A Toxoplasma gondii attenuated strain, its construction method and application

By knocking out the TgPP6C gene of Toxoplasma gondii, the problem of poor protection effect of the existing vaccine was solved, effective immune protection and safety enhancement of Toxoplasma gondii, and a live attenuated vaccine with significant immune protection effect was prepared.

CN115992163BActive Publication Date: 2025-07-22LANZHOU VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES(LANZHOU BRANCH CENTER OF CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211210011.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-30
Publication Date
2025-07-22
Estimated Expiration
2042-09-30

AI Technical Summary

Technical Problem

The immune protection effect of the existing Toxoplasma gondii vaccine is not ideal, and the existing drug treatment has little effect on Toxoplasma gondii infection in the suprazoite stage, with toxic side effects, and lacks effective prevention and treatment methods.

Method used

By knocking out the TgPP6C gene in Toxoplasma gondii, CRISPR-Cas9 technology was used to construct the TgPP6C attenuated strain of Toxoplasma gondii with the deletion of TgPP6C gene, reducing its pathogenicity and enhancing immune protection, and preparing a live attenuated vaccine.

Benefits of technology

The attenuated strain of Toxoplasma gondii with the deletion of TgPP6C significantly reduced the rate of proliferation in vitro, infected mice did not develop morbidity and did not die, produced high IgG antibody levels, provided significant immune protection and prevented Toxoplasma gondii reinfection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115992163B_ABST
    Figure CN115992163B_ABST
Patent Text Reader

Abstract

The present invention provides a Toxoplasma gondii attenuated strain, its construction method and application, belonging to the field of biomedical technology. By knocking out the TgPP6C gene in Toxoplasma gondii, an attenuated strain of Toxoplasma gondii lacking the TgPP6C gene is finally obtained. Compared with the wild strain, the in vitro proliferation rate of the Toxoplasma gondii attenuated strain lacking the TgPP6C gene is significantly decreased, and its pathogenicity is significantly reduced. Infected mice show no disease and no death, indicating high safety for the host. At the same time, after immunizing mice with the Toxoplasma gondii attenuated strain lacking the TgPP6C gene, high IgG antibody levels are generated, which can provide significant immune protection against reinfection with high doses of Toxoplasma gondii RH, PYS tachyzoites and Pru cysts. It can be used to prevent reinfection with Toxoplasma gondii and is an attenuated live vaccine with great application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to a Toxoplasma gondii avirulent strain, a construction method thereof and an application thereof. Background Art

[0002] Toxoplasma gondii is an opportunistic pathogenic protozoan that obligately parasitizes within cells, and can infect almost all warm-blooded animals including humans, and is widely distributed worldwide. Toxoplasma gondii belongs to an opportunistic pathogen. When a person ingests raw meat containing Toxoplasma gondii tissue cysts or water contaminated by oocysts in cat feces, the oocysts or tissue cysts rupture, and the parasites invade the intestinal mucosal cells. The sporozoites released by the oocysts or the bradyzoites released by the tissue cysts will transform into tachyzoites, and ultimately be distributed to various parts of the body, causing Toxoplasma gondii infection in the host. After a person with normal immunity is infected with Toxoplasma gondii, under the action of the body's immune system, the host does not show obvious clinical symptoms. However, for patients with low immune function, such as organ transplant patients, AIDS patients, etc., Toxoplasma gondii infection has a high risk and even leads to the death of the host. The treatment of existing drugs only works on the tachyzoite stage of the parasites, and has little effect on the bradyzoites in the cysts, and the use of drugs has certain toxic and side effects.

[0003] In recent years, scholars at home and abroad believe that developing vaccines to immunize hosts may be an effective measure for preventing and controlling toxoplasmosis. At present, the research and development of Toxoplasma gondii vaccines mainly focuses on inactivated vaccines, subunit vaccines, nucleic acid vaccines, etc. However, such vaccines can only provide partial immune protection for the immunized body and cannot achieve complete protection, and the immune protection effect is not ideal. Avirulent vaccines have advantages such as good immunogenicity and long immune period, and have become one of the best choices for preventing and controlling toxoplasmosis. However, at present, only one S48 Toxoplasma gondii avirulent live vaccine is allowed to be used in preventing abortions in goats and sheep, but this vaccine is only limited to use in countries such as New Zealand, and its genetic background is unclear. Therefore, finding new and effective vaccine candidate antigens for the research and development of anti-Toxoplasma gondii vaccines has become an important task for protecting human health. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a Toxoplasma gondii avirulent strain, a construction method thereof and an application thereof. The present invention finally obtains a Toxoplasma gondii avirulent strain with the TgPP6C gene deleted by knocking out the TgPP6C gene in Toxoplasma gondii, and finds that a low dose of the Toxoplasma gondii avirulent strain can have immune protection against acute and chronic infections of Toxoplasma gondii.

[0005] In order to achieve the above purpose, the present invention provides the following technical solutions:

[0006] A method for constructing a Toxoplasma gondii attenuated strain, which constructs the Toxoplasma gondii attenuated strain by knocking out the TgPP6C gene to affect the intracellular proliferation and pathogenicity of Toxoplasma gondii; the nucleotide sequence of the TgPP6C gene is as shown in SEQ ID NO.1.

[0007] Preferably, the knockout of the TgPP6C gene is carried out by using the CRISPR-Cas9 technology.

[0008] Preferably, the nucleotide sequence of the sgRNA of the CRISPR / Cas9 system is as shown in SEQ ID NO.2.

[0009] The present invention also provides a Toxoplasma gondii attenuated strain constructed by the above method for constructing a Toxoplasma gondii attenuated strain.

[0010] The present invention also provides an application of the above Toxoplasma gondii attenuated strain in a drug for preventing or treating Toxoplasma gondii infection.

[0011] The present invention also provides a live attenuated vaccine against Toxoplasma gondii, which comprises the above Toxoplasma gondii attenuated strain.

[0012] Beneficial technical effects: The present invention provides a Toxoplasma gondii attenuated strain and its construction method and application. By knocking out the TgPP6C gene in Toxoplasma gondii, an attenuated strain of Toxoplasma gondii lacking the TgPP6C gene is finally obtained. Compared with the wild strain, the in vitro proliferation rate of the Toxoplasma gondii attenuated strain lacking the TgPP6C gene is significantly decreased, and the pathogenicity is significantly reduced. Infected mice show no disease and no death, and it has high safety for the host. At the same time, after immunizing mice with the Toxoplasma gondii attenuated strain lacking the TgPP6C gene, a high IgG antibody level is produced, and significant immune protection efficacy can be provided against reinfection with high-dose Toxoplasma gondii RH, PYS tachyzoites and Pru cysts. It can be used to prevent reinfection with Toxoplasma gondii and is a live attenuated vaccine with great application value. Description of the Drawings

[0013] Figure 1 It is a schematic diagram for the construction of the Toxoplasma gondii attenuated strain RHΔpp6c, where A is a schematic diagram for the knockout of the TgPP6C gene; B is a PCR identification result diagram of the RHΔpp6c strain, where PCR1 and PCR3 respectively represent the 5' and 3' integrations of the homologous fragments, and PCR2 represents whether the TgPP6C gene has been successfully replaced.

[0014] Figure 2Basic phenotypic analysis of the Toxoplasma gondii weak virulent strain RHΔpp6c. Among them, A is the plaque pattern of the wild strain WT and RHΔpp6c; B is the intracellular proliferation experiment of the wild strain WT and RHΔpp6c and the statistics of irregular parasitophorous vacuoles. "*" represents p < 0.05, with significant difference; "***" represents p < 0.001, with extremely significant difference; scale bar: 2μm; C is the proliferation of tachyzoites in cells after the deletion of TgPP6C.

[0015] Figure 3 Antibody levels and survival curves of mice infected with different strains. Among them, A is the antibody levels of IgG, IgG1 and IgG2a in the sera of different mice; B is the survival rates of mice infected with the WT and RHΔpp6c weak virulent strains; C is the survival rates of mice infected with different Toxoplasma gondii after vaccination; D is the survival rates of mice after oral gavage with cysts; E is the number of cerebral cysts in mice 30 days after cyst infection. "n.s." represents not significant, "***" represents p < 0.001, with extremely significant difference. Detailed implementation mode

[0016] The present invention provides a method for constructing a Toxoplasma gondii weak virulent strain, which constructs a Toxoplasma gondii weak virulent strain by knocking out the TgPP6C gene to affect the intracellular proliferation and pathogenicity of Toxoplasma gondii; the nucleotide sequence of the TgPP6C gene is shown as SEQ ID NO.1.

[0017] In the present invention, the method for constructing the Toxoplasma gondii weak virulent strain includes the following steps:

[0018] (1) Construction of the knockout plasmid: Replace UPRT in pSAG1-Cas9-SgUPRT with TgPP6C, that is, construct the plasmid pSAG1-Cas9-SgTgPP6C; construct the homologous fragment DHFR containing TgPP6C, design 5'-end homologous arm and 3'-end homologous arm primers before the start codon and after the stop codon of the TgPP6C gene, and at the same time design the universal amplification primers of pUPRT-DHFR-D and pUC19 for ligation; finally, amplify the successfully sequenced DHFR plasmid.

[0019] (2) Construction of the Toxoplasma gondii weak virulent strain: Electroporate the above pSAG1-Cas9-SgTgPP6C knockout plasmid and the resistance fragment containing the PP6C homologous arm into Toxoplasma gondii, and obtain the Toxoplasma gondii weak virulent strain through screening and identification, denoted as RHΔpp6c.

[0020] In the present invention, the knockout of the TgPP6C gene is preferably carried out by using the CRISPR-Cas9 technology.

[0021] In the present invention, the nucleotide sequence of the sgRNA of the CRISPR / Cas9 system is shown as SEQ ID NO.2.

[0022] The present invention also provides a Toxoplasma gondii attenuated strain, which is constructed by the above-mentioned method for constructing a Toxoplasma gondii attenuated strain.

[0023] The present invention also provides an application of the above-mentioned Toxoplasma gondii attenuated strain in a drug for preventing or treating Toxoplasma gondii infection.

[0024] The present invention has no special limitation on the dosage form of the drug, and a pharmaceutically acceptable dosage form of the Toxoplasma gondii attenuated strain can be adopted. The present invention has no special limitation on the preparation method of the drug, and the preparation method corresponding to the dosage form can be adopted.

[0025] The present invention also provides a live attenuated Toxoplasma gondii vaccine, which comprises the above-mentioned Toxoplasma gondii attenuated strain.

[0026] To better understand the present invention, the content of the present invention will be further clarified below in conjunction with examples. However, the content of the present invention is not limited to the following examples. The experimental methods used in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified. The Toxoplasma gondii type I RH strain was purchased from the American Type Culture Collection (ATCC), and the purchase catalog number was 50174.

[0027] Example 1

[0028] (1) Construction of the knockout plasmid:

[0029] Design sgRNA according to the TgPP6C gene (TGGT1_301010) in the Toxoplasma gondii genome website ToxoDB, and its nucleotide sequence is shown in SEQ ID NO.2. Use the Q5 site-directed mutagenesis kit to replace UPRT in pSAG1-Cas9-SgUPRT with TgPP6C, that is, construct the plasmid pSAG1::Cas9::SgTgPP6C. Construction of the TgPP6C homologous fragment DHFR. Design 5'-end homologous arm and 3'-end homologous arm primers before the start codon and after the stop codon of the TgPP6C gene. The nucleotide sequence of the upstream primer of the 5'-end homologous arm primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4; the nucleotide sequence of the upstream primer of the 3'-end homologous arm primer is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6.

[0030] Design amplification primers for DHFR and pUC19 amplification primers. Among them, the nucleotide sequence of the upstream primer for amplifying the DHFR universal amplification primer from the pUPRT-DHFR-D vector is shown in SEQ ID NO.7, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.8; the nucleotide sequence of the pUC19 upstream primer is shown in SEQ ID NO.9, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.10

[0031] According to the MultiS One Step Cloning Kit was used for ligation. The ligation system is as follows:

[0032]

[0033] Then the ligation product was transformed into DH5α competent cells. Finally, the successfully sequenced DHFR plasmid PUC19-TgPP6C-DHFR was amplified, that is, the homologous fragment DHFR was amplified. The nucleotide sequence of the upstream primer of the amplification primer is shown in SEQ ID NO.11 above, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.12

[0034] Among them, the amplification reaction system is as follows:

[0035]

[0036] The reaction conditions were: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 56°C for 1 min, extension at 72°C for 4 min, for a total of 30 cycles; finally, extension at 72°C for 5 min

[0037] SEQ ID NO.2: GGAGTGAGAAGAGCTGTCTC;

[0038] SEQ ID NO.3: CTTCTTCCGTCTGCTTCG;

[0039] SEQ ID NO.4: GCCTTCTTGTCGAGAGTG;

[0040] SEQ ID NO.5: TGGAGACAAAGTGGTGAAG;

[0041] SEQ ID NO.6: CCAGCATTGACTCATAGAAC;

[0042] SEQ ID NO.7: AAGCTTCGCCAGGCTGTAAATCC

[0043] SEQ ID NO.8: GAATTCATCCTGCAAGTGCATAG;

[0044] SEQ ID NO.9: TGTGAAATTGTTATCCGCTC;

[0045] SEQ ID NO.10: AACGTCGTGACTGGGAAAACC;

[0046] SEQ ID NO.11: CTTCTTCCGTCTGCTTCG;

[0047] SEQ ID NO.12: CCAGCATTGACTCATAGAAC.

[0048] (2) Construction of RHΔpp6c tachyzoite strain:

[0049] Inoculate HFF cells into a 25T cell culture flask, add 8 mL of DMEM medium containing 10% FBS, and culture in a CO2 incubator at 37°C. After the cells are completely confluent, change to 8 mL of DMEM medium containing 2% FBS, add 500 μL of freshly released RH tachyzoites, and culture for 48 h. Then collect and purify the tachyzoites for electroporation of Toxoplasma gondii. Electroporate the pSAG1-Cas9-SgTgPP6C plasmid and the DHFR resistance fragment containing the TgPP6C homologous arms into Toxoplasma gondii. Obtain monoclonal tachyzoite strains through pyrimethamine and limited dilution in a 96-well cell plate. After large-scale culture, extract genomic DNA, amplify the 5' and 3' homologous arms of the PP6C gene and the DHFR open reading frame to verify whether the TgPP6C gene is knocked out. The nucleotide sequences of the amplification primers are shown in SEQ ID NO.13 - SEQ ID NO.18. Among them, SEQ ID NO.13 - SEQ ID NO.14 are the upstream and downstream primers for amplifying the 5' homologous arm respectively. The reaction system is as follows:

[0050]

[0051] Reaction conditions: Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 56°C for 1 min, extension at 72°C for 2 min, for a total of 30 cycles; finally, extension at 72°C for 5 min.

[0052] SEQ ID NO.15 - SEQ ID NO.16 are the upstream and downstream primers for amplifying the 3' homologous arm respectively. The amplification reaction system is as follows:

[0053]

[0054] Reaction conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 56°C for 1 min, extension at 72°C for 2 min, for a total of 30 cycles; finally, extension at 72°C for 5 min.

[0055] SEQ ID NO.17 and SEQ ID NO.18 are the upstream and downstream primers for amplifying the DHFR open reading frame, respectively. Among them, the reaction system is as follows:

[0056]

[0057]

[0058] Reaction conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 56°C for 1 min, extension at 72°C for 30 s, for a total of 30 cycles; finally, extension at 72°C for 5 min.

[0059] SEQ ID NO.13: TCTGTTCCATCTCTTCTGCATCT;

[0060] SEQ ID NO.14: ATGCTAATTCCTTTCTACTTTGGC;

[0061] SEQ ID NO.15: ACATGACACATTCCAAGTTC;

[0062] SEQ ID NO.16: CTTCAGCAGCATCAAGTAC;

[0063] SEQ ID NO.17: TGACGCAGATGTGCGTGTATCCAC;

[0064] SEQ ID NO.18: CTTGATTGGAACCACGAAGCAC;

[0065] From the results of PCR amplification, it can be seen that specific bands are present in PCR1 and PCR3, while no specific band is present in PCR2, confirming that TgPP6C has been knocked out.

[0066] Experimental Example 1:

[0067] (1) Basic phenotype analysis:

[0068] Indirect immunofluorescence: A small amount of completely escaped wild-type (WT) and RHΔpp6c parasite strains were taken from 25 T cell flasks, counted using a hemocytometer, and diluted to a final concentration of 10 5 / mL. 100μL of confocal dishes covered with HFF were inoculated for 24h; DMEM culture medium was discarded, 1mL of tissue fixative was added for 30min at room temperature; the cell culture dishes were washed 4 times with PBS solution, 0.2% TritonX-1001mL was added for 30min at room temperature; the dishes were washed 4 times with PBS solution, 3% BSA solution was added for 1h at room temperature; the dishes were washed 4 times with PBS solution, the primary antibody was added evenly to each dish, and the dishes were incubated overnight at 4℃; the primary antibody was rabbit anti-IMC1 (1:1000); the dishes were washed 4 times with PBS solution, the secondary antibody was added to each dish, and the dishes were incubated in a 37℃ incubator in dark for 1h; the secondary antibody was AlexaFluor488 goat anti-rabbit IgG (H+L) (1:1000); the dishes were washed 4 times with PBS solution, and the dishes were observed under a laser confocal microscope.

[0069] Plaques: Take a small amount of wild-type (WT) and RHΔpp6c strains that have completely escaped from the 25T cell bottle and count them to make the final concentration reach 10 3 / mL. In a 12-well plate filled with HFF, 200μL was added to each well, and the tachyzoites were evenly distributed in the wells by blowing gently, and then placed in a cell culture incubator; cultured for 7 days, the supernatant was discarded, and the bottom of the wells were washed 5 times by blowing gently with PBS solution; 1mL of tissue fixative was added to fix for 30min, the supernatant was discarded, and the PBS solution was washed 5 times; 1mL of 0.25% crystal violet was added to each well for staining for 30min, the supernatant was discarded, and the PBS solution was washed 5 to 7 times, and the remaining liquid around the wells was absorbed with absorbent paper, and the size and number of worm spots were calculated after air drying.

[0070] Intracellular proliferation: Take a small amount of wild-type (WT) and RHΔpp6c strains that have completely escaped from the 25T cell flask, count them, and dilute them to a final concentration of 1×10 6 / mL, 100μL was added to a 6-well plate covered with HFF. After invasion for 1 hour, the non-invading tachyzoites were washed away with preheated PBS solution; culture was continued for 3 hours, the culture medium was discarded, washed 4 times, and then fixed with tissue fixative for 30 minutes, and washed 4 times with PBS solution; 0.2% TritonX-100 was added and penetrated for 30 minutes; washed 4 times with PBS solution, 3% BSA was added and blocked for 40 minutes; washed 4 times with PBS solution, mouse anti-Toxoplasma gondii SAG1 monoclonal antibody (1:1000) was added, and incubated at 4℃ overnight; washed 4 times with PBS solution, Alexa Fluor488 goat anti-mouse IgG (H+L) (1:1000) was added, and incubated at 37℃ for 1 hour; washed 4 times with PBS solution, and the number of worm spots containing 1-2, 4-6, 8-10, 16-32 and >32 tachyzoites in PV was recorded and counted under a fluorescence microscope, and the proportion of abnormal number of tachyzoites in PV was counted at the same time.

[0071] (4) Preparation of the live attenuated vaccine:

[0072] Inoculate HFF cells into a 25T cell culture flask, add 8 mL of DMEM medium containing 10% FBS, and culture in a CO2 incubator at 37°C. After the cells are completely confluent, change to 8 mL of RPMI medium containing 2% FBS, add 100 μL of RHΔpp6c strain, and culture in a CO2 incubator at 37°C until the parasites escape from the cells, and collect the RHΔpp6c tachyzoites; filter the collected parasite suspension through a 3-μm filter to remove cell debris, and then adjust the concentration of tachyzoites to 100 tachyzoites / 200 μL and 200 tachyzoites / 200 μL with sterile PBS; the live attenuated vaccine is prepared.

[0073] (5) Immunization of mice:

[0074] Before immunization, the purchased female Kunming mice are first raised for one week to reduce stress response. Divide the mice into two major groups. One group is the immunization group: each mouse is intraperitoneally injected with 200 μL (100 tachyzoites) of RHΔpp6c tachyzoites; the other group is the control group: each mouse is intraperitoneally injected with 200 μL (100 tachyzoites) of wild-type WT tachyzoites to evaluate the virulence effect. Subsequently, the mice are divided into two major groups again. One group is the immunization group: each mouse is intraperitoneally injected with 200 μL (200 tachyzoites) of RHΔpp6c tachyzoites; the other group is the control group: each mouse is intraperitoneally injected with 200 μL of sterile PBS.

[0075] (6) Evaluation of immune effect:

[0076] Acute Toxoplasma gondii infection group: On the 60th day after immunization, take 12 RHΔpp6c immunized mice and blank control Kunming mice each, pick out a small amount of completely escaped wild-type RH and PYS tachyzoites from the 25T cell flask, count with a hemocytometer, and dilute to a final concentration of 5×10 3 tachyzoites / mL. Aspirate 200 μL of RH tachyzoites and intraperitoneally inject them into mice (6 mice), aspirate 200 μL of PYS tachyzoites and intraperitoneally inject them into mice (6 mice). Observe the health status of the mice every day after infection and record their survival time. On the 30th day after infection, euthanize the surviving mice.

[0077] Chronic Toxoplasma gondii infection group: On the 60th day after immunization, take 12 RHΔpp6c immunized mice and blank control Kunming mice each, orally infect them with 20 type II PRU cysts, and observe the health status of the mice every day after challenge and record their survival time; on the 30th day after infecting with PRU cysts, euthanize the surviving mice and detect the number of cysts in their brain tissues.

[0078] (7) Immunization of mice:

[0079] Antibody monitoring among different groups: On the 30th day after immunization, sera from 6 immunized mice were collected to detect the levels of IgG antibody and IgG1 and IgG2a antibody subclasses.

[0080] Results:

[0081] (1) Basic phenotype test:

[0082] The plaque assay showed that compared with WT, RHΔpp6c showed a highly significant decrease in the size and number of plaques formed (p < 0.001), and almost no plaques could be formed. See Figure 2 A. We observed that the deletion of TgPP6C led to the disorder of Toxoplasma gondii intracellular proliferation. The main manifestation was that when the number of intracellular tachyzoites reached "2", further division into "4" would show asynchronous division, and so on (division into 4 - 8, 8 - 16, and 16 - 32, etc.), and the common "rosette" shape could not be formed. See Figure 2 C. Therefore, it was inferred that the deletion of TgPP6C mainly affected the intracellular proliferation stage of tachyzoites. As can be seen from Figure 2 B, the number of parasitophorous vacuoles with irregular shapes formed by RHΔpp6c was significantly higher than that of WT (p < 0.001).

[0083] (2) Toxoplasma gondii virulence test:

[0084] Six mice were intraperitoneally injected with approximately 100 tachyzoites of Toxoplasma gondii wild strain (WT) RH strain and RHΔpp6c strain per mouse. As can be seen from Figure 3 B: Mice infected with wild strain tachyzoites all died within 8 - 10 days, while mice infected with RHΔpp6c tachyzoites did not die (p < 0.001).

[0085] (3) Acute infection test of Toxoplasma gondii RH and PYS strains:

[0086] Six mice in each experimental group were used for intraperitoneal inoculation with approximately 10 3 tachyzoites of Toxoplasma gondii RH and PYS strains per mouse. The day of inoculation was recorded as day 0, and the survival time of the mice was recorded. As can be seen from Figure 3 C: Control group mice all died within 10 days after infection with RH or PYS tachyzoites, while the RHΔpp6c immunized group did not die after infection with 10 3 tachyzoites of RH or PYS, and the survival time was significantly different from that of the control group (p < 0.001).

[0087] (4) Chronic infection test of Toxoplasma gondii Pru cysts:

[0088] Thirty days after immunization, we will prepare viable type II Pru cysts in advance and infect each mouse by gavage at a dose of 20. In the control group, the mice started to show symptoms and some died 10 days after infection, while the RHΔpp6c-immunized mice did not show symptoms or die, as can be seen from Figure 3 D. Thirty days after cyst infection, we collected the brain tissues of the surviving mice and counted the number of cerebral cysts. The results showed that the number of cysts in the control group was 3290±100, and that in the immunized group was 35±14 (p<0.001), as shown in detail in Figure 3 E.

[0089] (5) Evaluate the immune response induced by RHΔpp6c:

[0090] On the 30th day after immunization, the sera of the immunized mice were collected to detect the levels of anti-Toxoplasma IgG, IgG1, and IgG2a antibodies. As can be seen from Figure 3 A, the levels of IgG, IgG1, and IgG2a in the RHΔpp6c-immunized mice were significantly higher than those in the control group (p<0.001).

[0091] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A method for constructing a Toxoplasma gondii attenuated strain, characterized in that, Construct a Toxoplasma gondii attenuated strain by knocking out the TgPP6C gene to affect the intracellular proliferation and virulence of Toxoplasma gondii; the nucleotide sequence of the TgPP6C gene is as shown in SEQ ID NO.

1.

2. The construction method of the Toxoplasma gondii attenuated strain according to claim 1, characterized in that, The knockout of the TgPP6C gene is carried out by using the CRISPR-Cas9 technology.

3. The construction method of the Toxoplasma gondii attenuated strain according to claim 2, characterized in that, The nucleotide sequence of the sgRNA of the CRISPR-Cas9 system is as shown in SEQ ID NO.

2.

4. A Toxoplasma gondii attenuated strain, characterized in that, Constructed by the method for constructing a Toxoplasma gondii attenuated strain according to any one of claims 1 to 3.

5. Use of the Toxoplasma gondii attenuated strain according to claim 4 in the preparation of a drug for preventing Toxoplasma gondii infection.

6. A live attenuated vaccine against Toxoplasma gondii, characterized in that, Comprising the Toxoplasma gondii attenuated strain according to claim 4.

Citation Information

Patent Citations

  • Toxoplasma gondii attenuated live vaccine with deletion of AP2IV-1 gene and construction method thereof

    CN111607521A