A fusion gene, expression vector and anti-diabetic drug screening method

Abstract

The invention discloses a fusion gene, an expression vector and an anti-diabetic drug screening method. The method is based on a eukaryotic expression vector pCDNA3.1, an artificially synthesized EBFP2-T2A-SGLT2 fusion gene is inserted to obtain a new expression vector pBTS, and HEK293 cells are transfected to obtain genetically engineered cells that simultaneously express a blue fluorescent protein (EBFP2) and a human sodium-glucose cotransporter (SGLT2). The blue fluorescent protein EBFP2 expressed by the genetically engineered cells is used to evaluate transfection efficiency and can also be used as an internal reference for calculating the transport of fluorescent glucose by SGLT2. The self-cleaving peptide T2A is used to connect EBFP2 and SGLT2, and can be cleaved by intracellular proteases while being expressed in cells to obtain independent SGLT2 proteins, so that the real conformation of SGLT2 in cells can be better maintained, and the influence of the fusion protein on the activity of SGLT2 and its fluorescent glucose transporting ability can be solved from the source, and the biological activity of the real SGLT2 is reflected in the activity detection process, thereby ensuring the accuracy and repeatability of the drug detection results.

Description

Technical Field

[0001] The present invention relates to the field of biomedical engineering technology, in particular to the establishment and application of a fusion gene, an expression system and a method for screening anti-diabetic drugs with SGLT2 protein as a target. Background Art

[0002] According to the 10th edition of the "Global Diabetes Atlas" of the International Diabetes Federation (IDF), as of December 2021, there were 537 million (10.5%) adults aged 20-79 with diabetes worldwide. The total number of people with diabetes is expected to increase to 643 million (11.3%) by 2030 and to 783 million (12.2%) by 2045.

[0003] Blood sugar balance is crucial to human metabolism, and maintaining blood sugar balance in the circulatory system requires the coordinated action of multiple organs, such as the absorption and conversion of carbohydrates by the digestive tract, the uptake and utilization of glucose by tissues and organs, the synthesis and decomposition of glutinous rice in the liver, and the regulation of blood sugar homeostasis by the pancreas. The kidneys also play an important role in regulating blood sugar balance. The kidneys regulate blood sugar levels mainly in three ways: (1) renal glucose enters the blood circulation through gluconeogenesis; (2) renal activity consumes and utilizes glucose; and (3) renal glucose reabsorption. Studies have found that the glomeruli in the kidneys of healthy adults filter about 180g of glucose per day, of which about 99% is reabsorbed by the renal proximal tubules into the blood circulation, and the remaining 1% is excreted from the body in the form of urine. The transmembrane transporters that play an important role in glucose reabsorption in the kidney are mainly sodium-glucose type 1 transporter and sodium-glucose type 2 transporter (SGLT1 and SGLT2). SGLT1 is a low-capacity, high-affinity transporter that transports glucose and galactose at a sodium-glucose ratio of 2:1 and is responsible for transporting about 10% of glucose reabsorption in the kidney. However, because SGLT1 is also widely expressed in the small intestine and other tissues, the inhibition of SGLT1 may lead to glucose-galactose malabsorption syndrome and gastrointestinal-related side effects. SGLT2 is a high-capacity, low-affinity transporter that transports glucose at a sodium-glucose ratio of 1:1 and is responsible for 90% of glucose reabsorption in the kidney. In addition, because SGLT2 is mainly distributed in the kidney and has a high glucose reabsorption rate, selectively blocking SGLT2 can specifically inhibit the renal glucose reabsorption and promote glucose excretion from the urine, thereby achieving the effect of lowering blood glucose concentration. In summary, SGLT2 is currently an ideal target for anti-diabetic drugs, and SGLT2 inhibitors are independent of insulin action and can be used at any stage of diabetes development. A series of clinical data show that the use of SGLT2 inhibitors can not only effectively control blood sugar, but also improve β-cell function, increase insulin sensitivity, reduce patient weight, and reduce the risk of cardiovascular complications.

[0004] The method of screening anti-diabetic drugs targeting SGLT2 has been reported. This system uses enhanced green fluorescent protein (eGFP) as a reporter gene, transfects panc-1 pancreatic cells as a cell model, uses green fluorescent glucose molecules (2-BNDG) as a substrate, and evaluates the inhibitory activity of drugs on SGLT2 by flow cytometry detection of 2-BNDG signals. The problems are as follows:

[0005] ① The excitation wavelength of the reporter gene eGFP and substrate molecule 2-BNDG used in this screening system is 488nm, and the emission wavelengths are 507nm and 542nm respectively. It is difficult to accurately eliminate the interference of eGFP and obtain the accurate fluorescence value of 2-BNDG using flow cytometry, resulting in high background and low sensitivity;

[0006] ②The cells used in this screening system are panc-1 pancreatic cells, rather than human kidney-derived cells that express SGLT2 and function to transport glucose molecules. The glucose transport efficiency and function reflected may be different from the actual situation in the body; ③The establishment of this screening platform requires the construction of an overexpression stable cell line, which has a single method and cumbersome steps;

[0007] ④ The cell fluorescence signal in this screening system requires expensive flow cytometry detection, and the detection method is complicated and not suitable for high-throughput screening of drugs. Summary of the invention

[0008] The purpose of the present invention is to overcome the deficiencies of the prior art and to provide a fusion gene, an expression vector and an anti-diabetic drug screening method to solve the problems raised in the above technical background.

[0009] To achieve the above object, the present invention is implemented through the following technical solutions:

[0010] In a first aspect, the present invention provides a fusion gene, wherein the fusion gene is a fusion of a blue fluorescent protein gene EBFP2, a self-cleaving peptide gene T2A, and a human sodium-glucose transporter gene SGLT2;

[0011] The nucleotide sequence of the fusion gene is shown in SEQ ID NO: 1.

[0012] In the above technical scheme, the preparation method of the fusion gene is: firstly, the blue fluorescent protein gene EBFP2 is firstly spliced ​​with the self-cleaving peptide gene T2A by PCR method to form a fusion gene EBFP2-T2A, and then the above fusion gene EBFP2-T2A is spliced ​​with the human gene SGLT2 by PCR method, and finally the complete fusion gene EBFP2-T2A-SGLT2, i.e., the fusion gene, is obtained; wherein, the nucleotide sequence of the blue fluorescent protein gene EBFP2 is shown in SEQ ID NO: 2;

[0013] The self-cleaving peptide gene T2A has a nucleotide sequence as shown in SEQ ID NO: 3;

[0014] The nucleotide sequence of the human sodium-glucose transporter gene SGLT2 is shown in SEQ ID NO:4.

[0015] In the second aspect, the present invention provides an expression system based on the fusion gene described in the first aspect, the expression system comprises inserting the fusion gene into the overexpression vector pCDNA3.1 to obtain the fusion gene overexpression vector pBTS, or subcloning the fusion gene into a lentiviral vector to obtain the fusion gene overexpression lentiviral particle Levi_BTS, or subcloning the fusion gene into an adenoviral vector to obtain the fusion gene overexpression adenoviral particle Ad_BTS; then, the overexpression fusion protein cell line is obtained by transfecting or infecting cells. In the above technical scheme, the expression system also comprises an adeno-associated virus AAV_BTS constructed based on the fusion gene, and the adeno-associated virus AAV_BTS is used for subsequent mouse animal experiments.

[0016] In the above technical solution, the expression system uses the blue fluorescent protein EBFP2 as a reporter gene, and its fluorescence value can also be used as an internal reference for the subsequent evaluation of SGLT2 activity.

[0017] In a third aspect, the present invention provides a method for screening anti-diabetic drugs based on the fusion gene described in the first aspect, comprising the following steps:

[0018] (1) Constructing the fusion gene overexpression vector pBTS based on the fusion gene EBFG2-T2A-SGLT2;

[0019] (2) Transfecting cells with the fusion gene overexpression vector pBTS to establish a fusion gene overexpression cell model;

[0020] (3) This cell model uses EBFP2 as a reporter gene and 2-BNDG as a substrate for SGLT2 to establish a drug anti-diabetic evaluation system. The inhibitory effect of the drug on SGLT2 is preliminarily evaluated by calculating the fluorescence ratio of 2NBDG and EBFP2, and the possible anti-diabetic effect of the drug is indirectly evaluated.

[0021] In the above technical solution, the method for establishing the cell model in step (2) is replaced by establishing the cell model by infecting the cell model with adenovirus or lentivirus containing a fusion gene.

[0022] In the above technical solution, the cells transfected in step (2) are ATCC-derived human embryonic kidney cells HEK293.

[0023] In the above technical solution, the screening method uses overexpressed SGLT2 protein as a drug target.

[0024] In the above technical solution, in step (1), pCDNA3.1 is used as the basic framework, and the fusion gene fragment is inserted into the multiple cloning site to obtain the overexpression vector pBTS.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] 1. The reporter gene is the blue fluorescent protein EBFP2, which ensures that the target protein SGLT2 is efficiently expressed in the target cell HEK293, thereby establishing a cell model for screening anti-diabetic drugs;

[0027] 2. The reporter gene is a blue fluorescent protein EBFP2, which requires an excitation wavelength of 383 nm and an absorption wavelength of 507 nm for detection, which is quite different from the excitation wavelength and absorption wavelength required for detection of substrate 2-BNDG. It can be easily distinguished by flow cytometry, greatly reducing the mutual interference between the two fluorescent substances;

[0028] 3. The detection wavelengths of the reporter gene EBFP2 and the substrate 2-BNDG are quite different. High-quality data can be obtained by using a common fluorescence microplate reader after cell lysis, and the detection method is simple.

[0029] 4. The fluorescence values ​​of the reporter gene and substrate 2-BNDG can be read on a 96-well plate reader and subsequently calculated, so this method can be used for high-throughput screening of anti-diabetic drugs;

[0030] 5. The screening system uses human embryonic kidney cells HEK293, which are derived from ATCC and specifically express human SGLT2, to ensure that the test results are more consistent with the real situation in the human body and the data are more reliable and credible;

[0031] In addition, the drug screening system of the fusion gene overexpressed in HEK293 cells can also be constructed through lentivirus, adenovirus and other systems according to the screening needs.

[0032] The anti-diabetic drug screening method provided by the present invention is based on the eukaryotic expression vector pCDNA3.1, inserts the artificially synthesized EBFP2-T2A-SGLT2 fusion gene to obtain a new expression vector pBTS, transfects HEK293 cells to obtain genetically engineered cells that simultaneously express blue fluorescent protein (EBFP2) and human sodium-glucose co-transporter (SGLT2), the blue fluorescent protein EBFP2 expressed by the genetically engineered cells is used to evaluate the transfection efficiency, and can also be used as an internal reference for calculating the transport of fluorescent glucose by SGLT2, the self-cleaving peptide T2A is used to connect EBFP2 and SGLT2, and can be cleaved by intracellular proteases while being expressed in the cells to obtain independent SGLT2 proteins, which can better maintain the true conformation of SGLT2 in the cells, solve the possible influence of the fusion protein on the activity of SGLT2 and its fluorescent glucose transporting ability from the source, reflect the biological activity of the real SGLT2 in the activity detection process, and ensure the accuracy and repeatability of the drug detection results. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a schematic diagram of the preparation of the fusion gene in Example 1;

[0034] Figure 2 Schematic diagram of the construction of the fusion gene expression vector pBTS vector in Example 2;

[0035] Figure 3 The results of restriction endonuclease identification of plasmid pBTS in Example 2; Lane M is a linear nucleic acid molecule marker, Lane 1 is plasmid pBTS digested with restriction endonucleases Hind III & Xho I, and Lane 2 is plasmid pBTS;

[0036] Figure 4 This is a schematic diagram of the expression of the blue fluorescent protein EBFP2 of the fusion gene expression vector in Example 3;

[0037] Figure 5 The expression of the blue fluorescent protein EBFP2 of the fusion gene expression vector in Example 4 and the fluorescence image of 2-BNDG being absorbed by cells;

[0038] Figure 6 It is a bar graph showing the effects of the sodium ion dependent group and the sodium ion non-dependent group on SGLT2 activity in Example 4;

[0039] Figure 7 It is a bar graph showing the effect of Dapa on the activity of SGLT2 transporter 2-BNDG in Example 5;

[0040] Figure 8 It is a bar graph showing the effect of trilobatin (SYG) on the activity of SGLT2 transporting 2-BNDG in Example 6;

[0041] Fig. 9 It is a bar graph showing the effect of phlorizin (GPG) on the activity of SGLT2 transporting 2-BNDG in Example 7;

[0042] Fig.10 This is a schematic diagram of the fusion gene sequence in Example 1;

[0043] Fig.11 This is a schematic diagram of the sequence of the blue fluorescent protein gene EBFP2 in Example 1;

[0044] Fig.12 This is a schematic diagram of the sequence of the human sodium-glucose transporter gene SGLT2 in Example 1. DETAILED DESCRIPTION

[0045] The following describes the embodiments of the present invention by specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the following embodiments and features in the embodiments can be combined with each other without conflict.

[0046] Example 1

[0047] A fusion gene, wherein the fusion gene is a fusion of a blue fluorescent protein gene EBFP2, a self-cleaving peptide gene T2A, and a human sodium-glucose transporter gene SGLT2;

[0048] The fusion gene, whose nucleotide sequence is shown in Fig.10 in (SEQ ID NO: 1).

[0049] The preparation method of the fusion gene is: firstly, the blue fluorescent protein gene EBFP2 and the self-cleaving peptide gene T2A are spliced ​​into the fusion gene EBFP2-T2A by the PCR method, and then the above fusion gene EBFP2-T2A is spliced ​​with the human gene SGLT2 by the PCR method, and finally the complete fusion gene EBFP2-T2A-SGLT2 is obtained, i.e., the fusion gene. The construction process is as follows Figure 1 shown.

[0050] The blue fluorescent protein gene EBFP2 is preserved in the laboratory of the inventor, and its nucleotide sequence is shown in Fig.11 Medium (SEQ ID NO: 2);

[0051] The nucleotide sequence of the self-cleaving peptide gene T2A (SEQ ID NO: 3) is as follows:

[0052] GAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT

[0053] The human sodium-glucose transporter gene SGLT2 was purchased from Miaoling Biotechnology, product number P0622, and its nucleotide sequence is shown in Fig.12 Medium (SEQ ID NO: 4);

[0054] Example 2

[0055] Construction of fusion gene expression vector: Based on pCDNA3.1, the fusion gene expression vector pBTS was constructed. The plasmid is shown in the figure Figure 2As shown, the artificially synthesized fusion gene EBFP2-T2A-SGLT2 was inserted into the Hind III & Xho I restriction endonuclease sites of plasmid pCDNA3.1, and the restriction endonuclease identification was performed. The results were as follows Figure 3 It was then confirmed by sequencing.

[0056] Example 3

[0057] Transfection of fusion gene overexpression vector pBTS: The overexpression vector pBTS was transferred into HEK293 cells using the transfection reagent GenJetTM Plus InVitro DNA Transfection Reagent (Cat. No.: SL100499) from SignaGen. According to the instructions for the reagent, the specific transfection steps were as follows: ① One day before transfection, HEK293 cells were inoculated into a 6-well cell culture plate, and the cell density reached about 90% after overnight culture; ② 30-60 min before transfection, the culture medium was replaced, 1 mL / well; ③ Transfection complexes A and B were prepared, mixture A was 50 μL of diluent mixed with 1 μg of plasmid, and gently mixed, mixture B was 50 μL of diluent mixed with transfection reagent, and gently mixed, then mixture A and B were mixed, and allowed to stand at room temperature away from light for 10 min; ④ The mixture of A and B was then transferred into the culture well, mixed, and after culturing for 24 h, the expression of blue fluorescent protein EBFP2 was observed under a fluorescence microscope to preliminarily evaluate the transfection efficiency. The results are shown in Figure 4. Figure 4 ;

[0058] Depend on Figure 4 It can be seen that the blue fluorescent protein EBFP2 is expressed in HEK293 cells.

[0059] Example 4 SGLT2 activity detection:

[0060] ① Reagent preparation:

[0061] Sodium ion-dependent glucose transport buffer (KRH-Na+ buffer): 120mmol·L-1NaCl, 4.7mmol·L-1KCl, 1.2mmol·L-1MgCl 2 、2.2mmol·L-1CaCl 2 , 10mmol·L-1Hepes, adjust the pH to 7.4 with 1mmol·L-1Tris;

[0062] Sodium-independent glucose transport buffer (KRH-NMG buffer): 120mmol·L-1N-methy-glucamine, 4.7mmol·L-1KCl, 1.2mmol·L-1MgCl 2 、2.2mmol·L-1CaCl2 , 10mmol·L-1Hepes, adjust the pH to 7.4 with 1mmol·L-1Tris;

[0063] Sodium ion-dependent transport buffer: prepare 100 μmol·L-12-NBDG with KRH-Na+ buffer;

[0064] Sodium-independent transport buffer: prepare 100 μmol·L-12-NBDG with KRH-NMGbuffer;

[0065] Sodium ion-dependent transport termination buffer: prepare 0.5 mmol·L-1 phloridzin with KRH-Na+ buffer;

[0066] Sodium-independent transport termination buffer: use KRH-NMG buffer to prepare 0.5 mmol·L-1 phloridzin; ② Experimental steps:

[0067] a HEK293 cells transfected with the overexpression vector (high-glucose DMEM + 5% FBS + 1% penicillin-streptomycin) were cultured for 24 h, and then the culture medium was replaced with serum-free medium (low-glucose DMEM + 1% double antibody) for another 3 h.

[0068] b Remove the culture medium, add 37°C preheated KRH-Na+ buffer (or KRH-NMG buffer) to rinse twice, then add 0.5 mL of transport buffer to each well and heat at 37°C, 5% CO 2 Continue incubation for 30 min at room temperature;

[0069] c. Take out the cells from the incubator and place them on ice. Aspirate the transport buffer and add 200 μL of ice-cold stop buffer to each well to wash twice.

[0070] d. Add 200 μL of ice-cold stop buffer to each well, transfer the cells into an EP tube, pipette and vortex evenly, and perform flow cytometry to count the number of fluorescent cells.

[0071] e After aspirating the stop buffer in step b, add cell lysis buffer to lyse the cells for 30 minutes, transfer the lysate to a 96-well plate with a black frame and a transparent bottom, and observe the expression of EBFP2 in cells and the absorption of 2-BNDG by cells using a fluorescence microscope; read the corresponding fluorescence values ​​(EBFP2 and 2-BNDG) on a fluorescence microplate reader and calculate by the formula: SGLT2 relative activity value = Fluc 2-BND G sample / Fluc EBFP2 The sample mean,

[0072] The test results are shown in Table 1 and Figure 5, 6 As shown:

[0073] Table 1

[0074]

[0075] Note: Green light: excitation wavelength 488nm, emission wavelength 542nm; blue light: excitation wavelength 383nm, emission wavelength 507nm, from Table 1 and Figure 5 , 6 It can be seen that the expression of SGLT2 significantly promotes the absorption of substrate 2-BNDG by HEK293 cells.

[0076] Example 5 Effect of clinical drug dapagliflozin (SGLT2 selective inhibitor) on SGLT2 activity

[0077] The experimental method and reagents are the same as in Example 4. Experimental steps:

[0078] a HEK293 cells transfected with the overexpression vector (high glucose DMEM + 5% FBS + 1% penicillin-streptomycin) were cultured for 24 hours, and then the culture medium was replaced with serum-free medium (low glucose DMEM + 1% double antibody) and cultured for 2 hours. After that, different concentrations of Dapa (10, 5, 2.5 μM) were added for 1 hour.

[0079] b. Remove the culture medium, add 37°C preheated KRH-Na+ buffer (or KRH-NMG buffer) to rinse twice, then add 0.5 mL of transport buffer to each well and continue incubation at 37°C, 5% CO2 for 30 min;

[0080] c. Take out the cells from the incubator and place them on ice. Aspirate the transport buffer and add 200 μL of ice-cold stop buffer to each well to wash twice.

[0081] d. Add 200 μL of ice-cold stop buffer to each well, transfer the cells into an EP tube, pipette and vortex evenly, and perform flow cytometry to count the number of fluorescent cells.

[0082] e After aspirating the stop buffer in step b, add cell lysis buffer to lyse the cells for 30 minutes, transfer the lysate to a 96-well plate with a black frame and a transparent bottom, read the corresponding fluorescence values ​​(EBFP2 and 2-BNDG) on a fluorescence microplate reader, and calculate by the formula: SGLT2 activity relative value = Flu 2-BNDG Sample / Flu EBFP2 Sample mean.

[0083] The test results are shown in Table 2 and Figure 7 As shown:

[0084] Table 2

[0085]

[0086] Note: Dapa: dapagliflozin; green light: excitation wavelength 488nm, emission wavelength 542nm; blue light: excitation wavelength 383nm, emission wavelength 507nm

[0087] From Table 2 and Figure 7 It can be seen that the SGLT2 selective inhibitor dapagliflozin significantly inhibited the SGLT2-mediated absorption of exogenous glucose 2-BNDG in HEK293 cells.

[0088] Example 6 Effect of trilobatin on SGLT2 activity

[0089] The experimental method and reagents are the same as in Example 4. Experimental steps:

[0090] a HEK293 cells transfected with overexpression vectors (high glucose DMEM + 5% FBS + 1% penicillin-streptomycin) were cultured for 24 hours, and then the culture medium was replaced with serum-free medium (low glucose DMEM + 1% double antibody) and cultured for 2 hours. Different concentrations of trilobatin monomer (20, 10, 5, 2.5 μM) were added for 1 hour, and dapagliflozin (Dapa) 2.5 μM was used as a positive control; b The culture medium was removed, and KRH-Na+buffer (or KRH-NMGbuffer) preheated at 37°C was added to rinse twice, and then 0.5 mL of transport buffer was added to each well, and incubated for 30 minutes at 37°C and 5% CO2;

[0091] c. Take out the cells from the incubator and place them on ice. Aspirate the transport buffer and add 200 μL of ice-cold stop buffer to each well to wash twice.

[0092] d. Add 200 μL of ice-cold stop buffer to each well, transfer the cells into an EP tube, pipette and vortex evenly, and perform flow cytometry to count the number of fluorescent cells.

[0093] e After aspirating the stop buffer in step b, add cell lysis buffer to lyse the cells for 30 min, transfer the lysate (150 μL) to a 96-well plate with a black frame and a transparent bottom, read the corresponding fluorescence values ​​(EBFP2 and 2-BNDG) on a fluorescence microplate reader, and calculate by the formula: SGLT2 activity relative value = Flu 2-BNDG Sample / Flu EBFP2 Sample mean.

[0094] The test results are shown in Table 3 and Figure 8 As shown:

[0095] Table 3

[0096]

[0097] Note: Dapa: dapagliflozin; SYG: trilobatin; green light: excitation wavelength 488nm, emission wavelength 542nm; blue light: excitation wavelength 383nm, emission wavelength 507nm.

[0098] From Table 3 and Figure 8 It can be seen that: using the SGLT2 selective inhibitor dapagliflozin as a positive control, the inhibitory effect of trilobatin, an important active product of sweet tea, on SGLT2 was detected. The results showed that trilobatin could significantly inhibit the SGLT2-mediated glucose 2-BNDG absorption in HEK29 cells.

[0099] Example 7 Effect of phlorizin on SGLT2 activity

[0100] The experimental method and reagents are the same as in Example 4. Experimental steps:

[0101] a HEK293 cells transfected with overexpression vectors (high glucose DMEM + 5% FBS + 1% penicillin-streptomycin) were cultured for 24 hours, and then the culture medium was replaced with serum-free medium (low glucose DMEM + 1% double antibody) and cultured for 2 hours. Different concentrations of phlorizin monomer (20, 10, 5, 2.5 μM) were added for 1 hour, and dapagliflozin (Dapa) 10 μM was used as a positive control; b The culture medium was removed, and KRH-Na+buffer (or KRH-NMGbuffer) preheated at 37°C was added to rinse twice, and then 0.5 mL of transport buffer was added to each well, and incubated for 30 minutes at 37°C and 5% CO2;

[0102] c. Take out the cells from the incubator and place them on ice. Aspirate the transport buffer and add 200 μL of ice-cold stop buffer to each well to wash twice.

[0103] d. Add 200 μL of ice-cold stop buffer to each well, transfer the cells into an EP tube, pipette and vortex evenly, and perform flow cytometry to count the number of fluorescent cells.

[0104] e After aspirating the stop buffer in step b, add cell lysis buffer to lyse the cells for 30 min, transfer the lysate (150 μL) to a 96-well plate with a black frame and a transparent bottom, read the corresponding fluorescence values ​​(EBFP2 and 2-BNDG) on a fluorescence microplate reader, and calculate by the formula: SGLT2 activity relative value = Fluc 2-BNDG Sample / Fluc EBFP2 Sample mean.

[0105] The test results are shown in Table 4 and Fig. 9 As shown:

[0106] Table 4

[0107]

[0108] Note: Dapa: dapagliflozin; GPG: phlorizin; Green light: excitation wavelength 488nm, emission wavelength 542nm; Blue light: excitation wavelength 383nm, emission wavelength 507nm.

[0109] From Table 4 and Fig. 9 It can be seen that: using the SGLT2 selective inhibitor dapagliflozin as a positive control, the inhibitory effect of phlorizin, an important active product of sweet tea, on SGLT2 was detected. The results showed that phlorizin could significantly inhibit the SGLT2-mediated glucose 2-BNDG absorption in HEK29 cells.

[0110] The above-mentioned embodiments only express the specific implementation of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A method for screening anti-diabetic drugs based on fusion genes, characterized in that: The fusion gene is a fusion of the blue fluorescent protein gene EBFP2, the autolytic peptide gene T2A and the human sodium-glucose transporter gene SGLT2; The fusion gene has a nucleotide sequence as shown in SEQ ID NO: 1; The preparation method of the fusion gene is: First, the blue fluorescent protein gene EBFP2 and the self-cleaving peptide gene T2A were spliced ​​into a fusion gene EBFP2-T2A by PCR. Then the above fusion gene EBFP2-T2A was spliced ​​with the human gene SGLT2 by PCR method, and finally the complete fusion gene EBFP2-T2A-SGLT2 was obtained, i.e., the fusion gene; The following steps are involved: (1) Constructing the fusion gene overexpression vector pBTS based on the fusion gene EBFP2-T2A-SGLT2; (2) Transfecting cells with the fusion gene overexpression vector pBTS to establish a fusion gene overexpression cell model; The transfected cells are ATCC-derived human embryonic kidney cells HEK293; (3) This cell model uses EBFP2 as a reporter gene and 2-NBDG as a substrate of SGLT2 to establish a drug anti-diabetic evaluation system. The inhibitory effect of the drug on SGLT2 is preliminarily evaluated by calculating the fluorescence ratio of 2-NBDG and EBFP2, thereby indirectly evaluating the possible anti-diabetic effect of the drug.

2. The anti-diabetic drug screening method according to claim 1, characterized in that: The method for establishing the cell model in step (2) is replaced by establishing it by infecting adenovirus or lentivirus containing a fusion gene.

3. The anti-diabetic drug screening method according to claim 1, characterized in that: The screening method uses overexpressed SGLT2 protein as a drug target.

4. The anti-diabetic drug screening method according to claim 1, characterized in that: In step (1), pCDNA3.1 is used as the basic framework, and the fusion gene fragment is inserted into the multiple cloning site to obtain the overexpression vector pBTS.

Images