An HSV-1 oncolytic virus targeting the degradation of GBP protein and its preparation and application

Abstract

The present invention discloses an HSV-1 oncolytic virus targeting the degradation of GBP protein and its preparation and application, belonging to the field of gene engineering therapy. The present invention provides a method for improving the replication ability of oncolytic virus, which is achieved by targeting and inhibiting the GBP protein family. The present invention provides an HSV-1 oncolytic virus with strong replication ability, which is a recombinant HSV-1 expressing the Salmonella enterica serovar Typhimurium IpaH9.8 gene, and is obtained by inserting the IpaH9.8 gene fragment at the original ICP34.5 gene locus of HSV-1Δ34.5 / Δ47 (HSV-1 knocked out of the ICP34.5 and ICP47 genes). The oncolytic virus of the present invention can be used to prepare tumor therapeutic drugs, which can promote lymphocyte infiltration and killing activity, inhibit tumor growth, and has better therapeutic effects.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering therapy, and specifically relates to an HSV-1 oncolytic virus for targeted degradation of GBP protein, and a preparation and application thereof. Technical Background

[0002] Oncolytic viruses are a type of virus that can specifically infect and kill tumor cells. Currently, the development of oncolytic viruses is one of the research hotspots in cancer immunotherapy. Oncolytic viruses can exert tumor treatment effects in a variety of ways. First, the virus can replicate directly in tumor cells to lyse and kill tumor cells, inhibiting tumor growth; secondly, after oncolytic viruses infect and lyse tumor cells, the released tumor-associated antigens and danger signals can stimulate antigen presentation and effectively activate anti-tumor immune responses; viral infection stimulates cells to release cytokines, chemokines, etc., thereby improving the tumor suppressive microenvironment, promoting immune cell infiltration, and enhancing tumor immune responses. Studies in recent years have found that oncolytic viruses combined with chemoradiotherapy and immune checkpoint inhibitors can significantly improve the effect of tumor treatment.

[0003] In addition, as a replicable viral vector, oncolytic viruses can highly express exogenous effector genes in tumors, further enhancing the therapeutic effect of oncolytic viruses. At present, the exogenous molecules carried by oncolytic viruses can be divided into tumor antigens, immunostimulatory factors, immune-activating ligands, and chemokines. Immunostimulatory factors are currently the most important exogenous effector molecules expressed by oncolytic viruses, such as GG-CSF, IL-12, etc. The first FDA-approved oncolytic virus, T-VEC, inserts GG-CSF at the ICP34.5 site of HSV-1, and has achieved good results in the clinical treatment of melanoma.

[0004] Herpes Simplex Virus Type 1 (HSV-1) is an alphavirus subfamily of the Herpesviridae family. It is about 180 nanometers in size. Humans are its only natural host. 70% to 90% of adults have been infected with HSV-1. After infection, the virus will remain dormant in the human body for life, causing the main symptom of herpes labialis, which is less harmful to humans. In addition, there are mature clinical drugs for the antiviral treatment of HSV-1. As an oncolytic virus vector, HSV-1 has the advantages of large load and strong immunostimulatory activity. Therefore, HSV-1 is very suitable as an oncolytic virus vector. In addition to T-VEC, which has been approved by the FDA, a variety of oncolytic viruses under development are based on HSV-1 and are widely used to try to treat bladder cancer, breast cancer, melanoma, and liver cancer.

[0005] The guanylate-binding protein family (GBP) belongs to the interferon-induced dynamin GTPase superfamily. These proteins can restrict the replication of intracellular pathogens in immune and non-immune cells. The GTPase of GBP can target and lyse the vacuole membrane containing pathogens, thereby killing protozoan and bacterial pathogens within the vacuole. GBP can also target the replication complex of ribonucleic acid viruses, thereby inhibiting virus replication. IpaH9.8 is an E3 ubiquitin ligase encoded by Salmonella typhimurium. It has been found that IpaH9.8 can help Salmonella evade cellular immune surveillance by degrading multiple GBP proteins including GBP1.

[0006] Currently, the main direction of modifying oncolytic viruses is to achieve the purpose of enhancing tumor immunity by recombinantly expressing exogenous genes. However, few studies have focused on further improving the therapeutic effect of oncolytic viruses by enhancing the virus's own replication ability. In the present invention, IpaH9.8 is inserted into the HSV-1 genome to target the degradation of the viral restriction factor GBP, promote virus replication, and enhance the therapeutic effect. Summary of the Invention

[0007] The object of the present invention is to solve the problem of poor replication of HSV-1 in tumors, and to provide a method for improving the replication ability of HSV-1 oncolytic virus. Another object of the present invention is to provide an HSV-1 oncolytic virus with strong replication ability, as well as the preparation method and application of the HSV-1 oncolytic virus.

[0008] The object of the present invention is achieved by the following technical solutions:

[0009] The method for improving the replication ability of oncolytic virus provided by the present invention is achieved by targeting the inhibition of the GBP protein family. Specifically, a gene for degrading the GBP protein is inserted into the oncolytic virus genome to recombinantly express a factor that targets the inhibition or degradation of the GBP protein, thereby promoting the replication of the oncolytic virus. The oncolytic virus is an HSV-1 oncolytic virus.

[0010] In some embodiments, the HSV-1 has knocked out the ICP34.5 gene and the ICP47 gene. The method for improving the replication ability of the HSV-1 oncolytic virus is to insert a gene for degrading the GBP protein at the original ICP34.5 site of the HSV-1 genome.

[0011] In some embodiments, in the method for improving the replication ability of the HSV-1 oncolytic virus, the gene for degrading the GBP protein is the Salmonella IpaH9.8 gene, and the nucleotide sequence of the Salmonella IpaH9.8 gene is as shown in SEQ ID NO.1.

[0012] The present invention also provides an oncolytic virus with strong replication ability, which is obtained by the method for improving the replication ability of oncolytic virus described above.

[0013] In some embodiments, the oncolytic virus with strong replication ability is an HSV-1 oncolytic virus, which is a recombinant HSV-1 expressing a GBP protein-degrading enzyme.

[0014] In some embodiments, the HSV-1 oncolytic virus is a recombinant HSV-1 expressing the Salmonella enterica serovar Typhimurium IpaH9.8 gene.

[0015] A method for preparing a recombinant HSV-1 expressing the Salmonella enterica serovar Typhimurium IpaH9.8 gene specifically comprises the following steps:

[0016] (1) The first step of RED recombination: Using electroporation, a recombinant fragment with a nucleotide sequence as shown in SEQ ID NO.2 is inserted at the original ICP34.5 of HSV-1Δ34.5 / Δ47BAC, screening with Kana resistance, and picking monoclonal colonies for identification. The schematic diagram of the recombinant fragment with a nucleotide sequence as shown in SEQ ID NO.2 is as Figure 1 shown, which contains homologous arms, IpaH9.8, partial EGFP, Kana and full-length EGFP.

[0017] (2) The second step of RED recombination: Using the partial EGFP fragment in the recombinant fragment, recombinantly deleting the Kana resistance gene to obtain an HSV-1BAC only inserted with IpaH9.8 and GFP, and picking monoclonal colonies for identification.

[0018] (3) Transfecting the obtained recombinant BAC to obtain a recombinant HSV-1 expressing the Salmonella enterica serovar Typhimurium IpaH9.8 gene, named HSV-1Δ34.5 / Δ47-IpaH9.8.

[0019] The present invention also provides the application of the oncolytic virus with strong replication ability in the preparation of anti-tumor drugs.

[0020] Furthermore, the oncolytic virus can be used alone to prepare anti-tumor drugs. In addition, the oncolytic virus can be combined with other anti-tumor drugs or treatment means to prepare anti-tumor drugs or combined anti-tumor treatments. Other treatment drugs or means include, but are not limited to, radiotherapy, chemotherapy, surgical treatment, immune checkpoint inhibitors, CAR-T and other treatment drugs.

[0021] An anti-tumor drug contains the oncolytic virus described above, and can also contain other anti-tumor drugs, such as radiotherapy, chemotherapy, surgical treatment, immune checkpoint inhibitors, CAR-T and other treatment drugs.

[0022] The guanylate-binding proteins (GBP) protein family plays an inhibitory role in both bacterial and viral infections. In the present invention, the GBP protein is targeted for degradation to enhance the oncolytic activity of HSV-1 oncolytic virus and improve the oncolytic treatment effect. Based on the HSV-1 bacterial artificial chromosome (BAC), the ICP34.5 and ICP47 genes were knocked out using RED recombination technology, and the bacterial IpaH9.8 gene fragment was inserted at the original ICP34.5 gene locus. The HSV-1 recombinant BAC was transfected into VERO cells to obtain the HSV-1 oncolytic virus expressing IpaH9.8. IpaH9.8 can effectively degrade members of the GBP family and inhibit cellular antiviral immunity, thereby effectively increasing the virus replication level. The oncolytic virus can selectively replicate in tumor cells, and the released virus further infects surrounding tumor cells. The lysed tumor cells can release tumor-associated antigens (TAA), activate dendritic cells, promote tumor antigen presentation, activate cytotoxic T cells, and the cytokines and chemokines produced by the infection of the oncolytic virus can promote lymphocyte infiltration and activate anti-tumor immunity. Therefore, the method of inhibiting the GBP protein family in the present invention promotes the replication of oncolytic virus. Recombinant expression of the bacterial protein IpaH9.8 in oncolytic herpes virus can significantly increase the titer of oncolytic herpes virus, promote lymphocyte infiltration and killing activity, and inhibit tumor growth.

[0023] Compared with the prior art, the oncolytic virus of the present invention has the following advantages and beneficial effects:

[0024] (1) The present invention is based on herpes simplex virus HSV-1, which is widely infected in the population and has mature antiviral treatment means;

[0025] (2) The oncolytic herpes virus HSV-1 can selectively lyse and kill tumor cells, and can effectively stimulate the immune system, release tumor antigens and danger signals, etc., promote antigen presentation, and improve the tumor immune microenvironment;

[0026] (3) As an E3 ubiquitin ligase, IpaH9.8 can effectively degrade the GBP protein, and the GBP protein can inhibit virus replication. The present invention can effectively promote the replication of oncolytic virus and obtain better treatment effects. Brief Description of the Drawings

[0027] Figure 1 It is a schematic diagram of a recombinant fragment with a nucleotide sequence as shown in SEQ ID NO.2.

[0028] Figure 2 It is a schematic diagram of the genomic structure of HSV-1 virus expressing IpaH9.8 in the present invention.

[0029] Figure 3 It is the plasmid map of EGFP-N1-for Kana.

[0030] Figure 4 To detect whether recombinant HSV-1 expresses IpaH9.8 and whether IpaH9.8 can effectively degrade GBP protein.

[0031] Among them, Figure A detects the IpaH9.8 mRNA level by RT-qPCR;

[0032] Figure B shows that HT1080 cells were infected with HSV-1Δ34.5 / Δ47 and HSV-1Δ34.5 / Δ47-IpaH9.8 respectively, and the GBP1 protein can be degraded by IpaH9.8.

[0033] Figure 5 IpaH9.8 expression promotes HSV-1 replication.

[0034] Figure A shows that HSV-1 has better replication ability in HEK293T cells co-expressing IpaH9.8 and GBP1 than in cells expressing only GBP1;

[0035] Figure B shows that the infection of HSV-1Δ34.5 / Δ47-IpaH9.8 can effectively degrade GBP1 and promote viral protein expression;

[0036] Figure C shows that HSV-1Δ34.5 / Δ47-IpaH9.8 has a higher virus titer after infecting HT1080.

[0037] Figure 6 HSV-1Δ34.5 / Δ47-IpaH9.8 has a better therapeutic effect on subcutaneous tumors of mouse GC38.

[0038] Figure A is the experimental flow chart of treating subcutaneous tumors of mouse GC38 with HSV-1Δ34.5 / Δ47-IpaH9.8;

[0039] Figure B is the curve of tumor volume change after treatment with HSV-1Δ34.5 / Δ47-IpaH9.8 and the control group, proving that the therapeutic effect of HSV-1Δ34.5 / Δ47-IpaH9.8 is significantly better than that of HSV-1Δ34.5 / Δ47;

[0040] Figures C-E show by flow cytometry the infiltration and exhaustion of T cells in tumors under the infection of HSV-1Δ34.5 / Δ47-IpaH9.8, indicating that HSV-1Δ34.5 / Δ47-IpaH9.8 significantly promotes T cell infiltration;

[0041] Figure F-I shows the number and cytotoxicity of T cells in the spleen under the infection of HSV-1Δ34.5 / Δ47-IpaH9.8 by flow cytometry analysis, indicating that there is no significant change in the number and activity of splenic T cells between HSV-1Δ34.5 / Δ47-IpaH9.8 and HSV-1Δ34.5 / Δ47. Detailed implementation mode

[0042] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0043] In the following examples, the primers were all synthesized by Sangon Biotech. Phanta Gax Super-Fidelity DNA Polymerase (product number: P505-d1) was purchased from Nanjing Novoprotein. The Escherichia coli engineering strain GS1783 integrating the bacterial artificial chromosome of HSV-1F strain was from NTCC; DGEG high-glucose medium and trypsin cell digestive solution were purchased from Sigma, 100× penicillin-streptomycin solution was purchased from Gibco, and Fugene HD was purchased from Promega; NheI, EcoRI and T4 ligase were all purchased from NEB; qPCR GIX was purchased from Mona Bio; FLAG and β-actin antibodies were purchased from Wuhan Dian Biological Company, and ICP5 and ICP8 antibodies were purchased from Santa Cruz; Flow antibodies were all purchased from Biolegend; Gatrigel was purchased from Corning; The reverse transcription kit was purchased from Beijing Aidlab Biotechnologies Co., Ltd.

[0044] Example 1

[0045] 1. Construction of HSV-1Δ34.5 BAC

[0046] 1) Obtaining the RED2 homologous recombination fragment for knocking out HSV-1 ICP34.5 by PCR

[0047] According to the sequences at both ends of the HSV-1 ICP34.5 gene, RED2 homologous recombination primers were designed. The primers for knocking out both ends of ICP34.5 are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0048] ICP34.5-KO-F: CGCCGCCCCCGGCCGCCCGGGCCCACGGGCGCCGTCCCAATGCCCGGGCCCTGGCCCGCGAGGATGACGACGATAAGTAGGG (SEQ ID NO.3),

[0049] ICP34.5-KO-R: CGAGTTCGCCGGGCCGGCTCCGCGGGCCAGGGCCCGGGCATTGGGACGGCGCCCGTGGGCAACCAATTAACCAATTCTGATTAG (SEQ ID NO.4).

[0050] Using EGFP-N1-for Kana (whose map is as Figure 3 , and the sequence is as shown in SEQ ID NO.21) as a template, the RED2 recombinant fragment was obtained by PCR with ICP34.5-KO primers.

[0051] Table 1 PCR reaction system

[0052] Component Volume (μL) <![CDATA[ddH2O]]> 18 2×Phanta Gax Buffer 25 dNTP Gix (10 mG) 1 ICP34.5-KO-F (10 μg) 2 ICP34.5-KO-R (10 μg) 2 Phanta Gax Super-Fidelity DNA Polymerase 1 Plasmid template (20 ng) 1

[0053] Mix the above components and perform the following reactions on a PCR instrument: pre-denaturation at 95°C for 30 s, denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 1 min, final extension at 72°C for 2 min, 25 cycles.

[0054] Electrophoresis was carried out at 150 V for 20 min in 1% agarose gel, and a single band of about 1 Kb was cut under ultraviolet light. Gel extraction was performed using the OGEGA Gel Extraction Kit (D2500).

[0055] 2) Obtaining HSV-1Δ34.5BAC by Red2 recombination

[0056] a) First step of recombination: Take the HSV-1 BAC GS1783 strain, streak it on a chloramphenicol plate, and culture it in an incubator at 30 °C; pick a single colony and shake the bacteria at 30 °C; after 14 h, transfer it to 25 mL of medium and culture until OD = 0.6. Take 15 mL of the bacterial solution in a 50 mL conical flask, and stir it in a water bath at 42 °C for 15 min; transfer the conical flask to an ice-water mixture and stir it in an ice bath for 20 min; transfer the bacterial solution to a 50 mL centrifuge tube and collect the bacteria at 0 °C and 4500 g for 5 - 10 min; operate in a laminar flow hood and on ice, completely discard the medium, first slowly add 5 mL of pre-cooled ddH2O, gently pipette and mix well, then add 5 mL of ddH2O, centrifuge for 10 min, and repeat 2 - 3 times; discard the supernatant, add 75 μL of H2O, pipette and mix well, transfer it to a 1.5 mL EP tube, then add 100 ng of the ICP34.5 homologous recombination fragment, mix well and add it to an electroporation cuvette for electroporation. The voltage is 1.7 kV, and the electroporation constant value after electroporation is not less than 4; after completion, add 1 mL of fresh LB to the electroporation cuvette, mix well and transfer it to a 1.5 mL EP tube, shake it in a shaker at 30 °C and 240 rpm for 1 h; spread the bacterial solution on a double-antibody plate of chloramphenicol and kanamycin, culture it at 30 °C for 1 day, pick a single colony on Day 2, culture it overnight at 30 °C in 5 mL of double-antibody LB medium of chloramphenicol and kanamycin, and then extract the BAC. Design PCR primers according to the upstream and downstream of the HSV-1 ICP34.5 insertion site. The primer sequences are shown in SEQ ID NO.5 and SEQ ID NO.6 respectively. Verify whether the homologous recombination fragment is inserted into the HSV-1 genome according to the size of the PCR fragment.

[0057] Forward primer: ccagattacgctgcagctagcCGGGCCCCCCCCGAAACA (SEQ ID NO.5),

[0058] Reverse primer: agatgcacgcgtagcgaattcCGGGAAGCGGAACAAGGC (SEQ ID NO.6).

[0059] Steps for extracting bacterial artificial chromosome (BAC): Collect GS1783 strain at 8000 rpm for 2 min; resuspend the bacteria thoroughly with 600 μL of P1 buffer (25 mM Tris-HCl pH 8.0, 10 mM EDTA, 10 μg / mL RNase A, 50 mM glucose), add 600 μL of P2 buffer (0.2 g NaOH, 1% SDS), invert and mix 8 times, incubate at RT for 3 min; add 600 μL of P3 buffer (5 g potassium acetate (CH3COOK), 5.75 mL acetic acid (CH3COOH), 14.25 mL H2O), invert and mix 8 times, incubate on ice for 10 min, centrifuge at 13000 rpm at 4°C for 15 min; take the supernatant and centrifuge again at 4°C for 10 min; add 0.7 volume of isopropanol to the supernatant, let stand for 10 min; centrifuge at 13000 rpm at 4°C for 20 min; wash the precipitate twice with 70% absolute ethanol; dry for 10 min, add 40 μl of TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA) and redissolve overnight.

[0060] b) Second step of recombination: Take the monoclonal bacterial solution with correct recombination in the first step, transfer it to 2 mL of LB liquid medium with chloramphenicol resistance, and culture overnight at 32°C; transfer the bacterial solution at a ratio of 1:50 to 3 mL of LB and culture until OD = 0.5 - 0.7; take 2 mL of the bacterial solution in the logarithmic growth phase, mix it with 1.6 mL of LB and 400 μL of 20% arabinose (final concentration is 2%), culture at 30°C for 45 min to induce the expression of I-Scel endonuclease; heat shock at 42°C for 12 min, shake the bacteria at 32°C for 1 - 2 h, take 5 - 10 μL of the bacterial solution, dilute it and spread it on the plate to pick colonies, and identify them by streaking on chloramphenicol and kanamycin plates and PCR identification. The colonies that grow only on the chloramphenicol LB solid culture plate indicate that the kanamycin gene in the HSV-1 genome is deleted in the second step of recombination; verify whether the kanamycin gene in HSV-1 is deleted according to the size of the PCR fragment product. The PCR primer sequences are the same as SEQ NO.3 and SEQ NO.4 respectively. The BAC verified correctly in this step is named HSV-1Δ34.5.

[0061] 2. Construction of HSV-1Δ34.5 / Δ47 BAC

[0062] 1) Obtain the homologous recombination fragment for knocking out HSV-1 ICP47 RED2 by PCR

[0063] Based on the successfully verified HSV-1Δ34.5 BAC above, knock out ICP47. The primers at both ends for knocking out ICP47 are shown as SEQ ID NO.7 and SEQ ID NO.8.

[0064] ICP47-KO-F: ccctccgcccagaaacttgggcgatggtcgtacccgggacgctcccccgcccgacgagcaaggatgacgacgataagtaggg (SEQ ID NO.7),

[0065] ICP47-KO-R: ccgttgcgtggaccgcttcctgctcgtcgggcgggggagcgtcccgggtacgaccatcgcaaccaattaaccaattctgattag (SEQ ID NO.8).

[0066] Using EGFP-N1-for Kana as a template, the RED2 recombinant fragment was obtained by PCR with ICP47-KO primers.

[0067] Table 2 PCR reaction system

[0068] Component Volume (μL) <![CDATA[ddH2O]]> 18 2×Phanta Gax Buffer 25 dNTP Gix (10 mG) 1 ICP47-KO-F (10 μg) 2 ICP47-KO-R (10 μg) 2 Phanta Gax Super-Fidelity DNA Polymerase 1 Plasmid template (20 ng) 1

[0069] Mix the above components well and perform the following reaction on a PCR instrument: pre-denaturation at 95°C for 30 s, denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 1 min, final extension at 72°C for 2 min, 25 cycles.

[0070] Electrophoresis was carried out on 1% agarose gel at 150 V for 20 min, and a single band of about 1 Kb was cut under ultraviolet light. Gel extraction was performed using the OGEGA Gel Extraction Kit (D2500).

[0071] 2) Obtaining HSV-1Δ34.5 / Δ47BAC by Red2 recombination

[0072] a) First step of recombination: Take the HSV-1Δ34.5 strain, streak it on a chloramphenicol plate, and culture it in an incubator at 30°C; pick a single clone and shake the bacteria at 30°C; after 14 h, transfer it to 25 mL of medium and culture until OD = 0.6. Take 15 mL of the bacterial solution in a 50 mL conical flask, and stir and water-bath at 42°C for 15 min; transfer the conical flask to an ice-water mixture and stir and ice-bath for 20 min; transfer the bacterial solution to a 50 mL centrifuge tube and collect the bacteria at 0°C and 4500g for 5 - 10 min; operate in a laminar flow hood and on ice, completely discard the medium, first slowly add 5 mL of pre-cooled ddH2O, gently pipette and mix evenly, then add 5 mL of ddH2O, centrifuge for 10 min, and repeat 2 - 3 times; discard the supernatant, add 75 μL of H2O, pipette and mix evenly, add it to a 1.5 mL EP tube, then add 100 ng of the ICP47 homologous recombination fragment, mix evenly and add it to an electroporation cuvette for electroporation. The voltage is 1.7 kV, and the electroporation constant value after electroporation is not less than 4; after completion, add 1 mL of fresh LB to the electroporation cuvette, mix evenly and transfer it to a 1.5 mL EP tube, shake it on a shaker at 30°C and 240 rpm for 1 h; take the bacterial solution and spread it on a double-antibody plate of chloramphenicol and kanamycin, culture it at 30°C for 1 d, pick a single clone on Day 2, culture it overnight at 30°C in 5 mL of double-antibody LB medium of chloramphenicol and kanamycin, and then extract BAC. Design PCR primers based on the upstream and downstream of the HSV-1 ICP47 insertion site. The primer sequences are shown in SEQ ID NO.9 and SEQ ID NO.10 respectively. Verify whether the homologous recombination fragment is inserted into the HSV-1 genome according to the size of the PCR fragment.

[0073] Forward primer: taccggattacggggactgt (SEQ ID NO.9),

[0074] Reverse primer: ataaaagggggcgtgaggac (SEQ ID NO.10).

[0075] b) Second recombination: Take the monoclonal bacterial solution with correct first-step recombination, transfer it to 2 mL of LB liquid medium with chloramphenicol resistance, and culture it overnight at 32 °C; transfer the bacterial solution at a ratio of 1:50 to 3 mL of LB and culture until OD = 0.5 - 0.7; take 2 mL of the logarithmic growth phase bacterial solution, mix it with 1.6 mL of LB and 400 μL of 20% arabinose (final concentration is 2%), culture at 30 °C for 45 min to induce the expression of I-Scel endonuclease; heat shock at 42 °C for 12 min, shake the bacteria at 32 °C for 1 - 2 h, take 5 - 10 μL of the bacterial solution, dilute and spread on plates to pick colonies, and identify them by streaking on chloramphenicol and kanamycin plates and PCR identification. Colonies that grow only on the chloramphenicol LB solid culture plate indicate that the kanamycin gene in the HSV-1 genome is deleted in the second recombination; verify whether the kanamycin gene in HSV-1 is deleted according to the size of the PCR fragment product. The PCR primer sequences are the same as SEQ NO.9 and SEQ NO.10 respectively. The BAC verified correctly in this step is named HSV-1Δ34.5 / Δ47.

[0076] 3. Construct HSV-1Δ34.5 / Δ47-IpaH9.8 virus

[0077] 1) Obtain the EGFP-N1-for Kana intermediate plasmid inserted with the IpaH9.8 fragment

[0078] Using pCS2-IpaH9.8 (the construction of pCS2-IpaH9.8 is shown in Peng Li et al., Nature, 2017) as a template, obtain the IpaH9.8 fragment by PCR, and enzymatically digest and ligate it between the NheI and EcoRI sites of the EGFP-N1-for Kana intermediate plasmid. The PCR primer sequences are shown as SEQ ID NO.11 and SEQ ID NO.12 respectively.

[0079] Forward primer: CTAgctagcatgttaccgataaataataacttttcattgcc (SEQ ID NO.11),

[0080] Reverse primer: CCGgaattcttatgaatggtgcagttgtgagccg (SEQ ID NO.12).

[0081] Table 3 PCR reaction system

[0082] Component Volume (μL) <![CDATA[ddH2O]]> 18 2×Phanta Gax Buffer 25 dNTP Gix (10 mG) 1 Forward primer (10 μg) 2 Reverse primer (10 μg) 2 Phanta Gax Super-Fidelity DNA Polymerase 1 Plasmid template (20 ng) 1

[0083] Mix the above components well and perform the following reaction on a PCR instrument: pre-denaturation at 95 °C for 30 s, denaturation at 95 °C for 15 s, annealing at 58 °C for 15 s, extension at 72 °C for 2 min, final extension at 72 °C for 5 min, 25 cycles.

[0084] Electrophorese 1% agarose gel at 150 V for 20 min, and excise a single band of approximately 1.5 Kb under ultraviolet light. Recover the gel using the OGEGA Gel Extraction Kit (D2500). The fragment sequence is as shown in SEQ NO.19.

[0085] 2) Extract the EGFP-N1-for Kana plasmid and digest it with NheI and EcoRI from NEB.

[0086] Table 4 Restriction Enzyme Digestion System

[0087] NheI 1 μL EcoRI 1 μL 10×NEB buffer 5 μL Plasmid 1 μL

[0088] Add ddH2O to make up to 50 μL, incubate at 37 °C for 1 h, and recover the digested plasmid fragment using OGEGA gel extraction.

[0089] 3) Ligate with NEB T4 ligase to insert IpaH9.8 into the digested EGFP-N1-for Kana plasmid

[0090] Table 5 T4 Ligase System

[0091] Component 20 μL system T4 DNA Ligase Buffer (10x) 2 μL Digested plasmid (about 6 Kb) 75 ng (0.02 pmol) IpaH9.8 fragment (about 1.6 Kb) 60 ng (0.06 pmol) T4 DNA Ligase 1 μL <![CDATA[ddH2O]]> To 20 μL

[0092] Incubate at room temperature for 2 h. Take DH5α competent cells, add 20 μL of the ligation system, incubate on ice for 30 min, heat shock at 42 °C for 90 s, add non-resistant LB culture medium after 2 min on ice, activate at 37 °C for 1 h, culture overnight on an Amp-resistant LB solid culture plate. After picking monoclonal colonies and culturing to extract plasmids, perform restriction enzyme digestion identification with NheI and EcoRI.

[0093] 3) Obtain the HSV-1 bacterial artificial chromosome inserted with IpaH9.8

[0094] a) Obtain the RED2 homologous recombination fragment inserted with IpaH9.8 by PCR

[0095] Design RED recombination primers, use the intermediate plasmid of EGFP-N1-for Kana inserted with the IpaH9.8 fragment as a template, and obtain the IpaH9.8 homologous recombination fragment containing homologous arms, IpaH9.8, partial EGFP, Kana, and full-length EGFP by PCR. The structure of the IpaH9.8 homologous recombination fragment is as Figure 1 shown, and the PCR primer sequences are shown in SEQ ID NO.13 and SEQ ID NO.14 respectively.

[0096] Forward primer: ATGCTTGCCTGTCAAACTCTACCACCCCGGCACGCTCTCTGTCTCCatgttaccgataaataataactt (SEQ ID NO.13),

[0097] Downstream primer: GAGCTCCCGGGAGCTCCGCGGAAGACCCAGGCCGCCTCGGGTGTAACGtttacttgtacagctcgtccatgccgagag (SEQ ID NO.14).

[0098] Table 6 PCR reaction system

[0099] Component Volume (μL) <![CDATA[ddH2O]]> 18 2×Phanta Gax Buffer 25 dNTP Gix (10 mG) 1 Forward primer (10 μg) 2 Reverse primer (10 μg) 2 Phanta Gax Super-Fidelity DNA Polymerase 1 Plasmid template (20 ng) 1

[0100] Mix the above components and perform the following reactions on a PCR instrument: pre-denaturation at 95°C for 30 s, denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 4 min, final extension at 72°C for 5 min, 25 cycles.

[0101] Electrophorese with 1% agarose gel at 150 V for 20 min, and cut out a single band of approximately 3.6 Kb under ultraviolet light. Recover the gel using the OGEGA Gel Extraction Kit.

[0102] B) Red / ET recombination

[0103] (1) First recombination: Take the HSV-1Δ34.5 / Δ47 strain, streak it on a chloramphenicol plate, and culture it in a 30°C incubator; pick a single colony and shake it at 30°C; after 14 h, transfer it to 25 mL of medium and culture until OD = 0.6. Take 15 mL of the bacterial solution in a 50 mL conical flask, and stir it in a water bath at 42°C for 15 min; transfer the conical flask to an ice-water mixture and stir it in an ice bath for 20 min; transfer the bacterial solution to a 50 mL centrifuge tube and collect the bacteria at 0°C and 4500g for 5 - 10 min; operate in a laminar flow hood and on ice, completely discard the medium, first slowly add 5 mL of pre-cooled ddH2O, gently pipette and mix well, then add 5 mL of ddH2O, centrifuge for 10 min, and repeat 2 - 3 times; discard the supernatant, add 75 μL of H2O, pipette and mix well, transfer it to a 1.5 mL EP tube, then add 100 ng of the IpaH9.8 homologous recombination fragment, mix well and add it to an electroporation cuvette for electroporation. The voltage is 1.7 kV, and the electroporation constant value after electroporation is not less than 4; after completion, add 1 mL of fresh LB to the electroporation cuvette, mix well and transfer it to a 1.5 mL EP tube, and shake it at 30°C and 240 rpm for 1 h; spread the bacterial solution on a double-antibody plate of chloramphenicol and kanamycin, and culture it at 30°C for 1 d. On Day 2, pick a single colony, culture it overnight at 30°C in 5 mL of double-antibody LB medium of chloramphenicol and kanamycin, and then extract BAC. Design PCR primers according to the upstream and downstream of the HSV-1 ICP34.5 insertion site, and verify whether IpaH9.8 is inserted into the HSV-1 BAC according to the size of the PCR fragment. The PCR primer sequences are shown in SEQ NO.3 and SEQ NO.4 respectively.

[0104] (2) Second recombination: Take the monoclonal bacterial solution with correct first recombination, transfer it to 2 mL of LB liquid medium with chloramphenicol resistance, and culture it overnight at 32°C; transfer the bacterial solution at a ratio of 1:50 to 3 mL of LB and culture until OD = 0.5 - 0.7; take 2 mL of the bacterial solution in the logarithmic growth phase, mix it with 1.6 mL of LB and 400 μL of 20% arabinose (final concentration is 2%), and culture it at 30°C for 45 min to induce the expression of I-Scel endonuclease; heat shock at 42°C for 12 min, shake it at 32°C for 1 - 2 h, take 5 - 10 μL of the bacterial solution, dilute it and spread it on a plate to pick colonies, and identify them by streaking and PCR on chloramphenicol and kanamycin respectively. The colonies that grow only on the chloramphenicol LB solid culture plate indicate that the kanamycin gene in the HSV-1 genome is deleted in the second recombination; verify whether the kanamycin gene in HSV-1 is deleted according to the size of the PCR fragment product. The PCR primer sequences are the same as SEQ NO.5 and SEQ NO.6 respectively. The BAC verified correctly in this step is named HSV-1Δ34.5 / Δ47-IpaH9.8.

[0105] 4. Obtain recombinant HSV-1 virus expressing IpaH9.8

[0106] Culture VERO cells in a 6-well plate at a density of 1.5×10 5 / well. When the cell density reaches about 70%, perform transfection. 30 minutes before transfection, change to optiMEM. Mix 10 μL of BAC DNA with 90 μL of optiMEM, add 5 μL of Fugene HD and mix well. Incubate the transfection complex at room temperature for 10 minutes, and then add the transfection complex dropwise to the cells. Collect the virus when 100% of the cells show obvious cytopathic effects.

[0107] 5. Identification of recombinant HSV-1 expressing IpaH9.8

[0108] 1) Detection of IpaH9.8 gene transcription by RT-qPCR

[0109] Culture HT1080 cells in a 6-well plate. When the cell density reaches about 80%, infect the cells with HSV-1Δ34.5 / Δ47-IpaH9.8 GOI = 1. Collect the cells at 6 h, 12 h, and 24 h respectively. Then resuspend the cells in 500 μL of Trizol and lyse them at room temperature for 5 min. Add 100 μL of chloroform, vortex and mix well, and let stand for 5 min. Centrifuge at 12000 g for 15 min, and transfer the upper aqueous phase to a new 1.5 mL EP tube. Add 400 μL of isopropanol, invert and mix well, and let stand for 10 min. Centrifuge at 12000 g for 10 min. Discard the supernatant, add 500 μL of 75% ethanol to wash the precipitate, and centrifuge at 7500 g for 5 min. After drying the RNA precipitate, dissolve it in DEPC water and measure the RNA concentration with Nanodrop. Take 1 μg of RNA to reverse transcribe to obtain cDNA. After diluting the obtained cDNA 20-fold, detect the viral gene expression by RT-qPCR. The qPCR primers for IpaH9.8 are shown in SEQ ID NO.15 and SEQ ID NO.16 respectively; the qPCR primers for HSV-1 US3 are shown in SEQ ID NO.17 and SEQ ID NO.18 respectively; the qPCR primers for the internal reference telomerase are shown in SEQ ID NO.19 and SEQ ID NO.20 respectively.

[0110] IpaH9.8 qPCR primers: GAAAACCTGCCAGCTTTACCCGATTC (SEQ ID NO.15), CAGTGAGGAAATTACGGGTCGCTCTG (SEQ ID NO.16);

[0111] US3 qPCR primers: TTACCGCGGAAGAACTGGAC (SEQ ID NO.17), CCGTGGATCGTAAAGCCCAT (SEQ ID NO.18);

[0112] Telomerase qPCR primers: GGCACACGTGGCTTTTCG (SEQ ID NO.19), GGTGAACCTCGTAAGTTTATGCAA (SEQ ID NO.20).

[0113] Table 7 RNA reverse transcription system

[0114] Component Volume / Mass RNA 1 μg 5×TRUE RT GasterGix 4 μL <![CDATA[H2O]]> To 20 μL

[0115] The PCR instrument performs the following program: 25°C for 10 min, 42°C for 15 min, 85°C for 5 s.

[0116] Table 8 Mona GonAmp TG ChemoHS qPCR reaction system

[0117]

[0118] Table 9 BioRad CFX Connect TG qPCR reaction program

[0119]

[0120] The results are as Figure 4 Shown in A, the expressions of IpaH9.8 and the viral gene US3 increase significantly with the prolongation of the infection time.

[0121] 2) Immunoblot verification of HSV-1Δ34.5 / Δ47-IpaH9.8 virus

[0122] HT1080 cells are cultured in a 6-well plate. When the cell density reaches about 80%, HSV-1Δ34.5 / Δ47 and HSV-1Δ34.5 / Δ47-IpaH9.8 infect the cells respectively with a GOI of 1; after 24 h, the cells are collected, lysed on ice for 10 min with 100 μL / sample of NP-40 lysis buffer, centrifuged at 12,000 rpm for 5 min, and 80 μL of cell lysate is taken and added with 20 μL of 5×SDS-loading buffer, and the sample is prepared by boiling at 95°C for 10 min. 8% SDS-PAGE gel electrophoresis is carried out at voltages of 80 V for 20 min and 120 V for 1 h respectively. The wet transfer voltage is 100 V for 60 min. Antibody incubation detection is carried out.

[0123] The results are as Figure 4 Shown in B, HSV-1Δ34.5 / Δ47-IpaH9.8 can effectively degrade the GBP1 protein.

[0124] 6. IpaH9.8 promotes virus replication by degrading GBP1

[0125] 1) Detection of the function of IpaH9.8 in HSV-1 replication by fluorescence microscopy

[0126] Seed three wells of a 12-well plate with HEK293T cells. When the cell density reaches about 70%, transfect one well with 1 μg of the empty plasmid pCS2-Vector, transfect one well with 500 ng of the empty plasmid pCS2-Vector and 500 ng of the plasmid pCS2-GBP1 (for the construction of the pCS2-GBP1 plasmid, see Peng Li et al., Nature, 2017), and transfect the last well with 500 ng of the empty plasmid pCS2-GBP1 and 500 ng of the plasmid pCS2-IpaH9.8. After mixing the plasmids with liposome (PEI) and allowing them to stand for 15 min, add them to the 293T culture medium. After 24 h, infect with HSV-1-GFP at a GOI of 0.01. After 48 h, observe the replication of HSV-1-GFP under a fluorescence microscope.

[0127] The results are as Figure 5 shown in A. IpaH9.8 can effectively promote the replication of HSV-1-GFP.

[0128] 2) Detection of the function of IpaH9.8 in HSV-1 replication by immunoblotting

[0129] Infect HT1080 cells with HSV-1Δ34.5 / Δ47 and HSV-1Δ34.5 / Δ47-IpaH9.8 respectively at a GOI of 1. After 12 h, harvest the cells, prepare samples with NP-40 lysis buffer, perform 8% SDS-PAGE gel electrophoresis, and detect protein expression by immunoblotting.

[0130] The results are as Figure 5 shown in B. HSV-1Δ34.5 / Δ47-IpaH9.8 can effectively degrade GBP1 and promote the expression of viral proteins ICP5 and ICP8.

[0131] 3) Detection of the function of IpaH9.8 in HSV-1 replication by plaque assay

[0132] Culture 293T cells in a 6-well plate. When the cell density reaches about 70%, transfect with 400 ng / mL of VSV-G, 1 μg / well of PSPAX21, and 1.2 μg / well of pCDH-FLAG-GBP1. Collect the lentivirus supernatant about 2 days after transfection; infect HT1080 cells with the lentivirus, and obtain a stable HT1080 cell line stably expressing FLAG-GBP1 after puromycin screening. Infect the HT1080 empty vector and the HT1080 cell line stably expressing FLAG-GBP1 with HSV-1Δ34.5 / Δ47-IpaH9.8 and HSV-1Δ34.5 / Δ47 GOI = 0.01 respectively. After 48 h, collect the virus in the supernatant for plaque assay to titrate the titer.

[0133] The results are as Figure 5 shown in C. IpaH9.8 can effectively antagonize the inhibitory effect of GBP1 on HSV-1 replication and increase the HSV-1 titer.

[0134] 7. In vivo therapeutic effect of recombinant IpaH9.8 oncolytic virus

[0135] 1) Detect the effect of recombinant IpaH9.8 oncolytic virus on tumor growth

[0136] Divide C57 / 7J mice into three groups, with 2 groups as the control group and 1 group as the experimental group, with 5 mice in each group. Subcutaneously inoculate tumors in the left hindlimbs of the control group and experimental group mice (tumors were formed in all three groups of mice, and the number of in vitro cultured GC38 colon cancer cells injected was 10 6 ). When the tumor grows to about 150 mm 3 , inject 100 μL of PBS solution into the control group 1, inject 5×10 6 PFU of HSV-1Δ34.5 / Δ47 oncolytic virus (100 μL) into the tumor site of the control group 2 mice, and inject 5×10 6 PFU of HSV-1Δ34.5 / Δ47-IpaH9.8 oncolytic virus (100 μL) into the tumor site of the experimental group 1 mice. Inject every other day for 5 consecutive times. After injecting the virus, the mice are raised normally, and the tumor volume is observed and measured. The specific process is as Figure 6 shown in A.

[0137] The results are as Figure 6 shown in B. Treatment with HSV-1Δ34.5 / Δ47 significantly inhibited tumor growth compared with the PBS treatment group, and expression of IpaH9.8 could further significantly enhance the inhibitory effect on tumors.

[0138] 2) Detect lymphocyte infiltration by flow cytometry

[0139] (1) Obtain lymphocytes in the spleen and tumor

[0140] a. Isolate splenic lymphocytes

[0141] Remove the spleen from the mouse abdomen, add GACS Buffer, and knead it through a single-cell filter to obtain single-cell splenic cells, then centrifuge at 1800 rpm for 4 min; after lysing red blood cells, count the cells using a hemocytometer, and transfer 10 6 cells to a 1.5 mL EP tube for cell staining.

[0142] GACS Buffer (stored at 4°C): 1×PBS, 0.5% BSA, 2 mM EDTA.

[0143] b. Isolate tumor lymphocytes

[0144] Excise the tumor tissue, place it in a 100 mm Petri dish, add 5 mL PBS, and cut the tumor tissue into small pieces; grind and filter it through a 70 μm single-cell filter, centrifuge at 1800 rpm for 5 min to collect the cells; resuspend and pipette the cells evenly with 3 mL of 40% percoll and transfer them to a 15 mL centrifuge tube; slowly add 3 mL of 80% percoll from the bottom of the syringe to the injection tube, centrifuge at 2500 rpm for 15 min at room temperature; collect the cells at the interface between 40% and 80% percoll into a new 15 mL centrifuge tube, centrifuge at 1800 rpm for 5 min to collect the cells; after lysing red blood cells, centrifuge to collect the cells, and after counting, transfer 1 million cells to a 1.5 mL EP tube for cell staining.

[0145] (2) Stain splenic or tumor lymphocytes

[0146] a. Cell surface staining

[0147] Prepare antibody cocktails at a dilution ratio of 1:400 in a 30 μL system, including CD8-FITC, CD4-Blue, PD-1-APC, and TIG3-PE; resuspend the cells with the antibody cocktails and pipette them evenly, incubate at 4°C in the dark for 15 min; centrifuge at 1800 rpm for 4 min to collect the cells, pipette them evenly with 1 mL of PBS; centrifuge at 1800 rpm for 4 min, resuspend and pipette them evenly with 250 μL of PBS and transfer them to a FACS tube for flow cytometry analysis.

[0148] b. Intracellular staining of cells

[0149] Prepare the stimulation medium with RPGI1640 (10% FBS), which contains 50 ng / mL PGA, 1 μg Ionomycin, 5 μg Brefeldin A. Pipette and mix 1 million cells with 400 μL of the stimulation medium, then transfer them to a 96-well plate and place it in a cell culture incubator for 4 h. Centrifuge at 1800 rpm for 4 min, fix with 150 μL of fixation buffer at 4°C for 20 min, and then centrifuge at 1800 rpm for 4 min. Resuspend with 200 μL of perm wash buffer, and after centrifugation, resuspend with 30 μL of antibody cocktails (prepare antibody cocktails with perm wash buffer: CD8-FITC, CD4-Blue, IFN-γ-APC, and TNF-α-PE) and stain overnight at 4°C. The next day, wash twice with 500 μL of perm wash buffer, then resuspend the cells with 250 μL of PBS and transfer them to a flow cytometry tube for flow cytometry analysis.

[0150] The results are as Figure 6 shown in C-6I. HSV-1-ICP34.5 / 47-KO IpaH9.8 can effectively enhance lymphocyte infiltration in tumors, reduce tumor lymphocyte exhaustion, and enhance the cytotoxicity of splenic lymphocytes.

[0151] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A method for improving the replication ability of oncolytic virus, characterized in that: The method described above is to insert a gene that degrades GBP protein at the original ICP34.5 site of the HSV-1 oncolytic virus genome with the ICP34.5 gene and ICP47 gene knocked out; the gene that degrades GBP protein is the Salmonella IpaH9.8 gene.

2. An oncolytic virus, characterized in that: Obtained by the method described in claim 1.

3. A method for preparing a recombinant HSV-1 expressing Salmonella enterica serovar Typhimurium IpaH9.8 gene, characterized in that: It includes the following steps: (1) The first step of RED recombination: Using electroporation, insert a recombinant fragment with a nucleotide sequence as shown in SEQ ID NO.2 at the original ICP34.5 site of HSV-1Δ34.5 / Δ47 BAC, screen using Kana resistance, and pick monoclonal colonies for identification; the recombinant fragment contains homologous arms, IpaH9.8, partial EGFP, Kana and full-length EGFP; the HSV-1Δ34.5 / Δ47 is the HSV-1 with the ICP34.5 gene and ICP47 gene knocked out. (2) The second step of RED recombination: Using the partial EGFP fragment in the recombinant fragment, recombinantly delete the Kana resistance gene to obtain an HSV-1 BAC that only inserts IpaH9.8 and GFP, and pick monoclonal colonies for identification. (3) Transfect the obtained recombinant BAC to obtain a recombinant HSV-1 expressing the Salmonella IpaH9.8 gene.

4. Use of the oncolytic virus according to claim 2 in the preparation of a tumor therapeutic drug, characterized in that: The tumor described above is colon cancer.

5. The application according to claim 4, wherein: The oncolytic virus described above can be used alone to prepare a tumor treatment drug; or the oncolytic virus is combined with other tumor treatment drugs to prepare a tumor treatment drug.

6. The application according to claim 5, wherein: The other tumor treatment drugs described above include immune checkpoint inhibitors and CAR-T treatment drugs.

7. A tumor treatment drug, characterized in that: It contains the oncolytic virus described in claim 2.

Images