A high-yield palmitoleic acid accumulating Nitzschia algae and its application

Abstract

The invention discloses a Nitzschia algae that accumulates palmitoleic acid in high yield and its application. The Nitzschia algae (Nitzschi as.) Y3 is deposited with a number of CCTCCM2023030Y3, and the deposit address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province; the Nitzschia algae (Nitzschi as.) Y3 is observed under a microscope as a single-cell structure, the cell is spindle-shaped, the two ends are symmetrical, 24 to 31 μm long, 6 to 7 μm wide, and the cell proliferates by longitudinal division. The Nitzschia algae (Nitzschi as.) Y3 has a simple and reasonable fatty acid composition and can be used for the production of high-quality biodiesel; palmitoleic acid can account for 60 to 70% of the total fatty acids, which is beneficial to the extraction and purification of palmitoleic acid, and can be used to produce palmitoleic acid-related health products, foods, medicines, etc.; it can be cultured using pickling wastewater, salt lakes or seawater, and has good temperature and pH adaptability, can be simply and economically cultured for the production of palmitoleic acid, and is beneficial to reducing production costs.

Description

Technical Field

[0001] The invention belongs to the technical field of microalgae biotechnology, and particularly relates to a high-yield palmitoleic acid-accumulating Nitzschia algae and application thereof. Background Art

[0002] Palmitoleic acid (C16:1Δ9) is an important ω-7 monounsaturated fatty acid. Studies in recent years have shown that it has important effects in medicine and health care. It not only plays an important role in maintaining the balance of sugar and lipid metabolism in the body, but also has a good therapeutic effect on chronic diseases such as diabetes, obesity, inflammation and atherosclerosis. my country's population structure has entered an aging period, and the population base of chronic metabolic syndromes such as diabetes and "three highs" is huge, which is bound to generate huge demand for drugs based on palmitoleic acid.

[0003] Palmitoleic acid is usually produced by directly extracting it from oil crops or other plants, such as sea buckthorn. However, this production process faces problems such as low raw material yield, poor agronomic traits, low palmitoleic acid content, and difficulty in separation and extraction, resulting in insufficient raw material supply and difficulty in meeting market demand.

[0004] In recent years, the production of palmitic acid using microalgae has received widespread attention. Microalgae have the advantages of simple cultivation and high oil content. Studies have shown that some microalgae can accumulate high levels of palmitic acid. For example, Chinese patent CN114196711A discloses a method for producing palmitoleic acid using filamentous yellow algae, wherein the algae strain is cultured on an inorganic salt culture medium, then cultured with aeration on a columnar glass photobioreactor, and finally filtered, washed, and the initial nitrogen concentration and culture temperature are set and then cultured with aeration to obtain algae powder. This method is suitable for producing palmitoleic acid at low temperature (10-20°C), but the process is cumbersome and the palmitoleic acid output only accounts for 55% of its fatty acids; Chinese patent CN111349566A discloses a process for producing ω-7 fatty acids using Wei's algae, which is cultured in seawater to save production costs, but its fatty acid composition is complex and contains 9 components, which is not conducive to the purification of palmitoleic acid, and the palmitoleic acid output is not high (the highest accounts for 54.91% of the fatty acid content); Chinese patent CN109022508A discloses a method for producing palmitoleic acid using true eye spot microalgae, and the cost of culturing algae strains is relatively high.

[0005] Although the above method provides high-quality algae for the production of palmitoleic acid, the palmitoleic acid content generally does not exceed 55% of the total fatty acid content, and the fatty acid composition is relatively complex, which is not conducive to the extraction and purification of palmitoleic acid. It is urgent to further explore high-quality algae with higher palmitoleic acid content and simple fatty acid composition. Summary of the invention

[0006] In order to overcome the shortcomings and deficiencies of the prior art, the present invention provides a Nitzschia algae that accumulates palmitoleic acid in high yield, with the purpose of accumulating a higher content of fatty acids, which is beneficial to the extraction and purification of palmitoleic acid; in addition, the cultivation environment of the Nitzschia algae that accumulates palmitoleic acid in high yield provided by the present invention is economical and simple, which is beneficial to reducing the production cost of palmitoleic acid.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] The present invention provides a strain of Nitzschia sp. that accumulates palmitoleic acid in high yield, named: Nitzschia sp. Y3. The strain has been deposited in the China Center for Type Culture Collection on January 5, 2023, with a deposit number of CCTCC M2023030Y3, and a deposit address of: Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0009] Furthermore, the above-mentioned Nitzschia sp. Y3 is observed to be a single-cell structure under a microscope. The cell is spindle-shaped with symmetrical structures at both ends, 24 to 31 μm in length and 6 to 7 μm in width. The cell proliferates by longitudinal division.

[0010] Furthermore, the above-mentioned Nitzschia sp. Y3 was isolated from a natural salt lake (water sample was collected from Jiezechaka Salt Lake in Tibet, collection time: May 2022).

[0011] Further, the collection and separation steps are as follows:

[0012] (1) Collect water samples and collect them through filter membrane

[0013] (2) Cultivation and purification in culture medium

[0014] (3) Cell morphology and molecular identification

[0015] (4) Cell collection by centrifugation

[0016] The above-mentioned Nitzschia sp. Y3 culture method comprises placing Nitzschia sp. Y3 in a salt-containing culture medium, a culture medium based on a salt lake or seawater, or pickling wastewater, controlling the salt content to be 15 to 120 g / L, more preferably 60 to 105 g / L, the culture temperature to be 10 to 30° C., the pH to be 5 to 10, and the light intensity to be 50 to 800 μmol / m 2 / s, and cultured for 14 to 25 days.

[0017] The above-mentioned Nitzschia sp. Y3 is used in the production of high-quality biodiesel.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] (1) The present invention provides a strain of Nitzschia sp. Y3 that accumulates palmitoleic acid in high yield. Its fatty acid composition is relatively simple, and palmitoleic acid can account for 60-70% of the total fatty acids, which is significantly higher than that of existing algae species, and is conducive to the extraction and purification of palmitoleic acid.

[0020] (2) The present invention provides a strain of Nitzschia sp. Y3 that accumulates palmitoleic acid at a high yield, which can accumulate a relatively high content of fatty acids with a reasonable fatty acid composition and can be used for the production of high-quality biodiesel.

[0021] (3) The present invention provides a strain of Nitzschia sp. Y3 that accumulates palmitoleic acid at a high yield. The strain can be cultured using pickling wastewater, salt lakes or seawater, and has good adaptability to temperature and pH. It can be simply and economically cultured for the production of palmitoleic acid, which is beneficial to reducing the production cost of palmitoleic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a microscope image of Nitzschia sp. Y3 in Example 1 of the present invention.

[0023] Figure 2 It is a phylogenetic tree diagram constructed based on 18S rRNA of Nitzschia sp. Y3 in Example 1 of the present invention.

[0024] Figure 3 This is a diagram showing the results of fatty acid composition determination in Example 1 of the present invention.

[0025] Figure 4 This is a graph showing the proportion of palmitic acid in total fatty acids in cells of Nitzschia sp. Y3 cultured at different salinities in Example 3 of the present invention. DETAILED DESCRIPTION

[0026] The present invention will be more fully understood through the following detailed description, which should be read in conjunction with the accompanying drawings. Detailed embodiments of the present invention are disclosed herein; however, it should be understood that the disclosed embodiments are only exemplary of the present invention, which can be embodied in various forms. Therefore, the specific functional details disclosed herein should not be interpreted as limiting, but only as the basis of the claims and as a representative basis for teaching those skilled in the art to adopt the present invention in different ways in virtually any appropriate detailed embodiment.

[0027] Example 1

[0028] The present embodiment provides a strain of Nitzschia sp. Y3 that accumulates palmitoleic acid in high yield. The Nitzschia sp. was isolated from a natural salt lake (water sample was collected from Jiezechaka Salt Lake in Tibet, collection time: May 2022), named Nitzschia sp. Y3, and the algae strain was deposited in the China Center for Type Culture Collection on January 5, 2023, with a deposit number of CCTCC M 2023030Y3, and the deposit address is: Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0029] 1. Isolation and identification of Nitzschia sp. Y3 that accumulates palmitoleic acid at high yields

[0030] (1) Collecting water samples

[0031] The water samples were collected from Jieze Chaka Salt Lake in Tibet in May 2022, and then collected by filtering with a 0.22μm filter membrane.

[0032] (2) Culture medium purification

[0033] The water sample collected in step (1) was placed in Dunaliella medium (NaCl: 87.69 g / L; NaNO3: 0.42 g / L; NaH2PO4·2H2O: 0.0156 g / L; CaCl2·2H2O: 0.044 g / L; KCl: 0.074 g / L; MgSO4·7H2O: 1.23 g / L; NaHCO3: 0.84 g / L; Ferric citract (1%): 0.5 mL / L; A5: 1 mL / L) and cultured under a light intensity of 60 μmol / m 2 / s, and enriched and cultured at 25°C for 14 days. When a large number of cells were visible in the water sample, the culture medium was placed under an inverted microscope and a single cell was aspirated with a capillary and cultured again under the same conditions. The above operation was repeated until no other cells were present.

[0034] (3) Morphological identification

[0035] The cell morphology of Nitzschia sp. Y3 was observed under a microscope. Figure 1 As shown, Nitzschia sp. Y3 is a single-cell structure. The cell is spindle-shaped with symmetrical structures at both ends, about 24 to 31 μm long and about 6 to 7 μm wide. The cell proliferates by longitudinal division.

[0036] (4) Molecular identification

[0037] The purified cells were enriched and cultured again until OD 680nmWhen the p-value reached 0.6 or above, the cells were collected by centrifugation, and their DNA was extracted using a plant DNA extraction kit (CTAB method). The 18S rRNA universal primers (18S-F: AACCTGGTTGATCCTGCCAGT; 18S-R: TTGATCCTTCTGCAGGTTCACC) were used for amplification. The PCR products were sequenced to obtain their 18S rRNA sequences, which were then compared with the NCBI database for homology and a phylogenetic tree was constructed ( Figure 2 ), the results showed that it had a high homology with Nitzschia, and it was determined to be Nitzschia sp.

[0038] 2. Detection of fatty acid composition of Nitzschia sp. Y3 in Dunaliella medium

[0039] (1) Dunaliella medium culture

[0040] The Nitzschia sp. Y3 was cultured in Dunaliella medium (NaCl: 87.69 g / L; NaNO3: 0.42 g / L; NaH2PO4·2H2O: 0.0156 g / L; CaCl2·2H2O: 0.044 g / L; KCl: 0.074 g / L; MgSO4·7H2O: 1.23 g / L; NaHCO3: 0.84 g / L; Ferric citract (1%): 0.5 mL / L; A5: 1 mL / L) under a light intensity of 60 μmol / m 2 / s, temperature was 25℃, and culture was carried out under natural pH conditions for 14 days.

[0041] (2) Cell centrifugation collection

[0042] The cells were collected by centrifugation at 8000 rpm for 10 min in a cell-specific centrifuge, and the collected cells were freeze-dried.

[0043] (3) Component Concentration

[0044] Weigh 50 mg of the algae powder obtained in step (2) and grind it thoroughly for 10 minutes. Then add 7.5% KOH-CH3OH and mix thoroughly to suspend it. Place it in a 70°C water bath for 5 hours and mix it every 0.5 hours.

[0045] Then, HCl / CH3OH (1:1, v / v) and 14% BF3-CH3OH were added, mixed thoroughly, and placed in a 70°C water bath for 1.5 h.

[0046] 0.9% NaCl and n-hexane were added for extraction, and the mixture was centrifuged at 2000 rpm for 3 min. The organic phase was filtered through a 0.22 μm filter membrane.

[0047] (4) Fatty acid composition analysis

[0048] The concentrated component obtained in step (3) was analyzed for fatty acid components using a gas chromatograph. The chromatographic conditions were: Aligent 6980N gas chromatograph; FID flame ionization detector; 100m×0.25mm×0.25μm capillary column; N2 was used as carrier gas, the injection port and detector temperature were 250°C, the initial column temperature was set to 180°C, continued for 1 min, and increased to 230°C at a rate of 6°C / min, and continued for 20 min. The fatty acid composition is as follows Figure 3 shown.

[0049] By comparing with the standard, a total of 6 components were identified in the fatty acids (the peak at 16.318min was the added internal reference heptadecanoic acid), including myristic acid (C14:0), palmitic acid (C16:0), palmitoleic acid (C16:1), linoleic acid (C18:2), heneicosanoic acid (C21:0) and docosanoic acid (C22:0). The total fatty acid content reached 39.7% of the cell dry weight, among which palmitoleic acid had the highest content, reaching 66.4% of the total fatty acid content.

[0050] Example 2

[0051] In this embodiment, Nitzschia sp. Y3 is cultivated using pickling wastewater to produce palmitoleic acid. Using safe, non-toxic and nutritious food processing wastewater to cultivate microalgae can effectively reduce the cultivation cost of microalgae. Specifically, in this embodiment, Nitzschia sp. Y3 is cultivated using pickled vegetable wastewater.

[0052] The specific steps include:

[0053] (1) Cultivation of pickle wastewater

[0054] The salty wastewater produced during the pickling process has a salt content of 57.6 g / L, a pH of 7.5, a COD of 8325 mg / L, and total nitrogen and total phosphorus contents of 1650 and 324 mg / L, respectively. 2+ ,Zn 2+ ,K + ,Ca 2+ Other nutrients, including 2 / s and cultured at 25°C for 16 days.

[0055] (2) Collect cells by centrifugation

[0056] The cells were collected by centrifugation at 8000 rpm for 10 min in a cell-specific centrifuge, and the collected cells were freeze-dried.

[0057] (3) Component Concentration

[0058] Weigh 50 mg of the algae powder obtained in step (2) and grind it thoroughly for 10 minutes, then add 7.5% KOH-CH3OH and mix it thoroughly to suspend it, place it in a 70°C water bath for 5 hours, and mix it every 0.5 hours. Then add HCl / CH3OH (1:1, v / v) and 14% BF3-CH3OH and mix it thoroughly, and continue to place it in a 70°C water bath for 1.5 hours. Add 0.9% NaCl and n-hexane to extract once, and centrifuge at 2000rpm for 3 minutes. Filter the organic phase through a 0.22μm filter membrane.

[0059] (4) Fatty acid composition analysis

[0060] The concentrated components obtained in step (3) were analyzed for fatty acid components using a gas chromatograph. Chromatographic conditions: Aligent 6980N gas chromatograph; FID flame ionization detector; 100m×0.25mm×0.25μm capillary column. N2 was used as the carrier gas, the injection port and detector temperatures were 250°C, the initial column temperature was set to 180°C, lasted for 1 min, and increased to 230°C at a rate of 6°C / min, lasting for 20 min. The results showed that in the Nitzschia cultured in pickle wastewater, the total fatty acid content reached 41.3% of the cell dry weight, of which the content of palmitic acid reached 60.3% of the total oil content.

[0061] Example 3

[0062] In this example, Nitzschia sp. Y3 was cultured in Dunaliella medium under different salinity conditions.

[0063] The Dunaliella medium culture medium in Example 1 was cultured at salinity of 15, 30, 45, 60, 75, 90, 105, and 120 g / L, while the other conditions remained unchanged. The cells were collected by centrifugation, and the fatty acid components were analyzed using a gas chromatograph after filtering the organic phase with a filter membrane to obtain the proportion of palmitic acid in the total fatty acids in the cells.

[0064] like Figure 4When the salinity in the pickled vegetable wastewater increases within the range of 15-60g / L, the proportion of palmitoleic acid in the total fatty acids in the cells also increases. When the salinity is 60g / L, the proportion of palmitoleic acid in the total fatty acids is the highest. When the salinity in the pickled vegetable wastewater increases within the range of 60-120g / L, the proportion of palmitoleic acid in the total fatty acids in the cells gradually decreases. In the range of salinity of 60-105g / L, the proportion of palmitoleic acid in the total fatty acids in the cells is 60-70%.

[0065] Example 4

[0066] In this example, Dunaliella medium was used to culture Nitzschias p. Y3 under different light intensities.

[0067] Nitzschia sp. Y3 was grown under light intensities of 50, 450, and 800 μmol / m 2 / s, and the other conditions were kept the same as in Example 1. The cells were collected by centrifugation, and the fatty acid components were analyzed by gas chromatography after filtering the organic phase with a filter membrane. The results showed that the proportions of palmitic acid in the total fatty acids in the cells were 62.15%, 63.57% and 64.31%, respectively.

[0068] Example 5

[0069] In this example, Dunaliella medium was used to culture Nitzschias p. Y3 at different temperatures.

[0070] Nitzschia sp. Y3 was cultured at 10, 20, and 30°C, respectively, and the other conditions were kept the same as in Example 1. The cells were collected by centrifugation, and the fatty acid components were analyzed by gas chromatography after filtering the organic phase with a filter membrane. The results showed that the proportion of palmitic acid in the total fatty acids in the cells was 66.42%, 63.11%, and 61.34%, respectively.

[0071] Example 6

[0072] In this example, Dunaliella medium was used to culture Nitzschias p. Y3 at different pH values.

[0073] Nitzschia sp. Y3 was cultured at pH values ​​of 5, 7, and 10, respectively, and the other conditions were kept the same as in Example 1. The cells were collected by centrifugation, and the fatty acid components were analyzed by gas chromatography after filtering the organic phase with a filter membrane. The results showed that the proportion of palmitic acid in the total fatty acids in the cells was 57.26%, 61.32%, and 64.57%, respectively.

[0074] Example 7

[0075] In this example, Nitzschia sp. Y3 was cultured in an F / 2 medium prepared with seawater.

[0076] Nitzschia sp. Y3 was heated at 25°C and 150 μmol / m 2 / s light, cultured at natural pH for 18 days, collected cells by centrifugation, filtered the organic phase with filter membrane, and analyzed the fatty acid components using gas chromatography, which showed that the proportion of palmitic acid in the total fatty acids in the cells was 68.53%.

[0077] In summary, the algae microorganisms contained in the water samples collected from Jiezechaka Salt Lake in Tibet were morphologically and molecularly identified as Nitzschia sp., and were named Nitzschia sp. Y3. The algae strain was deposited in the China Center for Type Culture Collection on January 5, 2023, with the deposit number CCTCC M 2023030Y3, and the deposit address is: Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0078] The total fatty acid content of Nitzschia sp. Y3 in Dunaliella medium reached 39.7% of the cell dry weight, among which palmitoleic acid had the highest content, reaching 66.4% of the total fatty acid content.

[0079] Using safe, non-toxic and nutrient-rich food processing wastewater to cultivate Nitzschia sp. Y3 not only reduces the cultivation cost, but also the total fatty acid content of Nitzschia sp. Y3 cultivated with pickle pickling wastewater reaches 41.3% of the cell dry weight, of which the content of palmitic acid reaches 60.3% of the total fatty acid content.

[0080] It can be seen from the test results of the above embodiments that the Nitzschia sp. Y3 provided by the present invention is a Nitzschia sp. that accumulates palmitoleic acid in high yield. Its fatty acid composition is relatively simple, and only includes myristic acid (C14:0), palmitic acid (C16:0), palmitoleic acid (C16:1), linoleic acid (C18:2), heneicosanoic acid (C21:0) and docosanoic acid (C22:0), and can be used for the production of biodiesel. The preparation method can adopt the existing technology, specifically comprising: preparing the obtained fatty acid into biodiesel, the steps are as follows: the first step, adding the fatty acid to methanol at a molar ratio of 3:1-6:1 and 0.1-0.2% of an acidic bio-enzyme catalyst into a reaction device, heating to 72-78°C for reaction for 12 hours, then adding 0.2-0.4% of an alkaline catalyst for reaction for 0.5-1 hour, raising the temperature of the reaction device to 150°C to extract the methanol and catalyst participating in the reaction, and the second step, passing through a filtering device and a vacuum distillation device to obtain a finished biodiesel. Or refer to Chinese invention patent CN1766040A.

[0081] Furthermore, palmitoleic acid can account for 60-70% of the total fatty acids, which is significantly higher than existing algae species and is conducive to the extraction and purification of palmitoleic acid.

[0082] The invention provides a high-yield palmitoleic acid-accumulating Nitzschia algae, which can be cultured using pickling wastewater, salt lakes or seawater, has good temperature and pH adaptability, can be simply and economically cultured for palmitoleic acid production, and is beneficial to reducing the production cost of palmitoleic acid.

Claims

1. A Nitzschia algae strain that accumulates palmitoleic acid at high yields (Nitzschia sp.) Y3 , characterized in that: Nitzschia (Nitzschia sp.) Y3 It was deposited in the China Center for Type Culture Collection (CCTCC) on January 5, 2023, with the deposit number CCTCC M 2023030 Y3, and the deposit address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

2. The high-yield palmitoleic acid-accumulating Nitzschia according to claim 1 (Nitzschia sp.) Y3, Features: Nitzschia (Nitzschia sp.) Y3 Its fatty acids are myristic acid, palmitic acid, palmitoleic acid, linoleic acid, heneicosanoic acid and docosanoic acid.

3. The high-yield palmitoleic acid accumulating Nitzschia according to claim 1 (Nitzschia sp.) Y3 The cultivation method is characterized by: Nitzschia (Nitzschia sp.) Y3 Place in a salt culture medium with a salt content of 15-120 g / L, a culture temperature of 10-30°C, a pH value of 5-10, and a light intensity of 50-800 μmol / m 2 / s for 14 to 25 days.

4. The high-yield palmitoleic acid accumulating Nitzschia according to claim 3 (Nitzschia sp.) Y3 The cultivation method is characterized by: The salt content is 60 - 105 g / L.

5. The high-yield palmitoleic acid accumulating Nitzschia algae according to claim 1 (Nitzschia sp.) Y3 Application in the production of biodiesel.

Images