A rice chalkiness-related CHALK-H gene and its application

By cloning the CHALK-H gene related to rice chalkiness and regulating the accumulation of starch in grains, the problem of the unclear mechanism of rice chalkiness formation was solved, the appearance and taste quality of rice were improved, and the market value was increased.

CN115976061BActive Publication Date: 2025-09-23JILIN ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211655425.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-21
Publication Date
2025-09-23
Estimated Expiration
2042-12-21

AI Technical Summary

Technical Problem

In the existing technology, the molecular mechanism of rice chalkiness formation is unclear, which makes it difficult to improve the quality of rice. In particular, excessive chalkiness affects the appearance, processing and nutritional quality of rice.

Method used

The CHALK-H gene, which is related to rice chalkiness, was discovered and cloned. By regulating the chlorophyll content in the leaves, it affected the starch accumulation in the grains. The gene was overexpressed using a recombinant expression vector to cultivate rice with normal endosperm.

Benefits of technology

It provides a theoretical basis for the formation of chalkiness, improves the appearance and taste quality of rice, reduces the chalkiness, and increases the market value of rice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115976061B_ABST
    Figure CN115976061B_ABST
Patent Text Reader

Abstract

A rice chalkiness-related CHALK-H gene and its application belong to the field of genetic engineering technology. The nucleotide sequence of the CHALK-H gene of the present invention is shown in SEQ ID No: 1, and can be used in regulating grain starch development and improving rice chalkiness traits; the amino acid sequence of the protein encoded by the CHALK-H gene is shown in SEQ ID No: 2; a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the CHALK-H gene; the recombinant expression vector is a recombinant plasmid obtained by inserting the CHALK-H gene between the multiple cloning sites SmaI and SpeI of the pCAMBIA3300-ubi vector; a primer pair for amplifying the full length of the CHALK-H gene or any fragment thereof, or a positioning primer involved in fine positioning of the CHALK-H gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a rice chalkiness-related CHALK-H gene and an application thereof. Background Art

[0002] Rice (Oryza sativa) is one of the world's most important food crops. Rice quality is crucial to any country's rice industry, determining its position in international competition. Furthermore, against the backdrop of the current international situation, improving rice quality has become the primary goal of rice breeding in my country. Rice quality is primarily reflected in appearance and taste.

[0003] Chalkiness is one of the most important factors affecting rice quality. Generally, chalkiness is measured by chalkiness and chalkiness rate. Rice kernels with chalkiness exceeding 20% ​​are generally unacceptable in the market. Chalkiness significantly impacts rice's appearance, processing, cooking, and nutritional qualities, directly impacting its marketability and value. Therefore, reducing chalkiness not only improves rice's appearance and palatability, but also increases its commercial value.

[0004] Rice chalkiness refers to an optical property caused by insufficient endosperm filling, loosely arranged starch granules, and the presence of air between the starch granules, which causes sunlight to refract through the interior. Due to insufficient starch granules in the endosperm, chalkiness occurs in different locations on the grain, typically classified as ventral white, dorsal white, and central white. Many genes associated with the chalky white phenotype in rice have been cloned and analyzed, such as osbt1, flo4, flo5, flo7, gpa1, ms-h, and WCR1. Although many genes associated with chalkiness have been cloned, the molecular mechanisms of regulation remain unclear. Therefore, the discovery of new chalkiness-related mutants and the cloning of their genes will help further understand the role of starch synthesis and metabolic pathways in improving rice quality. Summary of the Invention

[0005] The purpose of the present invention is to disclose a rice chalkiness-related CHALK-H gene and its application.

[0006] The rice chalkiness-related coding gene described in the present invention is named CHALK-H, which belongs to the first (LOC_Os11g39670.1) of two alternatively spliced ​​open reading frames of the same gene (LOC_Os11g39670).

[0007] The rice chalkiness-related CHALK-H gene of the present invention has a CDS nucleotide sequence as shown in SEQ ID No: 2 (LOC_Os11g39670.1). The CHALK-H gene can be used to regulate grain starch development and improve rice chalkiness traits.

[0008] The amino acid sequence of the protein encoded by the rice chalkiness-related CHALK-H gene of the present invention is shown in SEQ ID No: 3.

[0009] A recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria containing a CHALK-H gene. The recombinant expression vector is a recombinant plasmid obtained by inserting the CHALK-H gene between the multiple cloning sites Sma I and Spe I of the pCAMBIA3300-ubi vector.

[0010] The primer pairs for amplifying the full length of the CHALK-H gene or any fragment thereof, or the positioning primer sequences involved in fine positioning of the CHALK-H gene are shown in Table 1.

[0011] The present invention has the beneficial effects of discovering, locating, and cloning a novel rice chalkiness-associated CHALK-H gene for the first time. The rice chalkiness-associated CHALK-H gene of the present invention affects grain starch accumulation by regulating chlorophyll content in leaves at room temperature. Overexpressing the CHALK-H gene in a chalky phenotypic mutant can cultivate normal endosperm rice. The CHALK-H gene is a highly valuable gene for studying the mechanism of chalkiness formation and can provide a theoretical basis for analyzing the "source," "sink," and "flow" theories of chalkiness formation. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 The grain phenotypes of wild-type Hwacheong and mutant chalk-h are shown;

[0013] Figure 2 Scanning electron microscopy observation of the grains of wild-type Hwacheong and mutant chalk-h;

[0014] Figure 3 The filling rate of wild type Hwacheong and mutant chalk-h was determined;

[0015] Figure 4 This is the MutMap analysis result of the mutant gene on chromosome 11;

[0016] Figure 5 This is the T1 grain phenotype of the T0 generation plants transformed with pCAMBIA3300-CHALK-H. DETAILED DESCRIPTION

[0017] The following examples are provided to facilitate a better understanding of the present invention. The experimental methods in the examples are conventional methods unless otherwise specified. The experimental materials used in the examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0018] The rice chalkiness-related gene described in the present invention is named CHALK-H and is sourced from the Rice Research Institute of Jilin Academy of Agricultural Sciences, Tiebei, Nanwaizi Town, Gongzhuling City, Jilin Province, China, Postal Code: 130360; Contact: Park Il-hwa, Mobile Number: 18684271922.

[0019] Example 1: Discovery of Rice Chalkiness-Related Sites and Their Encoding Genes

[0020] 1. Phenotypic and genetic analysis of the rice endosperm floury mutant chalk-h

[0021] Among the mutants generated by MNU chemical mutagenesis in the japonica rice variety Hwacheong, an endosperm floury mutant was screened out and named chalk-h.

[0022] Figure 1 The above is a scan of the whole and cross-section of Hwacheong mature seeds. The endosperm appears completely transparent. Figure 1 Below are scans of the whole and cross-section of mature chalk-h seeds, with the endosperm showing a chalky phenotype.

[0023] Cross-sections of wild-type Hwacheong and chalk-h mutant seeds were observed by scanning electron microscopy (e.g. Figure 2 As shown in the figure, the starch granules in wild-type seeds are tightly arranged and uniform in size, while the starch granules in chalk-h mutant seeds are loosely arranged and most of the granules are round.

[0024] Throughout the seed development process, the filling rate of chalk-h mutant was significantly lower than that of wild type Hwacheong ( Figure 3 (As shown). Starting six days after anthesis, dry matter accumulation in the mutant began to decrease significantly compared to the wild type, and this difference persisted until the end of grain filling. Corresponding to the significantly reduced grain filling rate, the 1,000-grain weight of mature chalk-h mutant seeds was significantly lower than that of the wild type, Hwacheong.

[0025] 2. Map-based cloning of mutant gene sites

[0026] After shelling, some of the F1 seeds harvested from the chalk-h mutant and wild-type Hwacheong and Milyang23 showed chalky white grains similar to the chalk-h mutant. Statistical analysis revealed that the separation ratio of normal endosperm brown rice to chalky white grains met the 3:1 separation ratio (X 2 <X 2 0.05=3.84), indicating that the chalky phenotype of the chalk-h mutant conforms to the inheritance rule controlled by a single recessive nuclear gene.

[0027] To determine the physical location of the chalk-h mutant gene, 16 mutant seeds were selected from the F1 generation of a Milyang23 hybrid. BSA analysis of the F2 seeds from a Milyang23-chalk-h hybrid was performed using 118 STS (sequence marker site) polymorphism makers distributed across 12 chromosomes. Two markers (S11071 and S11099) at the end of the long arm of chromosome 11 were associated with the mutant phenotype, and 192 F2 chalky individuals were genotyped. Linkage analysis revealed that the chalk-h gene cosegregates with STS marker S11091 between STS markers S11088 and S11099, with a physical distance of 563 kb between the two markers and encompassing 63 open reading frames (ORFs). The molecular markers used for fine mapping are listed in Table 1.

[0028] Table 1 Molecular markers used for localization

[0029]

[0030] To locate the mutant gene responsible for the chalky phenotype, a large population of DNA from F2 plants (32 strains) derived from hybridization of the chalk-h mutant with the wild-type Hwacheong was used for MutMap analysis. Sequence reads were compared with the HC sequence as a reference. Based on the average SNP index peak, the most likely candidate region was detected in the 157 kb region of chromosome 11, which is located within the tagged STS marker interval. Only two SNPs with an SNP index of 1 were found in the 156 kb candidate region, one of which was located in the -452 bp promoter region of LOC_Os11g39910 and the other in the 6th exon of LOC_Os11g39670 (as shown in Figure 2). Figure 4 shown).

[0031] dCAPs markers were designed to analyze two candidate genes, and the mutation site LOC_Os11g39670 was identified as being associated with the chalky phenotype. LOC_Os11g39670 encodes a seryl-tRNA synthetase, which has been designated TSCD11. The point mutation occurs at nucleotide 791bp within the open reading frame (ORF) of exon 6. This mutation replaces adenine (A) with thymidine (T), resulting in an amino acid change from glutamic acid (Glu) to valine (Val) in the chalk-h mutant. Cosegregation analysis was performed using derived split-expanded polymorphic sequence (dCAPs) markers. The sequence of primer 39670-dCAPs (Xba I) is shown in Table 1. The results showed complete cosegregation of the genotype and phenotype in the F2 population. The gene represented by SEQ ID No: 1 was designated CHALK-H.

[0032] Example 2: Acquisition and identification of transgenic plants

[0033] 1. Construction of recombinant expression vector

[0034] The ORF sequence of the CHALK-H gene including the full-length CDS was obtained by PCR amplification using Hwacheong's cDNA as a template and primer1 / 2 as primers.

[0035] PCR amplification was performed to obtain the CHALK-H gene. The PCR primer sequences were as follows:

[0036] primer1:

[0037] 5'CCCGGGCCCCCACCTTTCTCTTATCC 3;

[0038] primer2:

[0039] 5'TTTGTTCAACTACTCCCTCCA 3.

[0040] The complete ORF sequence of the CHALK-H gene was obtained using the primers primer1 and primer2. The fragment after double digestion with Sma I and Spe I was cloned into the vector pCAMBIA3300-ubi. The pCAMBIA3300-ubi containing CHALK-H was named pCAMBIA3300-CHALK-H.

[0041] 2. Obtaining recombinant Agrobacterium

[0042] pCAMBIA3300-CHALK-H was transformed into Agrobacterium tumefaciens EHA105 strain by freeze-thaw method to obtain recombinant strain. The plasmid was extracted and identified by PCR and enzyme digestion.

[0043] 3. Obtaining transgenic plants

[0044] pCAMBIA3300-CHALK-H was introduced into chalk-h mutants by Agrobacterium-mediated plant transgenesis. Seven overexpressing plants were obtained. Real-time fluorescence quantitative PCR was performed using primers primer3 / 4 to detect the CHALK-H gene in the overexpressing plants. Among the seven overexpressing transformed plants, the endosperm phenotype of five positive plants with significantly increased CHALK-H gene expression levels was consistent with that of wild-type Hwacheong (e.g. Figure 5 This indicates that LOC_Os11g39670 is the gene CHALK-H that controls the chalky trait of the chalk-h mutant.

[0045] Real-time fluorescence quantitative PCR was performed on the CHALK-H gene, and the primer sequences were as follows:

[0046] primer3:

[0047] 5′CAGTTTGTCCACACGCTCAA 3′;

[0048] primer4:

[0049] 5'GTTTTCGGGGAGAGCACTTC 3'.

Claims

1. A rice chalkiness-related CHALK-H The application of the gene in regulating the improvement of rice chalkiness trait is characterized in that: Using the CHALK-H Overexpression of the gene in a chalky phenotype mutant can cultivate normal endosperm rice. CHALK- H The nucleotide sequence of the gene is shown in SEQ ID No: 2; the chalky phenotypic mutant has a chalky trait caused by a substitution of adenine (A) by thymine (T) at the 791st base of the open reading frame (ORF) of the gene LOC_Os11g39670, resulting in a mutation of the amino acid sequence from glutamic acid (Glu) to valine (Val).

Citation Information

Patent Citations

  • Application of rice seryl tRNA synthetase gene STS11 and protein encoded by gene

    CN110878317A