Penicillium purpurogenum strain PQxj3, bacterial preparation and its application in promoting tobacco growth

Abstract

The present invention belongs to the field of microbial technology, and specifically relates to a Penicillium purpurogenum strain PQxj3 capable of promoting tobacco growth, which is classified and named Penicillium janthinellum The strain is deposited in the General Microbiological Center of China Microbiological Culture Collection Committee with a number of CGMCC NO: 40147. The present invention also uses the strain PQxj3 to prepare a bacterial agent, and through experiments and verification, it is found that the strain PQxj3 and the bacterial agent can promote tobacco growth; when used in tobacco planting, the tobacco root system will grow more developed, the plants will be taller and stronger, and the tobacco leaves will grow bigger and better.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a Penicillium purpurogenum strain PQxj3, a bacterial agent product and an application thereof in promoting tobacco growth. Background Art

[0002] Tobacco is an economic crop that is not suitable for continuous cropping. Long-term continuous cropping will cause the properties of tobacco-growing soil to deteriorate, soil fertility to decline, and increase the incidence of pests and diseases, which will in turn affect tobacco yield and quality (Gao Lin, Wang Xinwei, Shen Guoming, Tian Feng, Chen Qianfeng, Zhang Mingfa, Zhang Chengsheng. Differences in the structure of bacterial and fungal communities in tobacco-growing soils with different continuous cropping years [J]. China Agricultural Science and Technology Herald, 2019, 21(08): 147-152.). Tobacco is planted all year round in tobacco-producing areas, which has caused a serious decline in tobacco yield. In order to increase tobacco yield, a large amount of pesticides are used for prevention and control. Long-term and large-scale application of chemical pesticides can easily make pathogens resistant to pesticides, cause changes in soil texture, cause environmental pollution and pesticide residues, and seriously affect human health. At the same time, it seriously restricts the sustainable development of tobacco. Growth-promoting microorganisms and their microbial agents can not only increase crop yields, but also have higher economic benefits than chemical agents, which is in line with the development concept of green environmental protection (Gao Feng, You Chuihuai, Liu Chaoke, Zhang Tao, Tang Shukai, Gu Li, Ding Borui, Zhang Chongyi. Effects of the application of microbial agents on the economic traits of flue-cured tobacco and changes in its rhizosphere microecology [J]. Journal of Fujian Agricultural Sciences, 2014, 29(12): 1230-1235.).

[0003] Plant growth promoting rhizobacteria (PGPR) are a type of beneficial microorganisms that can promote plant growth and its absorption and utilization of mineral nutrients, and can inhibit harmful organisms. They live freely in the soil or attach to plant roots. PGPR can not only promote plant growth and reduce the use of chemical fertilizers, but also reduce the application of pesticides to a certain extent, playing the role of "reducing weight and reducing medicine". At present, the research and application of PGPR are mainly concentrated on important food crops such as rice, wheat, sorghum, and corn. The research on tobacco rhizosphere growth promoting bacteria is mainly focused on disease biocontrol, and there is less research on the effect of promoting tobacco growth. In addition, the results of PGPR in promoting tobacco growth in laboratories and greenhouses lack consistency in field survey results; this makes rhizosphere microorganisms and their products that can truly promote tobacco growth very few.

[0004] In response to the technical problem of the annual decline in tobacco production, in order to increase tobacco production, comply with the green and environmentally friendly development concept, and make tobacco sustainable, we should develop resources for tobacco growth-promoting bacteria, find out microorganisms that have the function of promoting tobacco growth, and solve the practical problem of low tobacco production; it is of broad and practical significance to develop high-quality growth-promoting bacteria products to increase tobacco production, optimize cultivation measures, and improve economic benefits. Summary of the invention

[0005] The present invention aims to overcome the defects of the prior art and provide a micropurpurogenous Penicillium strain ( Penicillium janthinellum )PQxj3. Bacterial preparations and their applications in promoting tobacco growth.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] A strain of Penicillium janthinellum PQxj3, whose classification name is Penicillium janthinellum, has a collection number of CGMCC NO: 40147 at the China Culture Collection Center of General Microorganisms, China. The collection date is March 17, 2022, and the address of the collection unit is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] The invention provides a bacterial agent prepared by using the Penicillium purpurogenum strain PQxj3, wherein the strain PQxj3 is placed in a triangular flask added with a bran solid culture medium, and cultured at 28±2°C for 14±2d.

[0009] In the above-mentioned bacterial agent, the bran solid culture medium is prepared by the following steps: weigh 40 g of bran, add 32±5 ml of distilled water, mix well, and sterilize at 121° C. for 20-30 min to obtain the bran solid culture medium.

[0010] The present invention provides application of the Penicillium purpurogenum strain PQxj3 in promoting tobacco growth.

[0011] The present invention also provides application of the bacterial agent in promoting tobacco growth.

[0012] The above application can be further applied to field transplanting by dipping the roots of the tobacco seedlings in the bacterial agent and then transplanting and planting them normally.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The invention explores the beneficial microbial resources in the soil and finds a beneficial microorganism Penicillium purpurogenum PQxj3, which can significantly promote the growth of tobacco and has never been reported in the relevant field. The strain is made into a microbial agent for tobacco planting, and the tobacco root system will grow more developed, the plants will be taller and stronger, and the tobacco leaves will grow bigger and better. The microbial agent can also improve the comprehensive disease resistance of tobacco, reduce the death of tobacco plants, and make the tobacco grow more uniform. It increases the yield of tobacco and is superior to the microbial agents currently on the market. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The effect of strain PQxj 3 on tobacco growth after 20 days of treatment;

[0016] Figure 2 The effect of strain PQxj 3 on tobacco growth after 40 days of treatment;

[0017] Figure 3 The results are a comparison of the effects of strain PQxj3 and commercial microbial agents on tobacco growth;

[0018] Figure 4 The morphological diagram of strain PQxj3, the left picture is the spore-producing surface of the plate culture, and the right picture is the back of the plate culture;

[0019] Figure 5 is the comparison result between ITS sequence and NCBI database;

[0020] Figure 6 To construct the phylogenetic tree of strain PQxj3;

[0021] Figure 7 The growth of field tobacco treated with strain PQxj3;

[0022] Figure 8 Statistics of agronomic traits of tobacco grown in the field at maturity with different treatments. In the figure, S refers to the commercially available Trichoderma harzianum agent. DETAILED DESCRIPTION

[0023] The technical solution of the present invention is further described in detail below in conjunction with the embodiments, but the protection scope of the present invention is not limited thereto.

[0024] During the experiment, the culture medium composition involved is as follows.

[0025] PDA culture medium: cut the washed and peeled potatoes into small pieces, weigh 200 g, add water and cook until soft, boil for 20-30 min, filter with eight layers of gauze, heat, add 15 g agar, continue heating and stirring to mix, after the agar is dissolved, add 20 g glucose, stir evenly, cool slightly and then add water to 1L, set the pH to natural, and sterilize at 115℃ for 20 min (test tube sterilization can make test tube slant culture medium; liquid culture medium does not need to add agar).

[0026] Microorganism-tobacco co-culture screening medium: MS powder (Murashige & Skoog Basal Medium with Vitamins) 0.94 g, PDA liquid medium 100 ml, sucrose 8 g, agar powder 10 g, add water to 1L, pH 5.78-5.82, sterilize at 115℃ for 30 min.

[0027] Bran solid culture medium (250 ml Erlenmeyer flask): Weigh 40 g of bran, add 32 ml of distilled water, mix well, and sterilize at 121°C for 20 min.

[0028] Experimental Materials and Methods

[0029] 1. Growth-promoting bacteria Penicillium micropurpurogenum strains ( Penicillium janthinellum )PQxj3 screening:

[0030] 1) Isolation and purification of microorganisms from soil samples.

[0031] In the tobacco planting fields of Nangan Tobacco Station in Luoshan County and Landian Tobacco Station in Xingji Town, Pingqiao District of Xinyang Tobacco Company, 20 g of rhizosphere soil under different conditions, different planting environments and different growth periods of tobacco were collected and dissolved in 200 ml of sterile water. The samples were shaken and dissolved for 30 min, and then gradient diluted. 10 -4 , 10 -5 , 10 -6 Three gradients were spread on a culture dish containing PDA medium and cultured at 28°C for 3 days. Single colonies were picked and purified and cultured again three times to obtain pure microorganisms. A total of 161 strains of mold were isolated and purified for isolation and screening of microorganisms that promote tobacco growth.

[0032] 2) The 161 pure strains of fungi were co-cultured with sterile tobacco seedlings to screen for fungi with better growth-promoting effects.

[0033] Microorganism-tobacco co-culture to screen growth-promoting bacteria: Tobacco sterile seedlings were obtained by tissue culture, and the sterile tobacco seedlings were transferred to the microorganism-tobacco co-culture screening medium. Pure molds were then inoculated into the roots of the sterile tobacco seedlings. The co-culture was carried out for 14 days at a temperature of 28°C, a humidity of 60%, and light for 12 h and dark for 12 h. The effects of molds on the fresh weight, number of root branches, root length, stem length, etc. of tobacco were investigated, and beneficial molds that promote tobacco growth were screened. The results are shown in Table 1.

[0034] Table 1: Effects of different molds on tobacco fresh weight, fibrous roots, root length and stem length

[0035]

[0036] The results in Table 1 show that a total of 3 tobacco-promoting fungi were screened, and the co-cultivated tobacco seedlings grew well. Among them, strain PQxj 3 had the best growth-promoting effect, which could significantly increase the fresh weight of tobacco and promote the growth of tobacco root branches, significantly increasing the root length and plant stem length; strain PQxj 3 is a very good growth-promoting fungus.

[0037] 3) Potted plant verification and screening experiment:

[0038] Preparation of microbial agent: strain PQxj 3 was placed in a triangular flask with bran solid culture medium and cultured at 28°C for 14 days (during the culture process, the mycelium was allowed to grow in large quantities in the early stage, and then the flask was properly shaken to make the mycelium evenly distributed, and then it was allowed to stand still again until sufficient mycelium and spores were produced). The PQxj 3 microbial agent was obtained, and the number of viable bacteria was about 2×10 8 cfu / g.

[0039] The substrates used were nutrient soil and vermiculite. Sterilize the nutrient soil and vermiculite, mix them in a 1:1 ratio and place them in a 10cm*10cm plastic pot to culture tobacco; culture the tobacco until it has 4-6 leaves, and select tobacco with consistent growth for the experiment; add the PQxj 3 microbial agent prepared above to the roots of the tobacco seedlings at an addition amount of 5% of the substrate weight (while using the blank control CK group without adding PQxj 3 microbial agent), continue to culture for 40 days, and count the tobacco fresh weight, root weight, stem length, and root length every 20 days to detect the effect of the strain on tobacco growth and screen tobacco growth-promoting bacteria. The results are shown in Figure 1 and 2 .

[0040] Depend on Figure 1 and Figure 2It can be seen that the screened growth-promoting bacteria PQxj 3 was used in potted plants and directly applied to the roots of tobacco seedlings. It had no adverse reactions to tobacco and could promote the growth of tobacco. Compared with the blank control group, strain PQxj3 could significantly promote the growth of tobacco; after 20 days of treatment, the fresh weight was 1.86 times that of the blank control group; after 40 days of treatment, the stem length of tobacco was also significantly higher than that of the blank control group; and the root weight, dry weight and root length were better than those of the blank control group. The experimental results show that PQxj3 has a very good growth-promoting effect on tobacco and is a very good tobacco growth-promoting bacteria.

[0041] 4) Potted plant verification experiment with commercial microbial agents:

[0042] Referring to the above potted plant experimental steps, the PQxj3 strain was compared with the common commercially available Trichoderma harzianum agent that promotes tobacco growth on the market, and the potted plant test was performed again. The results are shown in Figure 3 .

[0043] Figure 3 The results showed that compared with commercial microbial agents purchased on the market, the PQxj3 strain showed an outstanding growth-promoting effect, and the tobacco plants grew larger and stronger. Whether it was fresh weight above ground or root weight, the tobacco treated with the PQxj3 strain was better than the commercially available Trichoderma harzianum microbial agent. This shows that the strain PQxj3 is a very good tobacco growth-promoting bacterium with great development potential. It can be made into microbial agent products for tobacco planting to promote tobacco growth.

[0044] (ii) Growth-promoting bacteria Penicillium purpurogenum strains ( Penicillium janthinellum )

[0045] The colonies of strain PQxj3 obtained by screening were felt-like, with flocculent surface, gray or gray-green spore-producing surface, colorless to yellow back, and radial folds (see Figure 4 ).

[0046] The ITS-specific sequence of the strain was amplified by PCR using ITS1 and ITS4 universal primers to obtain the ITS gene fragment of the strain and compare it with the NCBI bacterial species database (see Figure 5 ), construct the phylogenetic tree of the strains (see Figure 6 ).

[0047] ITS sequence of PQxj3 strain: TTTATCATACCTAGTTGCTTCGGCGGGCCCGCCGTCATGGCCGCCGGGGGGCACTCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCCCTGAACGCTGTCTGAAGATTGCAGTCT GAGCGATTAGCTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACG CACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGCCCCCCGGCTCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCAC CGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCCGTAGGCCCGGCCGGCGCCCGCCGGCGACCCCCCTCAATCTTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

[0048] Based on the above morphological characteristics, the comparison results of NCBI strain database and the constructed phylogenetic tree, the strain was identified as Penicillium janthinellum The MN727028.1 strain has the highest similarity and was identified and preserved in the General Microbiological Center of the China Microbiological Culture Collection Administration. The species was determined to be Penicillium purpurogenum, and this application named it Penicillium purpurogenum Penicillium janthinellum PQxj3, the deposit number is CGMCC NO:40147.

[0049] (III) Growth-promoting bacteria Penicillium purpurogenum strains ( Penicillium janthinellum )Field growth promotion experiment of PQxj3:

[0050] Tobacco is generally cultivated in a greenhouse for about 2 months, so that the tobacco seedlings have 4-6 true leaves, and then they are ready for transplanting. When used for field transplanting, the roots of the tobacco seedlings are dipped in the PQxj 3 microbial agent, and the roots are dipped in an appropriate amount of agent (about 2g of agent per plant), and then transplanted and planted normally (with blank and commercially available Trichoderma harzianum agents as controls), and the agronomic traits of tobacco (plant height, leaf width, leaf length, stem girth, number of leaves, single leaf weight) are counted, and the effect of the strain on tobacco growth is analyzed to confirm that the strain's growth-promoting effect is real and effective, and can increase tobacco yields. The results are shown in Figure 7 and Figure 8 .

[0051] Figure 7 and Figure 8 The results of field trials of the strain PQxj3 showed that the tobacco treated with the tobacco growth-promoting bacteria PQxj3 grew uniformly and its overall growth was better than that of the blank control tobacco. The agronomic traits of tobacco at maturity were statistically analyzed. The agronomic traits of tobacco treated with the tobacco growth-promoting bacteria PQxj3 (plant height 90.25 cm, leaf length 69.67 cm, leaf width 34.25 cm, number of leaves 16.58, stem girth 10.75 cm, single leaf weight 94.07 g) were better than those of the blank control CK group (plant height 81.08 cm, leaf length 64.17 cm, leaf width 30.92 cm, number of leaves 16.25, stem girth 9.92 cm, single leaf weight 79.29 g). In addition, compared with the agronomic traits of the commercially available Trichoderma harzianum agent, the overall agronomic traits of tobacco treated with tobacco growth-promoting bacteria PQxj3 were better than those of the Trichoderma harzianum agent (plant height 84.17 cm, leaf length 68.75 cm, leaf width 33.67 cm, number of leaves 16.25, stem girth 10.67 cm, single leaf weight 90.68 g).

[0052] In summary, the micropurpurogenous Penicillium PQxj3 of the present invention is a strain and a bacterial agent that have a good promoting effect on tobacco growth.

Claims

1. A strain of Penicillium purpurogenum PQxj3, which is classified and named Penicillium janthinellum The collection number of the strain PQxj3 in the General Microbiology Center of China Culture Collection Administration is CGMCC NO: 40147.

2. A bacterial agent prepared by using the micropurpurogenous Penicillium strain PQxj3 according to claim 1, characterized in that: The strain PQxj3 was placed in a conical flask supplemented with bran solid culture medium and cultured at 28±2℃ for 14±2d.

3. The bacterial agent according to claim 2, characterized in that Weigh 40 g of bran, add 32±5 ml of distilled water, mix well, and sterilize at 121° C. for 20-30 min to obtain a bran solid culture medium.

4. Use of the Penicillium purpurogenum strain PQxj3 according to claim 1 in promoting tobacco growth.

5. Use of the bacterial agent according to claim 2 in promoting tobacco growth.

6. The use of the bacterial agent in promoting tobacco growth as claimed in claim 5, characterized in that: When used for field transplanting, dip the roots of the tobacco seedlings in the fungal agent and then transplant and plant normally.

Images