Pharmaceutical uses of knocking down or inhibiting circular RNA circ0030586
By knocking out or inhibiting circ0030586, drugs were prepared to treat or prevent cardiovascular diseases, especially atherosclerosis, caused by endothelial dysfunction. This solved the problem of endothelial dysfunction induced by circ0030586 under ox-LDL and achieved effective prevention and treatment of atherosclerosis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NANJING MEDICAL UNIV
- Filing Date
- 2023-02-01
- Publication Date
- 2026-07-24
Smart Images

Figure CN116042624B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the pharmaceutical use of knocking down or inhibiting circular RNA circ0030586. Background Technology
[0002] With the increasing aging of the population, the incidence and mortality rates of cardiovascular diseases are rising, posing a significant health threat and economic burden to humanity worldwide. Atherosclerosis (AS) is a chronic inflammatory disease of the arterial wall that causes various cardiovascular diseases, seriously endangering human health and safety. AS pathology is multifactorial, not driven by a single process. The aorta is composed of the intima, media, and adventitia. The intima is mainly composed of a single layer of cells formed by endothelial cells, covering the inner wall of the vessel and regulating the exchange of nutrients and oxygen between blood and tissues. As a chronic inflammatory disease, the primary step in AS pathogenesis is the activation and damage of endothelial cells, which in turn induces increased secretion of adhesion molecules and recruits monocytes to the intima, promoting the deposition of chemokines and the release of inflammatory factors, ultimately leading to plaque formation. A key marker of endothelial dysfunction is the production of inflammatory responses, which is the pathological basis of many cardiovascular diseases and mainly occurs in vulnerable areas of the arteries. Endothelial cell dysfunction plays a crucial role in AS-related cardiovascular diseases. Therefore, identifying the molecular mechanisms of inflammatory endothelial dysfunction is key to developing new strategies for the prevention and treatment of AS.
[0003] A growing body of research has revealed the crucial regulatory functions of non-coding RNAs (NRNAs), which participate in various biosynthetic processes such as transcription, translation, and protein degradation, and are closely related to the development and progression of cardiovascular diseases. In recent years, in-depth research on NRNAs has shown that they play important regulatory roles in a series of pathophysiological processes in AS, including lipid metabolism, endothelial cell activation, proliferation and functional abnormalities, inflammation-related cell recruitment and activation, and smooth muscle cell proliferation and transdifferentiation. Among these, circular RNAs (circRNAs) are a class of non-coding endogenous RNAs with covalently closed circular structures, abundant in the eukaryotic transcriptome, and possessing diverse biological functions. CircRNAs exhibit strong evolutionary conservation and stability, are not easily degraded by exonucleases, have a long half-life, and can remain stably present in plasma for extended periods, thus serving as diagnostic biomarkers for various diseases. CircRNAs can also act as sponges for miRNAs, competitively binding to miRNAs and preventing them from regulating their target genes. This allows miRNA-repressed mRNAs to be translated, promoting mRNA expression and thus exerting their biological functions. CircRNAs can also bind to RNA-binding proteins (RBPs) to regulate the function of related proteins. For example, circRNAs regulate RNA polymerase II activity by interacting with small ribonucleoprotein U1, thereby regulating parental gene transcription and the function of encoding proteins. CircRNAs have also been found to have functions such as selective splicing and protein translation, which enable them to play important regulatory roles in the pathological process of cardiovascular diseases. According to literature reports, circRNAs can participate in the pathological process of ankylosing spondylitis (AS) by regulating the activation of vascular endothelial cells, smooth muscle cells, and macrophages. However, given the vast number of circRNAs, specific circRNA sequences remain a hot research topic in this field as therapeutic targets for cardiovascular diseases caused by endothelial dysfunction. Summary of the Invention
[0004] To address the aforementioned problems, this application provides a pharmaceutical use for knocking down or inhibiting the circular RNA circ0030586. This application's research found that circ0030586 expression was significantly increased in an oxidized low-density lipoprotein (ox-LDL)-induced endothelial model. This invention provides a new therapeutic approach and target for drugs treating vascular endothelial dysfunction and atherosclerosis.
[0005] The objective of this invention can be achieved through the following technical solutions:
[0006] In a first aspect, the present invention protects the use of substances that knock out or knock down circ0030586, or substances that inhibit the expression of circ0030586, in the following (A1)-(A2):
[0007] (A1) To prepare drugs for the treatment or adjunctive treatment of cardiovascular diseases caused by endothelial dysfunction;
[0008] (A2) To prepare drugs for the prevention or adjunctive prevention of cardiovascular diseases caused by endothelial dysfunction.
[0009] In a specific implementation plan, the drugs for preventing and treating cardiovascular diseases caused by endothelial dysfunction include drugs for preventing and treating atherosclerosis.
[0010] Secondly, this invention protects a product whose active ingredient is a substance that knocks out or knocks down circ0030586, or a substance that inhibits the expression of circ0030586.
[0011] The product has the following functions: (B1)-(B2)
[0012] (B1) Treatment or adjunctive treatment for cardiovascular diseases caused by endothelial dysfunction;
[0013] (B2) Prevention or adjunctive prevention of cardiovascular diseases caused by endothelial dysfunction.
[0014] In a specific implementation, the substance that knocks down circ0030586 is a small interfering RNA that knocks down circ0030586; preferably, the small interfering RNA sequence that knocks down circ0030586 is selected from the following (C1) and / or (C2):
[0015] (C1)UAGAAAUCCAAUAGGCAUCTT, as shown in SEQ ID NO.1;
[0016] (C2)GAUGCCUAUUGGAUUUCUATT, as shown in SEQ ID NO.2.
[0017] Thirdly, the present invention also protects the use of circ0030586 as a target in the following (D1)-(D4):
[0018] (D1) To prepare drugs for the treatment or adjunctive treatment of cardiovascular diseases caused by endothelial dysfunction;
[0019] (D2) To prepare drugs for the prevention or adjunctive prevention of cardiovascular diseases caused by endothelial dysfunction;
[0020] (D3) Preparation of auxiliary detection reagents for atherosclerosis caused by endothelial dysfunction;
[0021] (D4) Develop / design / screen candidate drugs for the prevention and treatment of cardiovascular diseases caused by endothelial dysfunction.
[0022] Fourthly, this invention protects a method for screening drugs to prevent and treat cardiovascular diseases caused by endothelial dysfunction, comprising the following steps: administering a candidate drug to HCAECs induced with damage by treatment with 100 μg / mL ox-LDL for 24 h, and detecting the expression level of circ0030586; if circ0030586 is inhibited, this indicates that the candidate drug has in vitro activity in preventing and treating cardiovascular diseases caused by endothelial dysfunction; or administering the candidate drug to an animal model of cardiovascular diseases caused by endothelial dysfunction, and detecting the expression level of circ0030586; if circ0030586 is inhibited, this indicates that the candidate drug has in vivo activity in preventing and treating cardiovascular diseases caused by endothelial dysfunction.
[0023] Fifthly, this invention protects the application of the substance that detects circ0030586 in the preparation of an auxiliary diagnostic reagent for atherosclerosis caused by endothelial dysfunction;
[0024] Preferably, the substance used to detect circ0030586 is a substance used for quantitative detection of circ0030586;
[0025] More preferably, the substance used for quantitative detection of circ0030586 is a specific primer pair for circ0030586.
[0026] More preferably, the primer pair is as follows:
[0027] Upstream primer: TCAATTCTGAAAGCTCCGGTA, as shown in SEQ ID NO.3;
[0028] Downstream primer: CAGTGATGACTTCCCTGCTC, as shown in SEQ ID NO.4.
[0029] Beneficial results
[0030] This application investigates Apoexia caused by endothelial dysfunction using methods such as RT-qPCR, Western blotting, and immunofluorescence. - / - The expression of circ0030586 in mouse aortic tissue and human vascular endothelial cells was investigated. An endothelium-specific knockout adeno-associated virus (AAV) of circ0030586 was constructed and synthesized. An AS mouse model was established by feeding 8-week-old mice a high-fat diet (HFD) for 12 weeks. This invention elucidates for the first time the regulatory mechanism of circ0030586 on HCAECs. Knockout of circ0030586 effectively reduces the inflammatory response in HCAECs and the resulting AS, providing a new avenue for drug development and a drug target for the diagnosis and treatment of AS, thus possessing significant medicinal value. Attached Figure Description
[0031] Figure 1 A schematic diagram showing the expression levels of circ0030586 in normal and ox-LDL-induced HCAECs;
[0032] The detection method was to detect the expression level of circ0030586 in normal and ox-LDL-induced HCAECs by real-time quantitative PCR (RT-qPCR).
[0033] Figure 2 A schematic diagram showing the expression level of circ0030586 in vascular tissues of AS patients and control groups;
[0034] Detection method: Vascular tissues were collected from AS patients and control groups, RNA was extracted, and qRT-PCR was used to verify the expression level of circ0030586.
[0035] Figure 3 A schematic diagram showing the cell migration ability detection after knocking out and overexpressing circ0030586, followed by HCAECs ox-LDL stimulation.
[0036] The detection method was as follows: HCAECs circ0030586 that were knocked out or overexpressed were then stimulated with ox-LDL, seeded into a chamber, and after 12 h, the chamber was removed, fixed with methanol, stained with crystal violet, photographed, and the effect of knockdown or overexpression of circ0030586 on ox-LDL-induced cell migration ability was quantitatively and statistically analyzed.
[0037] Figure 4 A schematic diagram showing the expression levels of inflammatory genes such as IL-6, IL-1β, CCL-2, ICAM-1, VCAM-1, and SELE detected by RT-qPCR after knocking out and overexpressing circ0030586, respectively, followed by stimulation with HCAECs ox-LDL;
[0038] The detection method was as follows: HCAECs circ0030586 were knocked out or overexpressed, and then ox-LDL was applied for 24 h. Cell RNA was extracted, and the expression levels of inflammatory genes such as IL-6, IL-1β, CCL-2, ICAM-1, VCAM-1, and SELE were detected by qRT-PCR.
[0039] Figure 5 A schematic diagram illustrating the formation of AS plaques in mice using Oil Red O staining to isolate the aortic tree;
[0040] The detection method is as follows: AAV was constructed and synthesized. endo Adeno-associated virus (AAV) endo -shcirc0030586), and further construct Apoe - / -Endothelial-specific knockout circ0030586 mouse model in mouse background (Apoe - / - AAV endo -shcirc0030586). Select 4-week-old Apoe. - / - Half male and half female mice were injected with the virus via the tail vein and allowed to express it stably for 4 weeks. They were then fed a high-fat diet for 12 weeks to establish an AS model. Subsequently, their aortic blood vessels were harvested, and the size of the plaques was examined by Oil Red O staining.
[0041] Figure 6 A schematic diagram illustrating the immunofluorescence staining detection of ICAM-1 expression in frozen sections of blood vessels;
[0042] The detection method is as follows: AAV was constructed and synthesized. endo Adeno-associated virus (AAV) endo -shcirc0030586), and further construct Apoe - / - Endothelial-specific knockout circ0030586 mouse model in mouse background (Apoe - / - AAV endo -shcirc0030586). Select 4-week-old Apoe. - / - Half male and half female mice were injected with the virus via tail vein and allowed to express it stably for 4 weeks. They were then fed a high-fat diet for 12 weeks to establish an AS model. Mouse vascular tissue was selected and stained with immunofluorescence to identify ICAM-1 (red), CD31 (green), and DAPI (blue). White arrows indicate the co-localization regions of red and green. Detailed Implementation
[0043] The following examples are provided to enable those skilled in the art to fully understand the present invention, but do not limit the invention in any way. Reagents or instruments used, unless otherwise specified, are considered to be conventional products that can be purchased commercially.
[0044] The cell and reagent sources involved in the following examples are:
[0045] Human blood epidermal cells (HCEACs): purchased from ScienCell.
[0046] Apoe - / - Mice: 8-week-old male mice purchased from Vital River Laboratory Animal Technology Co., Ltd.
[0047] All cell experiments involved in the following examples have been approved by the Ethics Committee of Nanjing Medical University.
[0048] Example 1: Correlation Experiment between circ0030586 and AS Caused by Endothelial Dysfunction
[0049] To explore the level of circ0030586 in normal and ox-LDL-induced endothelial dysfunction-induced HCEACs and to verify whether circ0030586 is involved in AS, this embodiment uses qRT-PCR to detect the expression level of circ0030586 in normal and ox-LDL-induced HCEACs and in vascular tissues of AS patients.
[0050] The experimental steps for constructing HCEACs with inflammatory endothelial dysfunction are as follows:
[0051] (1) Cells were washed with phosphate-buffered saline (PBS), and human coronary artery endothelial cells (HCAEC) were cultured in ECM medium containing 10% fetal bovine serum (FBS), penicillin / streptomycin (P / S) and growth factor (GF) in a humid environment at 37°C and containing 5% CO2.
[0052] (2) Digest and passage HCAECs with 0.25% pancreatic enzyme solution, taking care to avoid over-digestion;
[0053] (3) Prepare a cryopreservation solution by mixing DMSO and FBS at a ratio of 1:9 for cell cryopreservation;
[0054] (4) Human coronary artery endothelial cells (HCAEC) were cultured and seeded in well plates. When the cell density reached 80-90%, the culture medium was replaced with serum-free medium and starved for 24 h. After treatment with 100 μg / mL ox-LDL for 24 h, the cells were collected or subjected to other treatments.
[0055] (5) Extract cell proteins or RNA to detect relevant indicators. Cells are used for cell experiments after 3-6 generations.
[0056] The experimental steps for total RNA extraction are as follows:
[0057] (1) Collect the processed samples and extract total RNA according to the Trizol kit instructions. Use an RNase-free pipette tip, DEPC water, and wear a mask (to avoid RNase and prevent RNA degradation);
[0058] (2) Wash the cells with PBS and add 1 mL of Trizol to each well;
[0059] (3) After 10 seconds, transfer the cell lysis buffer to EP and incubate on ice for 10 minutes.
[0060] (4) Add 200 μL of chloroform, shake to mix, and place on ice for 10 min to lyse;
[0061] (5) Centrifuge at 4℃, 12000rpm for 15min;
[0062] (6) Carefully aspirate the supernatant into a new EP tube, add isopropanol, mix by inverting the tube, and let stand on ice for 10 minutes.
[0063] (7) Centrifuge at 12000 rpm and 4℃ for 15 min, and discard the supernatant;
[0064] (8) Invert the paper to absorb the remaining liquid, add 75% ethanol diluted with DEPC water, and gently blow it away with a gun. A white feather-like precipitate can be seen.
[0065] (9) Centrifugation: 4℃, 12000rpm, 15min;
[0066] (10) Discard the supernatant ethanol, blot dry with paper, and air dry in the ventilation hole of the cell culture room (5-10 min).
[0067] (11) Add DEPC water to dissolve the RNA;
[0068] (12) Use NanoDrop to measure RNA concentration. After the measurement, store the sample in a -80℃ refrigerator for later use.
[0069] The reverse transcription experiment steps are as follows:
[0070] (1) Use II. Reverse transcription was performed using the 1st Strand cDNA Synthesis Kit, with a total reaction volume of 20 μL, as shown below:
[0071] RNase-free ddH2O To 20 μL
[0072] Total RNA 1μg
[0073] 5× II Buffer plus 4μL
[0074] (2) After mixing thoroughly, reverse transcription was performed using a PCR instrument:
[0075] 25℃ for 5 minutes
[0076] 42℃ for 30 minutes
[0077] 85℃ for 5 minutes
[0078] (3) After reverse transcription, dilute the cDNA with DEPC water at a ratio of 1:3 or 1:4 and store at -80℃ for later use.
[0079] The steps for a real-time PCR experiment are as follows:
[0080] (1) This experiment adopted qPCR SYBR Green Master Mix was used for relative quantification of the target gene. The PCR reaction system is as follows:
[0081] 1 μL of cDNA template
[0082] qPCR SYBR Green Master Mix 5μL
[0083] Upstream primer: TCAATTCTGAAAGCTCCGGTA, 1 μM 1 μL
[0084] Downstream primer: CAGTGATGACTTCCCTGCTC, 1 μM 1 μL
[0085] 2μL of ultrapure water
[0086] (2) Divide into groups and calculate the system (add cDNA at the end);
[0087] (3) Seal the membrane, centrifuge the 384-well plate and place it in a real-time PCR instrument;
[0088] (4) The reaction was performed on a Bio-Rad 480II quantitative PCR instrument.
[0089] Test results as follows Figure 1 As shown, compared with the normal group, the expression level of circ0030586 in ox-LDL-induced HCEACs was significantly increased; Figure 2 As shown, compared with the control group, the expression level of circ0030586 in the vascular tissue of AS patients was significantly increased.
[0090] To further clarify whether circ0030586 is involved in ox-LDL-induced endothelial damage, thereby leading to ankylosing spondylitis (AS), we knocked out and overexpressed circ0030586, and then used qRT-PCR to detect the migration ability of endothelial cells and the expression levels of inflammatory factors and adhesion molecules. The results are as follows: Figure 3 As shown, knockout of circ0030586 significantly improved ox-LDL-induced reduction in endothelial cell migration, while overexpression of circ0030586 enhanced ox-LDL-induced reduction in endothelial cell migration; furthermore, as Figure 4 As shown, knocking out circ0030586 significantly inhibited the increase in expression of ox-LDL-induced endothelial cell inflammatory factors and adhesion molecules, while overexpression of circ0030586 further increased the expression of ox-LDL-induced endothelial cell inflammatory factors and adhesion molecules.
[0091] Example 2: Mouse Model Experiment
[0092] To further verify the role of circ0030586 in AS caused by endothelial dysfunction, this embodiment constructed and synthesized AAV. endo Adeno-associated virus (AAV) endo -shcirc0030586), and further construct Apoe - / - Endothelial-specific knockout circ0030586 mouse model in mouse background (Apoe - / - AAV endo -shcirc0030586). Select 4-week-old Apoe - / - Mice of equal sexes were injected with the virus via the tail vein. After 4 weeks, once the AAV virus expression was stable, the mice were fed a high-fat diet for 12 weeks to establish a mouse model of atherosclerosis. Gross blood vessels were extracted and stained with Oil Red O.
[0093] The steps for Oil Red O staining of the aorta are as follows:
[0094] (1) After the aortic tree was separated, it was placed in a clean six-well plate and fixed with 4% paraformaldehyde.
[0095] (2) Use micro forceps to take the aorta fixed with paraformaldehyde into a new six-well plate and rinse it with triple-distilled water for about 10 minutes.
[0096] (3) Use a pipette to remove the triple-distilled water from the six-well plate, add 60% isopropanol solution, and treat for 2 min.
[0097] (4) Use a pipette to remove the isopropanol from the six-well plate, add the pre-filtered Oil Red O staining solution, and place it on a horizontal shaker for 1 hour for staining.
[0098] (5) Use a pipette to remove the Oil Red O staining solution from the six-well plate, add 60% isopropanol solution to rinse for 1 min, repeat this process 3 times until the background of the blood vessels is no longer red.
[0099] (6) Carefully remove any remaining fat from the outer wall of the blood vessel under a microscope using micro-scissors.
[0100] (7) Finally, lay the stained aortic tree flat on a black anatomical wax plate and take a picture.
[0101] The results are as follows Figure 5 As shown, endothelial-specific knockout of circ0030586 significantly reduced HFD-induced AS plaques.
[0102] Further immunofluorescence assays were performed on the blood vessels of mice fed a high-fat diet for 12 weeks. Aortic tissue was extracted from different groups of mice and stained with immunofluorescence. After frozen sectioning, the expression of the adhesion factor ICAM-1 was detected by immunofluorescence. Figure 6As shown, red represents ICAM-1, green represents CD31, and blue represents DAPI. The white arrows indicate the co-localization regions of red and green. It is evident that knocking out circ0030586 significantly inhibits the increased expression of ICAM-1 in the endothelium of HFD-mediated endothelium.
[0103] As can be seen from the above examples, in patients with atherosclerosis caused by inflammatory endothelial dysfunction and in atherosclerosis-related cell and animal models, inhibiting or knocking out circ0030586 can suppress inflammatory endothelial dysfunction and slow the progression of atherosclerosis. Therefore, substances that inhibit or knock out circ0030586 can be used to prepare drugs for treating inflammatory endothelial dysfunction, especially for preparing drugs for treating atherosclerosis caused by inflammatory endothelial dysfunction.
[0104] The above examples are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be used to limit the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.
Claims
1. Application of knockdown of circ0030586 small interfering RNA in the preparation of drugs for treating cardiovascular diseases caused by endothelial dysfunction. The cardiovascular disease caused by endothelial dysfunction is atherosclerosis; The small interfering RNA sequence is selected from the following (C1) and / or (C2): (C1) UAGAAAUCCAAUAGGCAUCTT, as shown in SEQ ID NO.1; (C2) GAUGCCUAUUGGAUUUCUATT, as shown in SEQ ID NO.
2.
2. A product whose active ingredient is small interfering RNA that knocks down circ0030586; The product is used to treat cardiovascular diseases caused by endothelial dysfunction, namely atherosclerosis. The small interfering RNA sequence is selected from the following (C1) and / or (C2): (C1) UAGAAAUCCAAUAGGCAUCTT, as shown in SEQ ID NO.1; (C2) GAUGCCUAUUGGAUUUCUATT, as shown in SEQ ID NO.2.