate the cell wall and cell membrane of bacteria, so as to introduce the CRISPR plasmids carried on the surface of the nanocarriers into the interior of the bacteria, and finally realize the transformation of the plasmids. If liposomes, nano-silica and other nanoparticles without sharp edges are used as carriers to present CRISPR plasmids, these plasmids are difficult to introduce into the interior of bacteria because bacteria cannot be endocytosed, the conversion efficiency is low, and the effect of eliminating bacterial drug resistance is poor.

[0085] The present application is described in detail above in conjunction with the embodiments, but the present application is not limited to the above embodiments, and various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. A method for targeted elimination of bacterial drug resistance, characterized in that: The following steps are involved: Assembling a nucleic acid molecule targeting an antibiotic resistance gene with a nanocarrier with sharp edges to obtain a targeting complex, wherein the nucleic acid molecule includes a first sequence encoding a CRISPR-associated nuclease and a second sequence generating an sgRNA targeting the antibiotic resistance gene, and the nanocarrier with sharp edges is a carbon nanotube, and the mass ratio of the carbon nanotube to the nucleic acid molecule is 5:1 to 3:1; The targeting complex is brought into contact with bacteria, and the nucleic acid molecule is delivered into the bacteria through the physical puncture of the nanocarrier, thereby knocking out the antibiotic resistance gene of the bacteria.

2. The method according to claim 1, characterized in that The sharp edge satisfies that the edge of the nanocarrier has 1 to 100 atomic layers outward.

3. The method according to claim 1, characterized in that The assembly is that the nanocarrier and the nucleic acid molecule are assembled under electrostatic force.

4. The method according to claim 1, characterized in that The assembly comprises the following steps: Activating the surface of the nanocarrier and then connecting a cationic material to obtain a cationic nanocarrier; The cationic nanocarrier is mixed with the nucleic acid molecule and incubated, and the nucleic acid molecule is assembled onto the cationic nanocarrier under electrostatic force to obtain a targeting complex.

5. The method according to claim 4, characterized in that The activation process uses EDC and NHS to activate the carboxyl group.

6. The method according to claim 4, characterized in that The cationic material is selected from at least one of polyethyleneimine, polypropyleneimine, spermine, spermidine, polyhistidine, polyarginine, polylysine, chitosan and imidazolium.

7. The method according to claim 1, characterized in that The CRISPR-associated nuclease is selected from at least one of Cas, Csa, Csb, Csc, Cse, Csf, Csm, Csn, Csx, Csy, and Cmr.

8. The method according to claim 1, characterized in that: The antibiotic resistance gene is selected from at least one of the following: aac, aad, acc, act, ant, aph, bel, cat, cit, cmy, ctx-M, dfr, ere, ebc, fex, floR, fox, ges, gim, gyr, imi, imp, kpc, mcr, mir, mox, mph, ndm, nmc, oqx, oxa, par, per, pse, qnr, rmt, sfc, shv, sim, sme, spm, str, sul, tem, tet, tla, van, veb, and vim.

9. The method according to claim 1, characterized in that: The antibiotic resistance gene mediates resistance to at least one of the following antibiotics: aminoglycosides, β-lactams, quinolones, polypeptides, macrolides, sulfonamides, tetracyclines, streptogramins, chloramphenicol, and lincosamides.

10. A targeted complex for eliminating bacterial resistance, characterized in that: include: A nanocarrier, wherein the nanocarrier has sharp edges and is a carbon nanotube; A nucleic acid molecule is assembled in the nanocarrier, wherein the nucleic acid molecule comprises a first sequence encoding a CRISPR-associated nuclease and a second sequence generating a sgRNA targeting an antibiotic resistance gene.

11. The targeting complex according to claim 10, characterized in that The nucleic acid sequence of the sgRNA is shown as SEQ ID No. 1 to 2, and / or, as shown as SEQ ID No. 3 to 4.

12. The method for preparing the targeting complex according to any one of claims 10 to 11, characterized in that: The following steps are involved: Activating the surface of the nanocarrier and then connecting the cationic material to obtain a cationic nanocarrier; The cationic nanocarrier is mixed with the nucleic acid molecule and incubated, and the nucleic acid molecule is assembled onto the cationic nanocarrier under the electrostatic force to obtain a targeting complex.

Images