mRNA dosage form biological preparation for repairing articular cartilage defects and its preparation method and application

Abstract

The present invention discloses a biological preparation for repairing articular cartilage defects, a preparation method and its application. The preparation includes active ingredient mRNA, as shown in SEQ ID NO: 1 or a sequence with a similarity of more than 90%; the method includes synthesizing DNA fragments, cloning the DNA fragments into expression plasmids to obtain recombinant plasmids, transferring the recombinant plasmids into host cells to obtain recombinant cells, extracting plasmids from recombinant cells, PCR amplification to obtain DNA templates, using the DNA templates to construct an RNA in vitro synthesis system and perform RNA in vitro synthesis to obtain active ingredient mRNA; application in pharmaceutical preparations for cartilage repair. The present invention uses an in vitro transcription method to synthesize a chemically modified FoxO1mRNA gene, and injecting the preparation into the articular cartilage defect can promote the differentiation of endogenous mesenchymal stem cells into cartilage; it has excellent biological activity and has application value in tissue engineering.

Description

Technical Field

[0001] The present invention belongs to the technical field of cartilage defect repair and treatment of biological preparations, preparation methods and applications, and in particular relates to an mRNA dosage form articular cartilage defect repair preparation and a preparation method and application thereof. Background Art

[0002] Cartilage defects are common orthopedic diseases, especially in athletes, and cartilage damage is usually accompanied by subchondral bone damage. Patients often experience joint swelling, pain, and limited mobility, which affects their daily life and work, and imposes a large economic burden on society. There are no blood vessels, nerves, or lymph nodes in the cartilage, and its self-repair ability after injury is poor, making it difficult to treat, which has always been a difficult problem in orthopedics. Current clinical treatment methods such as microfractures, osteochondral column transplantation, and chondrocyte transplantation do not involve combined treatment of osteochondral injuries, and the newly formed cartilage tissue is often fibrocartilage rather than hyaline cartilage. Fibrocartilage has poor mechanical properties and cannot withstand the huge stress generated during daily activities of the knee joint. It is prone to degeneration and wear, so long-term efficacy cannot be guaranteed. Summary of the invention

[0003] In order to solve the problems existing in the background technology, the present invention provides an mRNA dosage form biological preparation for repairing articular cartilage defects, and its preparation method and application. The mRNA sequence is SEQ ID NO: 1. The biological preparation has the ability to stimulate the expression of chondrogenic differentiation markers of bone marrow mesenchymal stem cells (BMSCs) and enhance the synthesis of extracellular matrix. In vivo experiments have confirmed that it enhances cartilage matrix repair, thereby achieving the purpose of treating cartilage defects.

[0004] The present invention constructs a biological preparation in the form of a chemically modified mRNA dosage form, which provides a new idea for tissue engineering repair, and enhances stability, reduces immunogenicity and increases expression effect through chemically modified mRNA.

[0005] In order to construct a tissue engineering scaffold, the present invention adopts the following technical solution:

[0006] 1. An mRNA dosage form biological preparation for repairing articular cartilage defects:

[0007] The invention comprises active component mRNA and cationic liposomes, wherein the active component mRNA is SEQ ID NO: 1 or a sequence with a similarity of more than 90% to the sequence shown in SEQ ID NO: 1.

[0008] The biological preparation is a liquid preparation and is a drug preparation for repairing cartilage defects.

[0009] The 5' end of the mRNA is connected to the 5' UTR via a cap structure; and the 3' end of the mRNA is connected to the poly A tail via a 3' UTR.

[0010] The uracil in the FoxO1 mRNA was replaced by Pseudo UTP.

[0011] The cartilage defect repair preparation is an injection preparation.

[0012] The active component mRNA is added into the solvent PBS to prepare a solution, and the concentration of the active component mRNA in the solution is 0.5-20 μg / μl.

[0013] 2. A method for preparing a cartilage defect repair preparation, the method comprising the following steps:

[0014] 1) synthesizing and transcribing a DNA fragment corresponding to the mRNA of the active ingredient in the cartilage defect repair preparation, and cloning the DNA fragment into an expression plasmid to obtain a recombinant plasmid;

[0015] 2) transferring the recombinant plasmid into a host cell to obtain a recombinant cell, expanding the recombinant cell, extracting a plasmid from the expanded recombinant cell, and performing PCR amplification using the extracted plasmid as a template to obtain a DNA template for in vitro expression of mRNA;

[0016] 3) Using a DNA template to construct an RNA in vitro synthesis system including the DNA template and performing RNA in vitro synthesis to obtain the active ingredient mRNA.

[0017] The RNA in vitro synthesis system, based on 1600 μl, includes the following components:

[0018] RNase-free water 440μl;

[0019] 7.5 mM ATP 160 μl;

[0020] 7.5 mM UTP or Pseudo UTP 160 μl;

[0021] 7.5 mM CTP 160 μl;

[0022] 7.5 mM GTP 160 μl;

[0023] 7.5 mM M7G (2'OMeA) pG 160 μl;

[0024] 40 μl of 150 ng / μl DNA template;

[0025] 10× Buffer 160 μl;

[0026] Enzyme Mix 160μl.

[0027] The conditions for the in vitro synthesis of the RNA are 36-38° C. for 8-12 hours.

[0028] 3. An mRNA dosage form biological preparation and its application:

[0029] The mRNA dosage form biological preparation is prepared by the preparation method.

[0030] The mRNA dosage form biological preparation is used in the pharmaceutical preparation for cartilage matrix repair and cartilage defect repair.

[0031] The formulation also includes a delivery material;

[0032] Preferably, the delivery material includes but is not limited to PEI, PAMAM, poly-lysine, chitosan, liposomes, lipid nanoparticles;

[0033] Preferably, the delivery material is PEI.

[0034] Beneficial effects of the present invention:

[0035] The present invention uses in vitro transcription to synthesize chemically modified FoxO1 mRNA gene, and injects the preparation into the defect of articular cartilage to promote the differentiation of endogenous mesenchymal stem cells into cartilage; it has excellent biological activity and application value in tissue engineering.

[0036] The mRNA dosage form of the cartilage defect repair preparation provided by the present invention includes a protein transcription factor mRNA that stimulates cartilage regeneration. After the cartilage defect repair preparation is introduced into target cells, it can promote the cartilage differentiation of BMSCs; the preparation of the cartilage defect repair preparation is simple and rapid, with a high expression level and low immunogenicity, and can quickly and efficiently promote the synthesis of cartilage cell extracellular matrix, thereby achieving the purpose of treating cartilage defects.

[0037] According to the description in the examples, the transcription factor mRNA for stimulating cartilage regeneration provided by the present invention can be expressed at a high level specifically in cells; after the mRNA provided by the present invention is injected into the articular cavity, TNFα in the serum of rats is not significantly increased, indicating that the cartilage defect repair preparation in the mRNA dosage form provided by the present invention has lower immunogenicity and good safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 is the plasmid map of pEGFP-N1 plasmid;

[0039] Figure 2 PCR was used to detect the gene expression of transcription factor FoxO1 in cells under different treatment methods;

[0040] Figure 3 PCR was used to detect the gene expression of Col2a1 in cells under different treatment methods;

[0041] Figure 4 TNFα levels in rats injected with the cartilage defect preparation of the mRNA dosage form provided by the present invention. DETAILED DESCRIPTION

[0042] The present invention is further described below in conjunction with the accompanying drawings and examples. The following specific examples are used to illustrate the present invention, but should not be construed as limiting the present invention. Within the spirit of the present invention and the protection scope of the claims, any modifications and changes made to the present invention fall within the protection scope of the present invention. The reagents used in all examples are not less than analytically pure standards.

[0043] The present invention provides a cartilage defect repair preparation in the form of an mRNA dosage form, comprising an active ingredient mRNA, wherein the mRNA is as shown in SEQ ID No. 1 (hereinafter referred to as Seq 1):

[0044]

[0045] In the present invention, the 5' end of the mRNA is preferably connected to the cap structure and the 5' UTR; and the 3' end of the mRNA is preferably connected to the 3' UTR and the poly A tail.

[0046] In the present invention, uracil in the mRNA shown in SEQ ID No. 1 is preferably replaced with Pseudo UTP, and replacing uracil with Pseudo UTP can improve the stability and expression efficiency of mRNA. In the present invention, the replacement is preferably achieved by replacing UTP in the raw material with Pseudo UTP during in vitro synthesis of mRNA.

[0047] In the present invention, the cartilage defect repair preparation is preferably a liquid preparation, more preferably an injection preparation. In the present invention, the concentration of the active ingredient mRNA in the cartilage defect repair preparation is preferably 0.5-20 μg / μl. The solvent of the active ingredient mRNA is preferably PBS. The present invention has no special restrictions on the preparation method of the PBS, and the conventional PBS in the art can be used. The present invention has no special restrictions on the preparation method of the injection preparation, and it can meet the requirements of conventional injection preparations in the art.

[0048] The present invention provides a method for preparing the cartilage defect repair preparation, comprising the following steps:

[0049] 1) synthesizing a DNA fragment corresponding to the mRNA of the active ingredient in the cartilage defect repair preparation, and cloning the DNA fragment into an expression plasmid to obtain a recombinant plasmid;

[0050] 2) transferring the recombinant plasmid into host cells to obtain recombinant cells, extracting plasmids from the expanded recombinant cells, and performing PCR amplification using the extracted plasmids as templates to obtain DNA templates for in vitro expression of mRNA;

[0051] 3) constructing an RNA in vitro synthesis system including the DNA template described in the specification to perform in vitro synthesis of mRNA to obtain the active ingredient mRNA.

[0052] In the present invention, a DNA fragment of the mRNA is synthesized and transcribed, and the DNA fragment is cloned into an expression plasmid to obtain a recombinant plasmid. The present invention does not specifically limit the method for synthesizing the DNA fragment corresponding to the mRNA, and the conventional DNA synthesis method in the art can be used. In the specific implementation of the present invention, it is preferably commissioned to a biotechnology company for synthesis. In the present invention, the specific sequence of the DNA fragment is determined according to the principle of complementary base pairing. In the present invention, the expression plasmid is preferably a pEGFP-N1 plasmid. In the present invention, the plasmid map of the pEGFP-N1 plasmid is as shown in Figure 1As shown, the pEGFP-N1 plasmid also includes promoters SV40 and pCMV, and a multiple cloning site.

[0053] In the present invention, the DNA fragment is preferably cloned into an expression plasmid by a method of enzyme digestion and ligation; in the present invention, the DNA fragment is preferably double-digested by BamHI and NheI enzymes to obtain a digested DNA fragment; the expression plasmid is preferably double-digested by BamHI and NheI enzymes to obtain a digested plasmid; and then the digested DNA fragment and the digested plasmid are connected to obtain a recombinant plasmid. The present invention does not specifically limit the specific operations of the double digestion and ligation, and the conventional double digestion and ligation operations in the art can be used.

[0054] After obtaining the recombinant plasmid, the present invention transfers the recombinant plasmid into a host cell to obtain a recombinant cell, extracts the plasmid from the expanded recombinant cell, and uses the extracted plasmid as a template to perform PCR amplification to obtain a DNA template for in vitro expression of mRNA. In the present invention, the host cell is preferably an Escherichia coli competent cell; the present invention does not specifically limit the transfer method, and the conventional transfer method in the art can be used. After obtaining the recombinant cell, the present invention preferably performs screening of positive recombinant cells and colony sequencing. In the present invention, the screening of positive recombinant cells is preferably performed on an amp-resistant solid culture medium. In the present invention, a single colony on the amp-resistant solid culture medium is selected for colony PCR, and the colony containing the target band in the colony PCR result is selected for sequencing. The present invention does not specifically limit the specific steps of the colony PCR, and the conventional colony PCR steps in the art can be used.

[0055] In the present invention, the plasmid of the correctly sequenced recombinant cell is extracted; the present invention has no particular limitation on the method for extracting the plasmid, and preferably a plasmid extraction kit is used. In the present invention, the extracted plasmid is used as a template for PCR amplification to obtain a DNA template for in vitro expression of mRNA. In the present invention, the PCR amplification system is based on 50 μl, preferably as follows:

[0056] PrimeSTAR Max Premix(2×)25μl

[0057] Primer F1.2 μl

[0058] Primer R 1.2 μl

[0059] DNA template 1μl

[0060] Water 21.6 μl

[0061] In the present invention, the initial concentration of the primer F and the primer R is preferably 10 μmol / L; the concentration of the DNA template is preferably 1 ng / μl. In the present invention, the PCR amplification program is preferably as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 60°C for 5 s, extension at 72°C for 2 min, 34 cycles; final extension at 72°C for 10 min.

[0062] In the present invention, after the PCR amplification reaction is completed, the amplification product is preferably subjected to agarose gel electrophoresis to determine whether the reaction is successful; the parameters of the agarose gel electrophoresis detection are preferably as follows: 1.5% agarose, 5V / min, 40min. In the present invention, the appearance of a band of the target size in agarose gel electrophoresis is considered to be a successful reaction.

[0063] In the present invention, after the PCR amplification reaction is completed, the amplification product is preferably concentrated and purified. In the present invention, the concentration is preferably performed using a Millipore 30kDa ultrafiltration tube; the purification is preferably performed using FPLC;

[0064] The present invention preferably uses NanoDrop to detect the concentration of the purified template and the ratio of 260 / 280 after the purification. When 260 / 280 is between 1.6 and 1.8, the template is considered qualified.

[0065] After obtaining the DNA template, the present invention constructs an RNA in vitro synthesis system including the DNA template to perform in vitro synthesis of mRNA to obtain the active component mRNA.

[0066] In the present invention, the RNA in vitro synthesis system, based on 1600 μl, comprises the following components:

[0067] RNase-free water 440μl;

[0068] 7.5 mM ATP 160 μl;

[0069] 7.5 mM UTP (or Pseudo UTP) 160 μl;

[0070] 7.5 mM CTP 160 μl;

[0071] 7.5 mM GTP 160 μl;

[0072] 7.5 mM M7G (2'OMeA) pG 160 μl;

[0073] 40 μl of 150 ng / μl DNA template;

[0074] 10× Buffer 160 μl;

[0075] Enzyme Mix 160μl.

[0076] In the present invention, the conditions for in vitro synthesis of RNA are preferably 36-38° C. for 8-12 h, more preferably 37° C. for 10 h.

[0077] In the present invention, the RNA in vitro synthesis is preferably carried out in a constant temperature reactor; the RNA in vitro synthesis system is preferably placed in a 2 ml RNase-free Tube tube, and multiple tubes are reacted at the same time;

[0078] The reaction reagents in the RNA in vitro synthesis system are added in the above order.

[0079] After the in vitro synthesis of RNA is completed, the present invention preferably further comprises the steps of removing the DNA template, recovering the mRNA and purifying the mRNA. In the present invention, the removal of the DNA template is preferably achieved by DNase I digestion;

[0080] The digestion preferably comprises mixing DNase I with the solution after RNA in vitro synthesis reaction; the volume ratio of DNase I to the solution after RNA in vitro synthesis reaction is preferably 3:40; the mixing is preferably achieved by turning the RNase-free Tube upside down, and the number of times of turning upside down is preferably 8 to 12 times, more preferably 10 times;

[0081] After the mixing, the solution is preferably collected at the bottom of the RNase-free Tube by centrifugation. In the present invention, the centrifugal speed is preferably 800-1200 rpm, more preferably 1000 rpm; the centrifugal time is preferably 8-12 s, more preferably 10 s.

[0082] The digestion temperature is preferably 37°C;

[0083] The digestion time is preferably 1 h.

[0084] In the present invention, after the digestion is completed, it is preferred to perform a residual DNA fragment detection. In the present invention, the recovery of mRNA is preferably achieved by precipitation with the ammonium acetate solution;

[0085] After recovering the mRNA, the present invention performs a quality test on the mRNA; the quality test includes the concentration of the mRNA, the ratios of 260 / 280 and 260 / 230 of the mRNA. When the range of 260 / 280 is 1.8 to 2.1, and the range of 260 / 230 is greater than 2.0, the mRNA is considered qualified.

[0086] In the present invention, the purified mRNA is achieved by FPLC purification. After the purified mRNA is purified in the present invention, the purified mRNA is preferably packaged.

[0087] The present invention provides the use of the cartilage defect repair preparation in the preparation of a drug for treating articular cartilage damage. In the present invention, the dosage of the drug preparation is preferably 10 to 20 μg per joint, more preferably 14 to 16 μg, and most preferably 15 μg.

[0088] In the present invention, the preparation further comprises a delivery material, including but not limited to PEI, PAMAM, poly-lysine, chitosan, liposomes, lipid nanoparticles;

[0089] Preferably, the delivery material is PEI;

[0090] Preferably, the mass ratio of PEI to mRNA is PEI:mRNA=0.1-10:1;

[0091] In the present invention, the method of using the drug is intra-articular injection. The present invention has no special limitation on the specific method of intra-articular injection, and conventional intra-articular injection operations in the art can be used.

[0092] In the present invention, the drug for treating articular cartilage damage has the cartilage defect repair preparation as an active ingredient or may further include other active ingredients; the dosage form of the drug is preferably an injection preparation.

[0093] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be understood as limiting the protection scope of the present invention.

[0094] Example 1

[0095] Recombinant plasmid preparation:

[0096] 1) Synthesize the target fragment of seq1;

[0097] 2) The target fragment and pEGFP-N1 plasmid were double-digested with BamHI and NheI respectively;

[0098] 3) In vitro ligation using T4 ligase;

[0099] 4) Transform competent E. coli and culture on AMP solid medium for 12 hours;

[0100] 5) Colony PCR: select colonies containing the target band for sequencing.

[0101] The colony PCR steps in step 5) are as follows:

[0102] 1. Picking single colonies Pour LB culture medium into the gun slot, then use the gun to add 400μl LB culture medium to the 48-well deep-well plate, use tweezers to pick up the single colony on the plate with the sterilized small white gun tip and put it into the 48-well deep-well plate, and record it on the 48-well deep-well plate and the corresponding form. Cover the selected 48-well deep-well plate with sealing film and make corresponding marks (date, plate number, etc.), use a needle to punch holes in the sealing film, and place it on a 37℃ shaker for 1 hour.

[0103] 2. Colony PCR reaction Prepare the following PCR reaction system, add the prepared reaction solution to a 96-well plate, add 2 μl of bacterial solution into it with a dispenser, and amplify according to the PCR program:

[0104] PrimeSTAR Max Premix(2×)25μl

[0105] Primer F1.2 μl

[0106] Primer R 1.2 μl

[0107] Bacterial liquid 2μl

[0108] Water 20.6 μl

[0109] In the present invention, the initial concentration of the primer F and the primer R is preferably 10 μmol / L; the concentration of the DNA template is preferably 1 ng / μl. In the present invention, the PCR amplification program is preferably as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 60°C for 5 s, extension at 72°C for 2 min, 34 cycles; final extension at 72°C for 10 min.

[0110] 3. Agarose gel electrophoresis: First prepare 1% agarose gel (weigh 1g agarose and add it to 100ml TAE solution), add 0.5μl bromophenol blue to the 96-well plate where the PCR reaction is completed, shake and mix, then spot the sample, take a picture of the agarose gel after electrophoresis and save it.

[0111] 4. Determine the positive clones and sequence them. Determine the positive clones based on the agarose gel electrophoresis band diagram, expand the culture of the positive clones, perform sequencing verification, and select the clones with completely correct sequences for the next step.

[0112] 6) Expand the culture of the correctly sequenced colonies and extract the plasmid.

[0113] The steps of plasmid extraction described in step 6) refer to the instructions of Omega D6915 Endo-free Plasmid MidiKit.

[0114] The obtained plasmid was used to amplify the DNA template according to the following reaction system:

[0115] Reaction volume, 50 μl (reaction volume for a single tube, multiple tubes reacted at one time)

[0116] The PCR amplification system is based on 50 μl, preferably as follows:

[0117] PrimeSTAR Max Premix(2×)25μl

[0118] Primer F1.2 μl

[0119] Primer R 1.2 μl

[0120] DNA template 1μl

[0121] Water 21.6 μl

[0122] The initial concentration of primer F and primer R is preferably 10 μmol / L; the concentration of the DNA template is preferably 1 ng / μl. The PCR amplification program is as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 60°C for 5 s, extension at 72°C for 2 min, 34 cycles; final extension at 72°C for 10 min.

[0123] After the reaction is completed, the reaction solution is combined in a 1.5 ml Tube tube. Take 10 μl for DNA agarose gel electrophoresis (1.5% agarose, 5V / min, 40min). Confirm the success of the reaction based on the size of the target band of electrophoresis. Qualification standard: a single band appears in the electrophoresis detection, and the size is correct.

[0124] Measurement results: The band size is single and meets the requirements.

[0125] DNA template ultrafiltration The DNA template obtained above was concentrated using Millipore 30 kDa ultrafiltration tubes.

[0126] DNA template FPLC purification: The DNA obtained by ultrafiltration was added with an equal volume of phenol / chloroform / isoamyl alcohol mixture (phenol / chloroform / isoamyl alcohol=25 / 24 / 1), shaken thoroughly, and centrifuged at 12000 g for 15 min.

[0127] Remove the precipitate, transfer the supernatant to a new centrifuge tube, add 1 / 10 of the supernatant volume of 3M NaAc (pH 5.2), mix well, then add 2 times the volume of anhydrous ethanol, mix well, and stand at -20°C for 30 min.

[0128] Centrifuge at 12000g for 10 min at 4°C and discard the supernatant.

[0129] The precipitate was washed with 70% ethanol, centrifuged at 12000 g for 5 min, the supernatant was taken and dried on a clean bench for 5 min.

[0130] Dissolve the purified DNA template in appropriate RNase-free water.

[0131] The concentration of the purified template and the ratios of 260 / 280 and 260 / 230 were detected by NanoDrop. Samples were taken for DNA agarose gel electrophoresis (1.5% agarose, 5 V / min, 40 min).

[0132] Pass criteria: 260 / 280 between 1.8 and 2.1, 260 / 230 between 1.6 and 2.2.

[0133] Measurement results: Concentration is 500ng / μl, 260 / 280=1.90, 260 / 230=1.7

[0134] Ultrafiltration of template after FPLC purification The DNA template after FPLC purification was concentrated in Millipore 30KDa ultrafiltration tube and eluted and dissolved with RNase-free water. The concentration of the template after ultrafiltration and the ratios of 260 / 280 and 260 / 230 were detected by NanoDrop. Finally, it was diluted to 150ng / μl with RNase-free water.

[0135] Measurement results: concentration of 150 ng / μl, 260 / 280=1.95, 260 / 230=1.85. In vitro synthesis of mRNA: In a constant temperature reactor, in vitro synthesis of mRNA was carried out.

[0136] The synthesis was carried out according to the following system (reaction reagents were added from top to bottom): reaction volume, 1600 μl (placed in a 2 ml RNase-free Tube, the reaction volume of a single tube, multiple tubes were reacted at one time).

[0137] The RNA in vitro synthesis system, based on 1600 μl, includes the following components:

[0138] RNA-free water 440μl;

[0139] 7.5 mM ATP 160 μl;

[0140] 7.5 mM UTP (or Pseudo UTP) 160 μl;

[0141] 7.5 mM CTP 160 μl;

[0142] 7.5 mM GTP 160 μl;

[0143] 7.5 mM M7G (2'OMeA) pG 160 μl;

[0144] 40 μl of 150 ng / μl DNA template;

[0145] 10× Buffer 160 μl;

[0146] Enzyme Mix 160μl.

[0147] The conditions for the in vitro synthesis of the RNA are 37° C. for 10 h.

[0148] DNase I digestion to remove DNA template. Add 120 μl DNase I to each tube after in vitro synthesis of mRNA.

[0149] Mix by inverting 10 times and centrifuging at 1000 rpm for 10 seconds.

[0150] Place it back in the thermostatic reactor at 37°C for 1 h.

[0151] After the reaction, the reaction solution was combined into an RNase-free 50ml Tube tube to detect the residual DNA fragments. The results of three measurements were 0.013ng, 0.016ng, and 0.017ng per 100μg mRNA.

[0152] Test 1: Detection of mRNA expression levels encoding transcription factors

[0153] Experimental method: In vitro potency-PCR assay

[0154] Seeding of BMSCs

[0155] 1) Cell preparation: Prepare cells for testing 1-3 days in advance. Take the cells purchased from Saiye Biotechnology and passage them in cell culture bottles to ensure that the cells are in the logarithmic growth phase when used.

[0156] 2) Cell digestion and counting: Take BMSCs in good growth condition, remove the culture medium, wash the cells with 1 ml PBS, add 0.25% trypsin by volume for 1 min, then add DMEM culture medium containing 10% FBS to neutralize the trypsin, blow the cells and transfer to a 15 ml centrifuge tube, blow repeatedly to mix, then take 10 μl of the cell suspension and count.

[0157] 3) Cell dilution: Take 1 ml of cell suspension and dilute it to 5×10^5 cells / ml with DMEM medium containing 10% FBS, and mix well by pipetting.

[0158] 4) Cell inoculation: Take 2 ml of cell suspension and add it to a 6-well plate. Prepare 3 parallel wells of cells for each mRNA sample, 1 well of cells for the control sample (GFP-mRNA), and 1 well for the blank control. Place the 6-well plate in a (37±1)℃, (5±0.5)%CO2 Incubate overnight in an incubator.

[0159] Cell transfection

[0160] About 24 hours after inoculation, observe the cell status in the 6-well plate. The confluence is about 90%. In the biosafety cabinet, prepare the required volume of 90% DMEM + 10% FBS medium. Discard the medium in the well plate 30 minutes before transfection and add 2 ml of fresh medium (90% DMEM + 10% FBS) to each well.

[0161] a) Prepare transfection system: Take 200 μl of opti-MEM, add 2.5 μg of mRNA (where U is U or Pseudo UTP, hereinafter referred to as: Ψ) sample or blank control, mix gently with a pipette tip, then add 5 μl of PEI, mix thoroughly, and let stand for 10 min.

[0162] b) Add the prepared transfection system evenly and dropwise into the cultured cells, and then shake it back and forth and left and right to ensure that the transfection system is evenly distributed on the cells.

[0163] c) Medium change: 6 h after transfection, the old medium was aspirated and replaced with 2 ml of fresh medium (90% DMEM + 10% FBS) per well.

[0164] d) Harvest: Harvest 24 hours after transfection. Aspirate the old culture medium and wash once with 1 ml PBS. Add Trizol to lyse the cells and extract total RNA.

[0165] PCR results showed that after transfection, the expression level of the target gene FoxO1 was significantly increased, the chondrogenic differentiation potential of BMSCs was enhanced, and matrix synthesis was improved ( Figure 2 , 3 ).

[0166] According to the mRNA encoding the transcription factor of the present invention, the immunogenicity is detected, and the evaluation standard is the TNFα level in the serum of rats after intramuscular injection of the mRNA.

[0167] 8-week-old SD rats were raised in a ventilated cage under SPF conditions and maintained with a 12-hour light and 12-hour dark cycle. The mRNA (U or Ψ) shown in SEQ ID No.1 was injected into the SD rats' joint cavity. The injection dose for each rat was 15 μg. After 24 hours, the rats were bled and the serum was separated. Enzyme-linked immunosorbent assay (ELISA) was performed using a rat TNFa kit (RayBio). The experimental results are shown in Figure 2. Figure 4 shown.

[0168] After rats were injected with the transcription factor mRNA preparation provided by the present invention, the expression level of TNFα was not significantly increased compared with the control group, which shows that the mRNA formulation provided by the present invention has low immunogenicity and good safety ( Figure 4 ).

[0169] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

[0170] SEQ ID No.1;

[0171] Name: Active ingredient mRNA

[0172] DNA type: unassigned DNA

[0173] Biological source: Artificial sequence / synthetic construct

[0174] atggccgaagcgcctcaggtggtggagaccgacccggacttcgagccgctgcctcggcagcgctcctgcacctggccgctgcccaggccggagtttaaccagtccaactcgaccacctccagcccggcgccgtcgggcagcacggccgccaaccccgacgccacggcgagcctggcctcggcgtccgctgtcagcaccgactttatgagcaacctgagcctgctagaagagagcgaggacttcgcgcgggcaccgggttgcgtggccgtggcggccgcagctgccgccagtaggggcctgtgcggggacttccagggcccggaggcgggctgcgtgcactcggcgccgccgcagcccccaccgaccgggccgctgtcgcagcccccaccggtgcctccagccgccgcggggccactcgctgggcagccgcgcaagaccagttcgtcgcgccgcaacgcgtggggcaacctgtcgtacgccgacctcatcaccaaggccatcgagagctcggcggagaagaggctcaccctgtcgcagatctacgagtggatggtgaagagtgtgccctacttcaaggataagggcgacagcaacagctcggcgggctggaagaattcaattcgccacaatctgtccctacacagcaagtttattcgagtacagaatgaaggaactgggaaaagttcttggtggatgctcaatccagagggaggcaagagtgggaaatcaccccggagaagagctgcatccatggacaacaacagtaaatttgctaagagccgaggacgggctgctaagaaaaaagcatctctccagtccgggcaagagggtcctggagatagccctgggtctca

[0175] gttttctaaatggcctgcaagccctgggtcccacagcaatgatgactttgataactggagtacatttcgtcctcgaaccagct

[0176] caaacgctagcaccatcagtgggagactttctcccatcatgacagagcaggatgacctgggggatggggatgtgcattcc

[0177] ctggtgtatccaccctctgctgccaagatggcgtctacactgcccagtctgtctgaaatcagcaatccagaaaacatggag

[0178] aaccttctggataatctcaatcttctctcatccccaacatctttaactgtgtcaacccagtcctcgcctggcagcatgatgcagc

[0179] agacaccttgctattcatttgcaccgccaaacaccagtctaaattcccccagccccaactacgcaaagtacacgtacggcc

[0180] aatccagcatgagccctgtgccccagatgcctatgcagacacttcaggacagcaaatcaagttatggaggattgaaccagt

[0181] ataactgtgccccaggactcttgaaagagttgctgacttctgactctcctccccacaatgatattatgtcaccagtcgatcctg

[0182] gagtggctcaacccaacagtcgggtcctgggccaaaatgtactgatgggccctaactcagtcatgccagcctatggcagc

[0183] caggcacctcataacaaaatgatgaaccccagttcccacacccaccctggacatgcacagcaaacttcttcagtcaatggc

[0184] cgtgccctgccccatgtggtgaacaccatgcctcacacatctgccatgaaccgcttgaccccagtgaagacacctttacaa

[0185] gtgcctctgtcccaccccatgcagatgagtgccctgggcaactactcctctgtgagcagctgcaatggctatggtaggatg

[0186] ggtgtcctccaccaggagaagctcccaagtgacttggatggcatgtttattgagcgcttggactgtgacatggagtccatca

[0187] ttcggaacgacctcatggacggagataccttggattttaactttgataatgtgttgcccaaccaaagcttcccgcacagtgtc

[0188] aagactacaacacacagctgggtgtcaggctag。

Claims

1. An mRNA dosage form biological preparation for repairing articular cartilage defects, characterized in that: The active ingredient mRNA is SEQ ID NO: 1; The 5' end of the mRNA is connected to the 5'UTR via a cap structure; the 3' end of the mRNA is connected to the poly A tail via a 3'UTR; The uracil in the mRNA is replaced by Pseudo UTP.

2. The mRNA dosage form biological preparation according to claim 1, characterized in that The cartilage defect repair preparation is an injection preparation.

3. The mRNA dosage form biological preparation according to claim 2, characterized in that: The active component mRNA is added into the solvent PBS to prepare a solution, and the concentration of the active component mRNA in the solution is 0.5-20 μg / μl.

4. The method for preparing the mRNA dosage form biological preparation according to any one of claims 1 to 3, characterized in that: The method comprises the following steps: 1) Synthetically transcribing a DNA fragment corresponding to the mRNA of the active ingredient in the cartilage defect repair preparation, and cloning the DNA fragment into an expression plasmid to obtain a recombinant plasmid; 2) transferring the recombinant plasmid into host cells to obtain recombinant cells, amplifying the recombinant cells, extracting plasmids from the amplified recombinant cells, and performing PCR amplification using the extracted plasmids as templates to obtain DNA templates for in vitro expression of mRNA; 3) using a DNA template to construct an RNA in vitro synthesis system including the DNA template and performing RNA in vitro synthesis to obtain the active ingredient mRNA.

5. The preparation method according to claim 4, characterized in that: The RNA in vitro synthesis system, calculated in 1600 μl, includes the following components: RNase-free water 440μl; 7.5 mM ATP 160 μl; 7.5 mM UTP or Pseudo UTP 160 μl; 7.5 mM CTP 160 μl; 7.5 mM GTP 160 μl; 7.5 mM M7G (2'OMeA) pG 160 μl; 40 μl of 150 ng / μl DNA template; 10× Buffer 160 μl; Enzyme Mix 160μl.

6. The preparation method according to claim 4 or 5, characterized in that: The conditions for the in vitro synthesis of the RNA are 36-38°C for 8-12h.

7. An mRNA dosage form biological preparation, characterized in that: The mRNA dosage form biological preparation is prepared by the preparation method described in claim 4.

8. An application of the mRNA dosage form biological preparation according to any one of claims 1 to 3 or the mRNA dosage form biological preparation prepared by the preparation method according to claim 4, characterized in that: The mRNA dosage form biological preparation is used in the preparation of medicines for cartilage matrix repair and cartilage defect repair.

Images