Application of the C2308T SNP site in the TaHDA9-B gene in assisting the selection of wheat with different plant heights

By detecting the C2308T SNP site in the TaHDA9-B gene and using PCR amplification and enzyme digestion methods to distinguish wheat genotypes, the problem of screening and improving wheat plant height traits in existing technologies was solved, and the lodging resistance and yield of wheat were improved.

CN115961064BActive Publication Date: 2025-09-30HEBEI NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202111180599.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-10-11
Publication Date
2025-09-30
Estimated Expiration
2041-10-11

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively screen and improve wheat plant height traits, resulting in insufficient lodging resistance and affecting yield.

Method used

By detecting the C2308T SNP site in the TaHDA9-B gene, PCR amplification and restriction endonuclease digestion were combined to distinguish wheat genotype I and genotype II. The plant height of wheat genotype II was higher than that of genotype I.

Benefits of technology

It achieves efficient screening and improvement of wheat plant height traits, enhances lodging resistance, and thus increases wheat yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003297096640000061
    Figure BDA0003297096640000061
  • Figure BDA0003297096640000071
    Figure BDA0003297096640000071
  • Figure BDA0003297096640000081
    Figure BDA0003297096640000081
Patent Text Reader

Abstract

The present invention discloses the application of the C2308T SNP site in the TaHDA9-B gene in assisting the screening of wheat with different plant heights. The genotype of the wheat to be tested is detected to determine whether it is genotype I or genotype II based on the TaHDA9-B gene. The plant height of the wheat of genotype II is greater than the plant height of the wheat of genotype I. The wheat of genotype I is a wheat whose genotype is CC homozygous based on the C2308T SNP site. The wheat of genotype II is a wheat whose genotype is TT homozygous based on the C2308T SNP site. The C2308T SNP site is the 2308th nucleotide from the 5' end of SEQ ID NO:1 in the wheat genome. Experiments have shown that the wheat plant height trait can be screened by detecting the genotype of the wheat to be tested based on the TaHDA9-B gene. The present invention has important application value in wheat breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to an application of the C2308T SNP site in the TaHDA9-B gene in assisting the screening of wheat with different plant heights. The C2308T SNP site is the 2308th nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome. Background Art

[0002] Wheat (Triticum aestivum L.) is one of my country's most important grain crops. Increasing wheat yield per unit area is a key measure to meet the ever-increasing demand for food and a strategic goal for ensuring food security. Reducing wheat plant height can increase lodging resistance and, consequently, yield. Therefore, plant height is crucial for achieving high and stable wheat yields.

[0003] At present, researchers have located a large number of QTLs that regulate plant height: Gao et al. used a Zhou 842B × Chinese Spring recombinant inbred line population to identify five plant height QTLs located on chromosomes 2A, 4A, 4B, 4D, and 5A; Zhang et al. identified eight QTLs related to plant height on chromosomes 1D, 2B, 3A, 3D, 4A, 4B, 5A, and 6B; Guo et al. conducted association analysis on 215 wheat varieties based on chip marker technology and associated 11 QTL loci related to plant height, which were located on chromosomes 3A, 3B, 5B, 6A, 6B, and 7B respectively; Yu et al. used a RIL population containing 110 lines of ITMI as materials to locate wheat plant height and detected a total of 10 QTL loci that controlled plant height, which were located on chromosomes 3B, 5A, 5B, 6A, and 7D respectively; Bai et al. used double haploid materials (Avalon x Cadenza) to map wheat plant height traits, and a total of five QTLs were detected, located at 2D, 4D, 3A, 3B, and 6A. Although a large number of QTLs related to wheat plant height have been located, the phenotypic contribution of most QTLs is small and the reproducibility is poor across different years and environments. Therefore, these QTLs are difficult to apply to the genetic improvement of wheat plant height.

[0004] CAPS markers, also known as PCR-RFLP (polymerase chain reaction for restriction fragment length polymorphism), are a type of co-dominant molecular marker based on PCR that reveals information on restriction length variation of specific PCR fragments. The basic principle is to amplify the target DNA using PCR, and then digest the amplified product with specific endonucleases to cut it into fragments of different sizes, which are then directly resolved on gel electrophoresis. The restriction enzyme sites of different alleles are distributed differently, resulting in DNA fragment bands of different lengths. The advantage is that it avoids the tedious transfer and hybridization steps in RFLP analysis while maintaining the accuracy of RFLP analysis. However, it is relatively rare for SNPs to be located at restriction enzyme sites. Therefore, the dCAPS marker was proposed. That is, based on the CAPS marker, mismatched bases are introduced into the amplification primers, and new restriction enzyme action sites are introduced in combination with the SNP site to produce a polymorphism similar to the CAPS marker. Summary of the Invention

[0005] The purpose of the present invention is to screen or assist in screening wheat with different plant heights.

[0006] The present invention firstly protects a method for screening or auxiliary screening of wheat with different plant heights.

[0007] The method for screening or assisting in screening wheat with different plant heights protected by the present invention may specifically be method 1, which may include the following steps: detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-B gene, and the plant height of wheat with genotype II is greater than the plant height of wheat with genotype I;

[0008] The wheat of genotype I is a wheat having a CC homozygous genotype based on the C2308T SNP site;

[0009] The wheat of genotype II is a wheat having a genotype of TT homozygous based on the C2308T SNP site;

[0010] The C2308T SNP site is the 2308th nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome.

[0011] The method for screening or assisting in screening wheat of different plant heights protected by the present invention may specifically be method 2, which may include the following steps in sequence:

[0012] (A1) using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1;

[0013] (A2) using the PCR amplification product P1 as a template, performing PCR amplification with primer pair B consisting of primer F2 and primer R2 to obtain a PCR amplification product P2;

[0014] (A3) digesting the PCR amplification product P2 with the restriction endonuclease BamHI to obtain digestion products; and then performing the following evaluation: if the digestion products are two DNA fragments, the genotype of the wheat to be tested based on the TaHDA9-B gene is genotype I; if the digestion products are one DNA fragment, the genotype of the wheat to be tested based on the TaHDA9-B gene is genotype II;

[0015] The plant height of wheat of genotype II was greater than that of wheat of genotype I;

[0016] The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4;

[0017] The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5;

[0018] The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6;

[0019] The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO:7.

[0020] The method for screening or assisting in screening wheat of different plant heights protected by the present invention may specifically be method three, which may include the following steps in sequence:

[0021] (B1) using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1;

[0022] (B2) using the PCR amplification product P1 as a template, performing PCR amplification on primer pair B consisting of primer F2 and primer R2 to obtain a PCR amplification product P2;

[0023] (B3) digesting the PCR amplification product P2 with the restriction endonuclease BamHI to obtain a digestion product; and then performing the following evaluation: if the digestion product contains only a 78 bp DNA fragment and a 22 bp DNA fragment, the genotype of the wheat to be tested based on the TaHDA9-B gene is genotype I; if the digestion product contains only a 100 bp DNA fragment, the genotype of the wheat to be tested based on the TaHDA9-B gene is genotype II;

[0024] The plant height of wheat of genotype II was greater than that of wheat of genotype I;

[0025] The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4;

[0026] The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5;

[0027] The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6;

[0028] The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO:7.

[0029] The method for screening or assisting in screening wheat of different plant heights protected by the present invention may specifically be method 4, which may include the following steps in sequence:

[0030] (C1) using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain a PCR amplification product P1;

[0031] The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4;

[0032] The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5;

[0033] (C2) Sequencing the PCR amplification product P1 and then performing the following evaluation:

[0034] If the nucleotide sequence of the PCR amplification product P1 is as shown in SEQ ID NO: 2, positions 1793 to 2606 from the 5' end, the genotype of the wheat to be tested based on the TaHDA9-B gene is genotype I;

[0035] If the nucleotide sequence of the PCR amplification product P1 is as shown in SEQ ID NO: 3, positions 1793 to 2606 from the 5' end, the genotype of the wheat to be tested based on the TaHDA9-B gene is genotype II;

[0036] The plant height of wheat of genotype II is greater than that of wheat of genotype I.

[0037] The present invention also protects a kit for identifying or assisting in identifying wheat plant height. The kit may include a substance for detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-B gene;

[0038] The genotype I is the TaHDA9-B gene with a CC homozygous genotype based on the C2308T SNP site;

[0039] The genotype II is a TaHDA9-B gene with a genotype of TT homozygous based on the C2308T SNP site;

[0040] The C2308T SNP site is the 2308th nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome.

[0041] The kit may specifically be composed of substances for detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-B gene.

[0042] Any of the above-mentioned substances for detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-B gene may include a primer pair A consisting of primer F1 and primer R1 and / or a primer pair B consisting of primer F2 and primer R2;

[0043] The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4;

[0044] The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5;

[0045] The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6;

[0046] The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO:7.

[0047] Any of the above-mentioned materials for detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-B gene can specifically be composed of the primer pair A and the primer pair B.

[0048] Any of the above-mentioned materials for detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-B gene can specifically be composed of the primer pair A.

[0049] Any of the above-mentioned substances for detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-B gene may further include a restriction endonuclease BamHI.

[0050] Any of the above-mentioned materials for detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-B gene can specifically be composed of the primer pair A, the primer pair B and the restriction endonuclease BamHI.

[0051] The present invention also protects the use of any of the above-mentioned kits, which may be at least one of (z1) to (z4):

[0052] (z1) Screening or assisting in screening wheat with different plant heights;

[0053] (z2) Identify or assist in identifying wheat plant height;

[0054] (z3) identifying or assisting in identifying the genotype of the wheat TaHDA9-B gene;

[0055] (z4) Wheat breeding.

[0056] The present invention also protects the molecular marker shown in SEQ ID NO: 1.

[0057] The present invention also protects the use of the molecular marker represented by SEQ ID NO: 1, which can be at least one of (z1) to (z4):

[0058] (z1) Screening or assisting in screening wheat with different plant heights;

[0059] (z2) Identify or assist in identifying wheat plant height;

[0060] (z3) identifying or assisting in identifying the genotype of the wheat TaHDA9-B gene;

[0061] (z4) Wheat breeding.

[0062] In the above text, when the genotype of the C2308T SNP site in the molecular marker is CC homozygous, the wheat is determined to be genotype I; when the genotype of the C2308T SNP site is TT homozygous, the wheat is determined to be genotype II. The C2308T SNP site is the 2308th nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome. The plant height of genotype II wheat is greater than that of genotype I wheat.

[0063] In the above, the > may specifically be a statistical >.

[0064] Experiments have shown that the method provided by the present invention can be used to detect the genotype of the wheat to be tested based on the TaHDA9-B gene to screen or assist in screening the wheat plant height trait. The present invention has important application value in the process of wheat molecular marker-assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 These are the genotype detection results of the TaHDA9-B gene in some wheat varieties in natural populations. DETAILED DESCRIPTION

[0066] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0067] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0068] The wheat materials used in the following examples were all from the China National Crop Germplasm Bank (website: http: / / icscaas.com.cn / jiguoku / zhongzhiku.htm), and material information can be found on the China Crop Germplasm Information Network (website: http: / / icgr.caas.net.cn). Since the wheat materials are all cultivated varieties, they are usually assumed to be highly homozygous plant materials with homozygous genotypes.

[0069] Example 1. Discovery of the C2308T SNP in the wheat TaHDA9-B gene and establishment of a wheat genotyping method based on the TaHDA9-B gene

[0070] 1. Discovery of the C2308T SNP in the TaHDA9-B gene in wheat

[0071] After extensive experiments, the inventors of the present invention discovered a single-nucleotide polymorphism (SNP) site in the wheat TaHDA9-B gene (nucleotide sequence shown in SEQ ID NO:1), designated the C2308T SNP. The C2308T SNP is located at position 2308 from the 5' end of SEQ ID NO:1, and the genotypes are CC homozygous and TT homozygous. Because genomic DNA is a double-stranded DNA molecule composed of two reverse-complementary single-stranded DNA molecules, the DNA molecule encoding the protein is generally designated as the sense DNA molecule, and the DNA molecule that is the reverse complement of the sense DNA molecule is designated as the antisense DNA molecule. The genotype of the C2308T SNP is always the sense DNA genotype. The nucleotide sequence shown in SEQ ID NO:1 is a reference sequence downloaded from the website http: / / plants.ensembl.org / index.html, and the Gene ID is TraesCS2B02G309700.

[0072] Wheat is divided into two genotypes based on the differences in the TaHDA9-B gene: TaHDA9-BC (hereinafter referred to as genotype I) and TaHDA9-BT (hereinafter referred to as genotype II). The nucleotide sequence of the TaHDA9-B gene in genotype I wheat is shown in SEQ ID NO: 2. The nucleotide sequence of the TaHDA9-B gene in genotype II wheat is shown in SEQ ID NO: 3.

[0073] 2. Synthesis of Primer Pair A and Primer Pair B for Amplifying the Target Sequence Including the C2308T SNP

[0074] Primer pair A and primer pair B were designed and synthesized for amplifying a target sequence including the C2308T SNP. Primer pair A consisted of primer F1 and primer R1. Primer pair B consisted of primer F2 and primer R2.

[0075] The nucleotide sequences of each primer are as follows:

[0076] Primer F1: 5′-GATTTACCTCAAGGGAACACAATAAGATGG-3′ (SEQ ID NO: 4)

[0077] Primer R1: 5′-GCTCTGAAGATCAGTGAGACACATCCTATC-3′ (SEQ ID NO: 5)

[0078] Primer F2: 5′-AGCTTCTCAAGTATCATGCTAGGAT-3′ (SEQ ID NO: 6)

[0079] Primer R2: 5′-AGCATGAACCTGTCAGTGAAATAGA-3′ (SEQ ID NO: 7)

[0080] The target sequence amplified by primer pair A is shown in SEQ ID NO: 1, positions 1793 to 2606 from the 5' end.

[0081] 3. Establishment of a wheat genotyping method based on the TaHDA9-B gene

[0082] 1. Extract the genomic DNA of the wheat to be tested.

[0083] 2. Using the genomic DNA of the wheat to be tested in step 1 as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1.

[0084] The reaction system was 10 μL, consisting of 3.6 μL ddH2O, 5 μL 2×Taq enzyme Mix, 0.2 μL primer F1 aqueous solution (concentration of 10 μmol / L), 0.2 μL primer R1 aqueous solution (concentration of 10 μmol / L) and 1 μL genomic DNA of the wheat to be tested (concentration of 20 ng / μL).

[0085] 2×Taq enzyme Mix was a product of Nanjing Novozymes Co., Ltd., with the product catalog number being P131.

[0086] The reaction conditions were as follows: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 15 s, 32 cycles; 72°C for 10 min; and storage at 16°C.

[0087] 3. After completing step 2, using the diluted solution of PCR amplification product P1 (a mixture of 1 volume part PCR amplification product P1 and 9 volume parts water) as a template, PCR amplification is performed using primer pair B consisting of primer F2 and primer R2 to obtain PCR amplification product P2.

[0088] The reaction system was 10 μL, consisting of 3.6 μL ddH2O, 5 μL 2×Taq enzyme Mix, 0.2 μL primer F2 aqueous solution (concentration of 10 μmol / L), 0.2 μL primer R2 aqueous solution (concentration of 10 μmol / L) and 1 μL dilution of PCR amplification product P1.

[0089] The reaction conditions were as follows: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 10 s, 32 cycles; 72°C for 10 min; and storage at 16°C.

[0090] 4. The PCR amplification product P2 obtained in step 3 was digested with the restriction endonuclease BamHI to obtain a digestion product; the digestion product was subjected to 4% agarose gel electrophoresis and the following judgment was made: if the digestion product was band type A (displaying two bands of 78 bp and 22 bp, respectively), the wheat C2308T SNP to be tested was CC homozygous, that is, the genotype of the wheat to be tested based on the TaHDA9-B gene was genotype I; if the digestion product was band type B (displaying one band of 100 bp), the wheat C2308T SNP to be tested was TT homozygous, that is, the genotype of the wheat to be tested based on the TaHDA9-B gene was genotype II.

[0091] Example 2: Association analysis and verification between wheat TaHDA9-B gene genotype and wheat plant height

[0092] 1. Genotyping of individual wheat TaHDA9-B genes in natural populations

[0093] Genotyping of each wheat variety in a natural population was performed using the method of step 3 in Example 1. The natural population consisted of 295 wheat varieties (all hexaploid). The wheat variety names are detailed in Table 1.

[0094] Some test results can be found in Figure 1 (M is a DNA marker, and the other lanes represent different wheat varieties; T is a wheat variety of genotype II, and C is a wheat variety of genotype I).

[0095] The genotypes of 295 wheat varieties based on the TaHDA9-B gene are shown in Table 1: the genotypes of 62 wheat varieties based on the TaHDA9-B gene are genotype II, and the genotypes of 233 wheat varieties based on the TaHDA9-B gene are genotype I.

[0096] Table 1

[0097]

[0098]

[0099]

[0100]

[0101]

[0102] Note: I is genotype I, II is genotype II.

[0103] 2. Plant height trait detection

[0104] 295 wheat varieties were planted in nine environments, and the average plant height of two genotypes of wheat under different planting conditions was calculated.

[0105] The statistical results are shown in Table 2.

[0106] Table 2

[0107]

[0108]

[0109] Note: P value is the significance level of the association analysis. * " indicates P < 0.05," ** ” indicates P < 0.01.

[0110] 3. Correlation Analysis

[0111] The Tassel2.1 software was used to select the single linear model + population structure (GLM + PCA) method to conduct an association analysis between the genotype of the wheat TaHDA9-B gene and plant height in the natural population. The results are shown in Table 2.

[0112] The results showed that, in a natural population of 295 wheat varieties, the plant height of genotype II wheat was greater than that of genotype I wheat; the ">" represents a statistically significant difference. Studies of natural populations have shown that genotype I is an excellent genotype for reducing wheat plant height.

[0113] The above results indicate that the plant height trait of wheat can be screened or assisted in screening by detecting the genotype of the wheat to be tested based on the TaHDA9-B gene, which has important application value in the process of wheat molecular marker-assisted breeding.

[0114] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims. <110> Hebei Normal University <120> Application of the C2308T SNP site in the TaHDA9-B gene in assisting the selection of wheat with different plant heights <160> 7 <170> PatentIn version 3.5 <210> 1 <211> 5993 <212> DNA <213> Triticum aestivum L. <220> <221> <222> (2308)…(2308) <223> m is c or t <400> 1 taattcacccgcgcaataatgttgaccgtccgatcatggtatcaacacgattctgactgt 60 ccatgccggtccagaacgttccccagagacatcgcctcgctcggttttccccttcctcct 120 cacgcacgaccgccccaacttccgccgccgcctccgccgtcgcgaactcgctgtcggctt 180 ccccgtccgcccccattcggcgccgcctccgcctgtagaggcaggcggccgctcgagagc 240 gaggtcatgttggagaaagacaggatatcctatttctacgatggtatgttccctacnnnn 300 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 360 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 420 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 480 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 540 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 600 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 660 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 720 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 780 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 840 nnnnnnagttctctcctggtcgcaagtcgctactcttgatgctatgtgctatgtgccatc 900 gggacctgttcaactagaattggtgtgaccctgttatttggcctactatttccttgagtt 960 gttcaacctagcagtcagtgcgttataaaattgcgttagtgtttgcttcattctaggtca 1020 gataaagaagtcaaatggtaaaaattgctgcgctatttgtttgatttggttctcatgact 1080 agttccttaactgtgttgtttgtagaaaatccacacaccttcaacactatataagttttt 1140 tcgctgttcaaccttttatgattgcttacttggttacttttctgtgaccgaacatctcag 1200 gggatgttggcaatgtgtactttgggccaaatcatccgatgaaaccgcatcgcctttgca 1260 tgacacatcatctcgtgttatcatatgaccttcacaagaaaatggagatatatgtcggta 1320 ttgaattatgttcatcccctttctttgtacttatgaattgtttacatgtgtcttttacct 1380 tattttgctcccattggattttgcagagaccccacaaagcatatccaacagagcttgcgc 1440 agttccattctgctgattatgtggaattcttgcaccgaataactcctgatacccagcact 1500 tgtatgcaaatgaattaactagatgtatgaatgatgatatttctctcttttacagactac 1560 tctcccaggctttgctattttcacaatgcaatacatgccgcacatattgctcgcttatat 1620 ttagctgtaaaaaatcatgtcaaaacttggttagaacatgtgtatgacgagtggaccatg 1680 tgccatgtgcctaagatttgtggctcgccacagttgtttatatgaaccaaacgccagcag 1740 catttggtcaaacttgcgtaacttctgacaccgaaccaaaaactcccaaaatgatttacc 1800 tcaagggaacacaataagatggtctgacctctcaacaaattgttatatccaaatggaagc 1860 ttagctgtttgcacttaaataagaactgtctgctatactttccacaatatgcctgttgt 1920 actaaatggaattgctataaatcacatctacatgtatttggggtttcttacttcactta 1980 tctgacttcgtcattgtaatcattgtcccagacaaccttggagaggactgcccggtcttt 2040 gatgatttgtttgagttctgccaaatctatgctggaggaactctaggataatgaaaatt 2100 gccaatgcttctttctgttttgtgatctgtctaagcatttctttatttttcagatgcggc 2160 tcgaagactaaatcataaaacatgtgatattgctattaattgggctggtgggctgcatca 2220 tgcaaagaagtgtgaggcgtcaggcttctgctacattaatgacctggttttgggaattct 2280 ggagcttctcaagtatcatgctagggtmctctatattgacattgatgtccatcatggaga 2340 tggagttgaagaagccttttatttcactgacaggttcatgcttttatggatagtaaaata 2400 ctccctccgttcctatatataagtctctctagagattccactatggactacatacggagc 2460 aaaatgagtgaattttacactctaaaatatgtctatatacatccatatgtagtttgtagtg 2520 gaatctctaaaaagacttatatttaggaatggaggggatcatgacagtaattggtgata 2580 ggatgtgtctcactgatcttcagagcctccatagacgcctactcttttgttgtcaccata 2640 tattcagtttagtcgctatctctggctctgtcttctaagatggttagtgcgaggttgctg 2700 tatagtaatgccgctgtctcttcgagagcctttagatttcctatctgattttatctatac 2760 atatttgcagggtaatgactgtaagtttccacaagtatggtgacatgttctttcctggca 2820 caggtgatattaaaggtaatgttccactgacaagttttatgaatatacattttatgtagtt 2880 gcctttacttaatttcgcagtagttcatcgcaattattttcagtttgtatcttagtttgt 2940 gctcaatattgggcatgggttttatggtgtttgttgttccctatttacttatgtcgatta 3000 aagttggaatgtgaactctcaattgtatgaaatagaagagacatttacaaactgagttac 3060 aatgggttttagcataatattactcaaagttgatggtactggaggtaatcaataattcta 3120 ggaaccatcgtgacatacttcagtttcttcttttcttcactctctcctgtccatctagaa 3180 catgtatgtgacttttatcattgaactcttgtctccattactggacaatcttggtgcggt 3240 attctatccaaatagccagcatcatatttgggaatagtggaggtttatgatctatatttg 3300 ataagcggtagtgccaaaaaggatgttcttcattctgatgcatgtattatcatctgagct 3360 tagaagaatagaagctgtcaactgaccaacaactcttgcggtcatgcttgaaccatca 3420 cttcaagattcactttatcgtttttgtaatgggtctttactttttgccataatgctatttt 3480 tgcacatattttgcgtgcatctgtatgagtggaagggttctttacgcaattgtcttt 3540 gattttagttgcgagttctccaatcaaaattaccccatcactagagtttgtaactcacat 3600 agaggaagggcaaggttcgatatgagcagaaatgtgcgctttctgtgtttattaacatgtt 3660 gaaaaaatggcgcttacagagcttgcatcttgctttgtttaataagttcaatatc 3720 gtgctgttaagtaatgatgatgagagctttaaaaatttagcttcattttagaaggatgt 3780 gctcttcatatcgatttacctggctgtcatttgaaggatatgggagacagggaaaa 3840 atattatgcaatcacatcccacttaagatggcatagatgacatcagttttactcggct 3900 ttttaaaacggtaaaagtcaatgtgcattactttatgtcatcatgttcttgttcgcta 3960 ctcttattgaggtatgtaatgttgcttatcatgtagattattgccaaagttgttgagaca 4020 tatctgccaggtgctattgttcttcaatgtggggctgattcattggcgcgagaccgcta 4080 gggtgtttcaatctttcaatagaaggtactctctgaaacttgatattacgtgctactata 4140 gatttggcaaaacatccagatgtataaactaaccgcgattaccttgtccccactgttgaa 4200 attttgtattctgagaattttcttgcgttgatggtatttggggtcctttggacttcagtt 4260 tcattgagctaactcactcggataatctattattatacttactaacttgatctgtttcca 4320 taaacaggccatgctgaatgtgtaaagtttgttaagaaatttaaaatcccgctgctggta 4380 agggagaaaactatcatcgtatgattatctttgctctttctaggatattcatgtatttca 4440 aacatgcaggtgacaggaggtggtgggtacaccaaagagaatgtagcacgctgttgggct 4500 gttgaaactggggttcttctagacacagaactcccaaatggtatctcatttgtttgttct 4560 gctccccttaaccttgttggtttgagtgtcagtagctagtaatccttcaatatagcggca 4620 tttttcttgtattctttttcttttcttttcttgatcttttaaggtgaaaagtgaaaatgaat 4680 ccaatactgtcctaatactcttcccttatagtactactttctgtaagcaattcttcctta 4740 gtggttatccattgtccggagttttacatggcattttctttgcagagatccctgacaatg 4800 aatacattgagtacttcggtccagattatacattgaaagtgccaaatctgaacatggtat 4860 gaacctttctgattgatctttctaactctatgcctgcctggtgttgtggatttaactgtt 4920 gtttggtgcgtcatgtttttatatgttgggtacgcttaactagaatatcaacttctttct 4980 tgagatgtgtagatgtgcaaatgatatttgtcttcctattgatgatggaccaggaca 5040 acttgaatagtaagacgtatctcagttcaatcaaagtgcaagtaatggagagtttgcggg 5100 ccatacaacatgcacctggcgttcagatgcaagaggttagtttgtattcccatttgcttg 5160 ttggttgttgaaacatcccaattaaaactggggatggatactatgtgaagactagaatac 5220 gcctttgcatcttttgttgtctttttttcttgcttccaccaggatagtgtagtttgtt 5280 gtttctgagcagagaccggatacataatgagtttattttgcaggttccacccgatttcta 5340 tgtcccggattttgatgaagacgagctggatcctgatgaacgtgttgatcgtaagtgaaa 5400 tacctctggcatgtctgacagtgctcatttggacgagtaaaaacttgatgatttctccgt 5460 gcaaactcgccattgtcctctcgaagcatatgcacgccacataatgagaaatttcccctg 5520 aaatgaaataaatgttatctatttattcttaaattggctgtatccttcttcattcagcca 5580 cttttgaaccgtgccatcatactatttctttacagaagtgtgtattatttcatgcagagc 5640 atacccaagacaagcaggttcatcgtgacgacgagtactatgaaggcgacaatgacaatg 5700 atcatgatgacggcggacattgaaatcggcatcttggtgatgtatgtaggtggaagctga 5760 aagtctttcctgcagcagcagcagctgttcagtttaacatcgtgggatgggaaatagttg 5820 gctggttgacattttaggaggatctaacgcctagggctgggaagcattgtgggagaatgt 5880 aacacttcctgacttgtacaacatcgtacgatttcgctgtacttaaacactccctccaat 5940 ccgaattaattgacgcagtctcatacaatggcaaaaggagtaccatcttttca 5993 <210> 2 <211> 5993 <212> DNA <213> Triticumaestivum L. <400> 2 taattcacccgcgcaataatgttgaccgtccgatcatggtatcaacacgattctgactgt 60 ccatgccggtccagaacgttccccagagacatcgcctcgctcggttttccccttcctcct 120 cacgcacgaccgccccaacttccgccgccgcctccgccgtcgcgaactcgctgtcggctt 180 ccccgtccgcccccattcggcgccgcctccgcctgtagaggcaggcggccgctcgagagc 240 gaggtcatgttggagaaagacaggatatcctatttctacgatggtatgttccctacnnnn 300 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 360 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 420 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 480 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 540 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 600 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 660 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 720 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 780 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 840 nnnnnnagttctctcctggtcgcaagtcgctactcttgatgctatgtgctatgtgccatc 900 gggacctgttcaactagaattggtgtgaccctgttatttggcctactatttccttgagtt 960 gttcaacctagcagtcagtgcgttataaaattgcgttagtgtttgcttcattctaggtca 1020 gataaagaagtcaaatggtaaaaattgctgcgctatttgtttgatttggttctcatgact 1080 agttccttaactgtgttgtttgtagaaaatccacacaccttcaacactatataagttttt 1140 tcgctgttcaaccttttatgattgcttacttggttacttttctgtgaccgaacatctcag 1200 gggatgttggcaatgtgtactttgggccaaatcatccgatgaaaccgcatcgcctttgca 1260 tgacacatcatctcgtgttatcatatgaccttcacaagaaaatggagatatatgtcggta 1320 ttgaattatgttcatcccctttctttgtacttatgaattgtttacatgtgtcttttacct 1380 tattttgctcccattggattttgcagagaccccacaaagcatatccaacagagcttgcgc 1440 agttccattctgctgattatgtggaattcttgcaccgaataactcctgatacccagcact 1500 tgtatgcaaatgaattaactagatgtatgaatgatgatatttctctcttttacagactac 1560 tctcccaggctttgctattttcacaatgcaatacatgccgcacatattgctcgcttatat 1620 ttagctgtaaaaaatcatgtcaaaacttggttagaacatgtgtatgacgagtggaccatg 1680 tgccatgtgcctaagatttgtggctcgccacagttgtttatatgaaccaaacgccagcag 1740 catttggtcaaacttgcgtaacttctgacaccgaaccaaaaactcccaaaatgatttacc 1800 tcaagggaacacaataagatggtctgacctctcaacaaattgttatatccaaatggaagc 1860 ttagctgtttgcacttaaataagaactgtctgctatactttccacaatatgcctgttgt 1920 actaaatggaattgctataaatcacatctacatgtatttggggtttcttacttcactta 1980 tctgacttcgtcattgtaatcattgtcccagacaaccttggagaggactgcccggtcttt 2040 gatgatttgtttgagttctgccaaatctatgctggaggaactctaggataatgaaaatt 2100 gccaatgcttctttctgttttgtgatctgtctaagcatttctttatttttcagatgcggc 2160 tcgaagactaaatcataaaacatgtgatattgctattaattgggctggtgggctgcatca 2220 tgcaaagaagtgtgaggcgtcaggcttctgctacattaatgacctggttttgggaattct 2280 ggagcttctcaagtatcatgctagggtcctctatattgacattgatgtccatcatggaga 2340 tggagttgaagaagccttttatttcactgacaggttcatgcttttatggatagtaaaata 2400 ctccctccgttcctatatataagtctctctagagattccactatggactacatacggagc 2460 aaaatgagtgaattttacactctaaaatatgtctatatacatccatatgtagtttgtagtg 2520 gaatctctaaaaagacttatatttaggaatggagggagtacatgacagtaattggtgata 2580 ggatgtgtctcactgatcttcagagcctccatagacgcctactcttttgttgtcaccata 2640 tattcagtttagtcgctatctctggctctgtcttctaagatggttagtgcgaggttgctg 2700 tatagtaatgccgctgtctcttcgagagcctttagatttcctatctgattttatctatac 2760 atatttgcagggtaatgactgtaagtttccacaagtatggtgacatgttctttcctggca 2820 caggtgatattaaaggtaatgttccactgacaagttttatgaatatacattttatgtagtt 2880 gcctttacttaatttcgcagtagttcatcgcaattattttcagtttgtatcttagtttgt 2940 gctcaatattgggcatgggttttatggtgtttgttgttccctatttacttatgtcgatta 3000 aagttggaatgtgaactctcaattgtatgaaatagaagagacatttacaaactgagttac 3060 aatgggttttagcataatattactcaaagttgatggtactggaggtaatcaataattcta 3120 ggaaccatcgtgacatacttcagtttcttcttttcttcactctctcctgtccatctagaa 3180 catgtatgtgacttttatcattgaactcttgtctccattactggacaatcttggtgcggt 3240 attctatccaaatagccagcatcatatttgggaatagtggaggtttatgatctatatttg 3300 ataagcggtagtgccaaaaaggatgttctcattctgatgcatgtattatcatctgagct 3360 tagaagaatagaagctgtcaactgaccaacaactcttgcggtcatgcttgaaccatca 3420 cttcaagattcactttatcgtttttgtaatgggtctttactttttgccataatgctatttt 3480 tgcacatattttgcgtgcatctgtatgagtggaagggttctttacgcaattgtcttt 3540 gattttagttgcgagttctccaatcaaaattaccccatcactagagtttgtaactcacat 3600 agaggaagggcaaggttcgatatgagcagaaatgtgcgctttctgtgtttattaacatgtt 3660 gaaaaaatggcgcttacagagcttgcatcttgctttgtttaataagttcaatatc 3720 gtgctgttaagtaatgatgatgagagctttaaaaatttagcttcattttagaaggatgt 3780 gctcttcatatcgatttacctggctgtcatttgaaggatatgggagacagggaaaa 3840 atattatgcaatcacatcccacttaagatggcatagatgacatcagttttactcggct 3900 ttttaaaacggtaaaagtcaatgtgcattactttatgtcatcatgttcttgttcgcta 3960 ctcttattgaggtatgtaatgttgcttatcatgtagattattgccaaagttgttgagaca 4020 tatctgccaggtgctattgttcttcaatgtggggctgattcattggcgcgagaccgccta 4080 gggtgtttcaatctttcaatagaaggtactctctgaaacttgatattacgtgctactata 4140 gatttggcaaaacatccagatgtataaactaaccgcgattaccttgtccccactgttgaa 4200 attttgtattctgagaattttcttgcgttgatggtatttggggtcctttggacttcagtt 4260 tcattgagctaactcactcggataatctattattatacttactaacttgatctgtttcca 4320 taaacaggccatgctgaatgtgtaaagtttgttaagaaatttaaaatcccgctgctggta 4380 agggagaaaactatcatcgtatgattatctttgctctttctaggatattcatgtatttca 4440 aacatgcaggtgacaggaggtggtgggtacaccaaagagaatgtagcacgctgttgggct 4500 gttgaaactggggttcttctagacacagaactcccaaatggtatctcatttgtttgttct 4560 gctccccttaaccttgttggtttgagtgtcagtagctagtaatccttcaatatagcggca 4620 tttttcttgtattctttttcttttcttttcttgatcttttaaggtgaaaagtgaaaatgaat 4680 ccaatactgtcctaatactcttcccttatagtactactttctgtaagcaattcttcctta 4740 gtggttatccattgtccggagttttacatggcattttctttgcagagatccctgacaatg 4800 aatacattgagtacttcggtccagattatacattgaaagtgccaaatctgaacatggtat 4860 gaacctttctgattgatctttctaactctatgcctgcctggtgttgtggatttaactgtt 4920 gtttggtgcgtcatgtttttatatgttgggtacgcttaactagaatatcaacttctttct 4980 tgagatgtgtagatgtgcaaatgatatttgtcttcctattgatgatggaccaggaca 5040 acttgaatagtaagacgtatctcagttcaatcaaagtgcaagtaatggagagtttgcggg 5100 ccatacaacatgcacctggcgttcagatgcaagaggttagtttgtattcccatttgcttg 5160 ttggttgttgaaacatcccaattaaaactggggatggatactatgtgaagactagaatac 5220 gcctttgcatcttttgttgtctttttttcttgcttccaccaggatagtgtagtttgtt 5280 gtttctgagcagagaccggatacataatgagtttattttgcaggttccacccgatttcta 5340 tgtcccggattttgatgaagacgagctggatcctgatgaacgtgttgatcgtaagtgaaa 5400 tacctctggcatgtctgacagtgctcatttggacgagtaaaaacttgatgatttctccgt 5460 gcaaactcgccattgtcctctcgaagcatatgcacgccacataatgagaaatttcccctg 5520 aaatgaaataaatgttatctatttattcttaaattggctgtatccttcttcattcagcca 5580 cttttgaaccgtgccatcatactatttctttacagaagtgtgtattatttcatgcagagc 5640 atacccaagacaagcaggttcatcgtgacgacgagtactatgaaggcgacaatgacaatg 5700 atcatgatgacggcggacattgaaatcggcatcttggtgatgtatgtaggtggaagctga 5760 aagtctttcctgcagcagcagcagctgttcagtttaacatcgtgggatgggaaatagttg 5820 gctggttgacattttaggaggatctaacgcctagggctgggaagcattgtgggagaatgt 5880 aacacttcctgacttgtacaacatcgtacgatttcgctgtacttaaacactccctccaat 5940 ccgaattaattgacgcagtctcatacaatggcaaaaggagtaccatcttttca 5993 <210> 3 <211> 5993 <212> DNA <213> Triticumaestivum L. <400> 3 taattcacccgcgcaataatgttgaccgtccgatcatggtatcaacacgattctgactgt 60 ccatgccggtccagaacgttccccagagacatcgcctcgctcggttttccccttcctcct 120 cacgcacgaccgccccaacttccgccgccgcctccgccgtcgcgaactcgctgtcggctt 180 ccccgtccgcccccattcggcgccgcctccgcctgtagaggcaggcggccgctcgagagc 240 gaggtcatgttggagaaagacaggatatcctatttctacgatggtatgttccctacnnnn 300 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 360 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 420 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 480 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 540 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 600 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 660 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 720 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 780 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 840 nnnnnnagttctctcctggtcgcaagtcgctactcttgatgctatgtgctatgtgccatc 900 gggacctgttcaactagaattggtgtgaccctgttatttggcctactatttccttgagtt 960 gttcaacctagcagtcagtgcgttataaaattgcgttagtgtttgcttcattctaggtca 1020 gataaagaagtcaaatggtaaaaattgctgcgctatttgtttgatttggttctcatgact 1080 agttccttaactgtgttgtttgtagaaaatccacacaccttcaacactatataagttttt 1140 tcgctgttcaaccttttatgattgcttacttggttacttttctgtgaccgaacatctcag 1200 gggatgttggcaatgtgtactttgggccaaatcatccgatgaaaccgcatcgcctttgca 1260 tgacacatcatctcgtgttatcatatgaccttcacaagaaaatggagatatatgtcggta 1320 ttgaattatgttcatcccctttctttgtacttatgaattgtttacatgtgtcttttacct 1380 tattttgctcccattggattttgcagagaccccacaaagcatatccaacagagcttgcgc 1440 agttccattctgctgattatgtggaattcttgcaccgaataactcctgatacccagcact 1500 tgtatgcaaatgaattaactagatgtatgaatgatgatatttctctcttttacagactac 1560 tctcccaggctttgctattttcacaatgcaatacatgccgcacatattgctcgcttatat 1620 ttagctgtaaaaaatcatgtcaaaacttggttagaacatgtgtatgacgagtggaccatg 1680 tgccatgtgcctaagatttgtggctcgccacagttgtttatatgaaccaaacgccagcag 1740 catttggtcaaacttgcgtaacttctgacaccgaaccaaaaaactcccaaaatgatttacc 1800 tcaagggaacacaataagatggtctgacctctcaacaaattgttatatccaaatggaagc 1860 ttagctgtttgcacttaaataagaactgtctgctatactttccacaatatgcctgttgt 1920 actaaatggaattgctataaatcacatctacatgtatttggggtttcttacttcactta 1980 tctgacttcgtcattgtaatcattgtcccagacaaccttggagaggactgcccggtcttt 2040 gatgatttgtttgagttctgccaaatctatgctggaggaactctaggataatgaaaatt 2100 gccaatgcttctttctgttttgtgatctgtctaagcatttctttatttttcagatgcggc 2160 tcgaagactaaatcataaaacatgtgatattgctattaattgggctggtgggctgcatca 2220 tgcaaagaagtgtgaggcgtcaggcttctgctacattaatgacctggttttgggaattct 2280 ggagcttctcaagtatcatgctagggttctctatattgacattgatgtccatcatggaga 2340 tggagttgaagaagccttttatttcactgacaggttcatgcttttatggatagtaaaata 2400 ctccctccgttcctatatataagtctctctagagattccactatggactacatacggagc 2460 aaaatgagtgaatttacactctaaaatatgtctatatacatccatatgtagtttgtagtg 2520 gaatctctaaaaagacttatatttaggaatggagggagtacatgacagtaattggtgata 2580 ggatgtgtctcactgatcttcagagcctccatagacgcctactcttttgttgtcaccata 2640 tattcagtttagtcgctatctctggctctgtcttctaagatggttagtgcgaggttgctg 2700 tatagtaatgccgctgtctcttcgagagcctttagatttcctatctgattttatctatac 2760 atatttgcagggtaatgactgtaagtttccacaagtatggtgacatgttctttcctggca 2820 caggtgatattaaaggtaatgttccactgacaagttttatgaatatacattttatgtagtt 2880 gcctttacttaatttcgcagtagttcatcgcaattattttcagtttgtatcttagtttgt 2940 gctcaatattgggcatgggttttatggtgtttgttgttccctatttacttatgtcgatta 3000 aagttggaatgtgaactctcaattgtatgaaatagaagagacatttacaaactgagttac 3060 aatgggttttagcataatattactcaaagttgatggtactggaggtaatcaataattcta 3120 ggaaccatcgtgacatacttcagtttcttcttttcttcactctctcctgtccatctagaa 3180 catgtatgtgacttttatcattgaactcttgtctccattactggacaatcttggtgcggt 3240 attctatccaaatagccagcatcatatttgggaatagtggaggtttatgatctatattg 3300 ataagcggtagtgccaaaaaggatgttctcattctgatgcatgtattatcatctgagct 3360 tagaagaatagaagctgtcaactgaccaacaactcttgcggtcatgcttgaaccatca 3420 cttcaagattcactttatcgtttttgtaatgggtctttactttttgccataatgctatttt 3480 tgcacatattttgcgtgcatctgtatgagtggaagggttctttacgcaattgtcttt 3540 gattttagttgcgagttctccaatcaaaattaccccatcactagagtttgtaactcacat 3600 agaggaagggcaaggttcgatatgagcagaaatgtgcgctttctgtgtttattaacatgtt 3660 gaaaaaatggcgcttacagagcttgcatcttgctttgtttaataagttcaatatc 3720 gtgctgttaagtaatgatgatgagagctttaaaaatttagcttcattttagaaggatgt 3780 gctcttcatatcgatttacctggctgtcatttgaaggatatgggagacagggaaaa 3840 atattatgcaatcacatcccacttaagatggcatagatgacatcagttttactcggct 3900 ttttaaaacggtaaaagtcaatgtgcattactttatgtcatcatgttcttgttcgcta 3960 ctcttattgaggtatgtaatgttgcttatcatgtagattattgccaaagttgttgagaca 4020 tatctgccaggtgctattgttcttcaatgtggggctgattcattggcgcgagaccgccta 4080 gggtgtttcaatctttcaatagaaggtactctctgaaacttgatattacgtgctactata 4140 gatttggcaaaacatccagatgtataaactaaccgcgattaccttgtccccactgttgaa 4200 attttgtattctgagaattttcttgcgttgatggtatttggggtcctttggacttcagtt 4260 tcattgagctaactcactcggataatctattattatacttactaacttgatctgtttcca 4320 taaacaggccatgctgaatgtgtaaagtttgttaagaaatttaaaatcccgctgctggta 4380 agggagaaaactatcatcgtatgattatctttgctctttctaggatattcatgtatttca 4440 aacatgcaggtgacaggaggtggtgggtacaccaaagagaatgtagcacgctgttgggct 4500 gttgaaactggggttcttctagacacagaactcccaaatggtatctcatttgtttgttct 4560 gctccccttaaccttgttggtttgagtgtcagtagctagtaatccttcaatatagcggca 4620 tttttcttgtattctttttcttttcttttcttgatcttttaaggtgaaaagtgaaaatgaat 4680 ccaatactgtcctaatactcttcccttatagtactactttctgtaagcaattcttcctta 4740 gtggttatccattgtccggagttttacatggcattttctttgcagagatccctgacaatg 4800 aatacattgagtacttcggtccagattatacattgaaagtgccaaatctgaacatggtat 4860 gaacctttctgattgatctttctaactctatgcctgcctggtgttgtggatttaactgtt 4920 gtttggtgcgtcatgtttttatatgttgggtacgcttaactagaatatcaacttctttct 4980 ttagagatgtgtagatgtgcaaatgatatttgtcttcctattgatgaatggaccaggaca 5040 acttgaatagtaagacgtatctcagttcaatcaaagtgcaagtaatggagagtttgcggg 5100 ccatacaacatgcacctggcgttcagatgcaagaggttagtttgtattcccatttgcttg 5160 ttggttgttgaaacatcccaattaaaactggggatggatactatgtgaagactagaatac 5220 gcctttgcatcttttgttgtctttatttttcttgcttccaccaggatagtgtagtttgtt 5280 gtttctgagcagagaccggatacataatgagtttattttgcaggttccacccgatttcta 5340 tgtcccggattttgatgaagacgagctggatcctgatgaacgtgttgatcgtaagtgaaa 5400 tacctctggcatgtctgacagtgctcatttggacgagtaaaaacttgatgatttctccgt 5460 gcaaactcgccattgtcctctcgaagcatatgcacgccacataatgagaaatttcccctg 5520 aaatgaaataaatgttatctatttattcttaaattggctgtatccttcttcattcagcca 5580 cttttgaaccgtgccatcatactatttctttacagaagtgtgtattatttcatgcagagc 5640 atacccaagacaagcaggttcatcgtgacgacgagtactatgaaggcgacaatgacaatg 5700 atcatgatgacggcggacattgaaatcggcatcttggtgatgtatgtaggtggaagctga 5760 aagtctttcctgcagcagcagcagctgttcagtttaacatcgtgggatgggaaatagttg 5820 gctggttgacattttaggaggatctaacgcctagggctgggaagcattgtgggagaatgt 5880 aacacttcctgacttgtacaacatcgtacgatttcgctgtacttaaacactccctccaat 5940 ccgaattaattgacgcagtctcatacaatggcaaaaggagtaccatcttttca 5993 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <400> 4 gatttacctcaagggaacacaataagatgg 30 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <400> 5 gctctgaagatcagtgagacacatcctatc 30 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <400> 6 agcttctcaagtatcatgctaggat 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <400> 7 agcatgaacctgtcagtgaaataga 25

Claims

1. A method for screening or assisting in screening wheat with different plant heights, comprising the following steps: detecting the wheat to be tested based on TaHDA9-B Whether the genotype of the gene is genotype I or genotype II, the plant height of wheat of genotype II is greater than the plant height of wheat of genotype I; The wheat of genotype I is a wheat having a CC homozygous genotype based on the C2308T SNP site; The wheat of genotype II is a wheat having a genotype of TT homozygous based on the C2308T SNP site; The C2308T SNP site is the 2308th nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome.

2. A method for screening or assisting in screening wheat of different plant heights, comprising the following steps in sequence: (A1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1; (A2) using the PCR amplification product P1 as a template, performing PCR amplification on primer pair B consisting of primer F2 and primer R2 to obtain a PCR amplification product P2; (A3) The PCR amplification product P2 is digested with restriction endonuclease BamHI to obtain digestion products; and then the following evaluation is performed: if the digestion products are two DNA fragments, the wheat to be tested is based on TaHDA9-B The genotype of the gene is genotype I; if the enzyme cleavage product is a DNA fragment, the wheat to be tested is based on TaHDA9-B The genotype of the gene is genotype II; The plant height of wheat of genotype II was greater than that of wheat of genotype I; The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4; The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5; The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6; The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO:

7.

3. A method for screening or assisting in screening wheat of different plant heights, comprising the following steps in sequence: (B1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1; (B2) using the PCR amplification product P1 as a template, performing PCR amplification on primer pair B consisting of primer F2 and primer R2 to obtain a PCR amplification product P2; (B3) The PCR amplification product P2 is digested with restriction endonuclease BamHI to obtain digestion products; and then the following evaluation is performed: if the digestion products contain only 78 bp DNA fragments and 22 bp DNA fragments, the wheat to be tested is TaHDA9-B The genotype of the gene is genotype I; if the enzyme digestion product contains only a 100 bp DNA fragment, the wheat to be tested is based on TaHDA9-B The genotype of the gene is genotype II; The plant height of wheat of genotype II was greater than that of wheat of genotype I; The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4; The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5; The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6; The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO:

7.

4. A method for screening or assisting in screening wheat of different plant heights, comprising the following steps in sequence: (C1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1; The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4; The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5; (C2) Sequencing the PCR amplification product P1 and then performing the following evaluation: If the nucleotide sequence of the PCR amplification product P1 is as shown in SEQ ID NO: 2 from the 1793rd to the 2606th position from the 5' end, the wheat to be tested is based on TaHDA9-B The genotype of the gene is genotype I; If the nucleotide sequence of the PCR amplification product P1 is as shown in SEQ ID NO:3 from the 1793rd to the 2606th position from the 5' end, the wheat to be tested is based on TaHDA9-B The genotype of the gene is genotype II; The plant height of wheat of genotype II is greater than that of wheat of genotype I.

5. Detection of wheat based on TaHDA9-B The application of the substance for genes of genotype I or genotype II is at least one of (z1) to (z3): (z1) Screening or assisting in the screening of wheat with different plant heights; (z2) Identify or assist in identifying wheat plant height; (z3) Identification or auxiliary identification of wheat TaHDA9-B the genotype of a gene; The genotype I is based on the C2308T SNP site, which is a CC homozygous genotype. TaHDA9-B Gene; The genotype II is based on the genotype of the C2308T SNP site, which is TT homozygous. TaHDA9-B Gene; The C2308T SNP site is the 2308th nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome.

6. The use according to claim 5, characterized in that: The detection of wheat to be tested is based on TaHDA9-B The material for determining whether the genotype of the gene is genotype I or genotype II includes a primer pair A consisting of primer F1 and primer R1 and / or a primer pair B consisting of primer F2 and primer R2; The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4; The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5; The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6; The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO:

7.

7. The use according to claim 6, characterized in that: The detection of wheat to be tested is based on TaHDA9-B The substance for determining whether the genotype of the gene is genotype I or genotype II also includes the restriction endonuclease BamHI.

8. The use of the molecular marker represented by SEQ ID NO: 1, which is at least one of (z1)-(z3): (z1) Screening or assisting in the screening of wheat with different plant heights; (z2) Identify or assist in identifying wheat plant height; (z3) Identification or auxiliary identification of wheat TaHDA9-B the genotype of a gene; The application is achieved through the C2308T SNP site; the C2308T SNP site is the 2308th nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome; If the genotype based on the C2308T SNP site is CC homozygous, then TaHDA9-B The genotype of the gene is genotype I; If the genotype based on the C2308T SNP site is TT homozygous, then TaHDA9-B The genotype of the gene is genotype II; The plant height of wheat of genotype II is greater than that of wheat of genotype I.