A nucleic acid aptamer for detecting brown algae and application thereof
By combining nucleic acid aptamers screened using SELEX technology with fluorescent markers to construct molecular probes or detection kits, the cumbersome and costly detection of *Phaeocystis globosa* in existing technologies has been solved, enabling rapid and accurate on-site detection.
Patent Information
- Application Number
- CN202310114004.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-14
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2043-02-14
AI Technical Summary
Existing methods for detecting Phaeocystis globosa, such as PCR technology, are cumbersome, time-consuming, and costly, and cannot meet the needs for rapid and accurate on-site detection.
Nucleic acid aptamers screened using SELEX technology were designed to specifically recognize the nucleotide sequences of *Phaeocystis globosa*, and molecular probes or detection kits were constructed by combining them with fluorescent markers. Detection was then performed using equipment such as ELISA readers and flow cytometers.
It achieves highly sensitive and specific detection of Phaeocystis globosa, is simple and fast to operate, low in cost, suitable for on-site detection, and has good application prospects.
Smart Images

Figure FDA0004077897120000011 
Figure HDA0004077897140000011 
Figure HDA0004077897140000021
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of bioengineering technology, and particularly relates to a nucleic acid aptamer for detecting Phaeocystis globosa and application thereof. BACKGROUND
[0002] Algae are primary producers in the ocean and form the basis of the marine ecological environment, and can provide food for planktonic animals. However, with the increase of eutrophication emissions caused by human activities, red tides often break out in coastal areas, and Phaeocystis globosa is the most common algae causing red tides. The harmful red tide outbreak caused by Phaeocystis globosa not only affects the survival and growth of marine organisms and reduces the reproductive capacity of marine organisms, but also affects the normal development of larvae, causing great harm to the environment and fisheries. At present, the diagnosis methods for Phaeocystis globosa mainly include molecular biology detection methods such as PCR technology, nested PCR technology, fluorescent quantitative PCR technology, ELISA technology, etc. The detection result of PCR technology is accurate and reliable, but it has the disadvantages of complicated operation, long time consumption, expensive instruments and reagents, etc., and cannot meet the requirements of on-site rapid and accurate detection and diagnosis. Therefore, efforts should be made to develop rapid detection technology and functional products for Phaeocystis globosa which are convenient to operate, low in cost, short in time consumption, high in accuracy and can be used on site in aquaculture farms, which is crucial for early detection and determination of pathogens and then formulating treatment programs to control the spread of pathogens and reduce losses.
[0003] Nucleic acid aptamer is a nucleic acid sequence that can specifically recognize target objects by using Systematic Evolution of Ligands by Exponential Enrichment technology (SELEX), and can specifically bind to targets such as small molecules, peptides, proteins, viruses, cells, etc. In recent years, due to the precise specificity and high affinity of nucleic acid aptamer, it has received widespread attention in many fields at home and abroad, such as disease diagnosis and treatment, drug delivery, food safety detection and environmental monitoring, etc. In the field of environmental detection, nucleic acid aptamer is widely used in the detection of environmental pathogenic microorganisms. The application of nucleic acid aptamer in the detection of Phaeocystis globosa is expected to realize the precise, rapid and low-cost detection of this red tide species. Therefore, nucleic acid aptamer has broad application prospects in the fields of environmental monitoring and targeted prevention and treatment. SUMMARY
[0004] The purpose of the present application is to provide a nucleic acid aptamer for detecting Phaeocystis globosa and application thereof, so as to realize high-sensitivity and specific detection of Phaeocystis globosa.
[0005] According to one aspect of the present application, a nucleic acid aptamer for detecting Phaeocystis globosa is provided, and the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO. 1.
[0006] Preferably, the nucleotide sequence is phosphorylated, sulfhydrylated, methylated, aminated or isotopically labeled.
[0007] Preferably, the secondary structure of the nucleotide sequence as shown in SEQ ID NO. 1 is as shown in Figure 1 .
[0008] Preferably, the nucleotide sequence has a functional group selected from at least one of a biotin label, a luminescent label and an enzyme label.
[0009] Preferably, the luminescent label is selected from at least one of a hydroxyl fluorescein, a fluorescein isothiocyanate or a carboxytetramethylrhodamine.
[0010] According to another aspect of the present application, there is provided use of the above-mentioned nucleic acid aptamer for detecting Phaeocystis globosa in the preparation of a product for detecting Phaeocystis globosa, which does not include use in disease diagnosis.
[0011] Preferably, the product comprises a fluorescent molecular probe, and the nucleic acid aptamer for detecting Phaeocystis globosa is attached with a luminescent label.
[0012] According to another aspect of the present application, there is provided a product for detecting Phaeocystis globosa, comprising the above-mentioned nucleic acid aptamer for detecting Phaeocystis globosa.
[0013] Preferably, the product for detecting Phaeocystis globosa is a molecular probe and / or a detection kit.
[0014] Compared with existing protein antibodies, the nucleic acid aptamer obtained by SELEX technology in the present application has higher affinity and specificity for Phaeocystis globosa, and also has characteristics that protein antibodies do not have, including no immunogenicity, short preparation period, good reproducibility, small molecular weight, easy in vitro chemical synthesis, easy to label, easy to modify and substitute different parts of the nucleic acid aptamer, stable sequence, easy to transport and store, etc. When the nucleic acid aptamer based rapid detection method of the present application is used to detect Phaeocystis globosa, the operation is simple and rapid, and high accuracy and sensitivity can be achieved. The nucleic acid aptamer can be used to construct a molecular probe or a detection kit, and combined with an enzyme label instrument, a flow cytometer, a fluorescence microscope and other detection equipment to realize accurate detection of Phaeocystis globosa. This has important significance for rapid diagnosis of Phaeocystis globosa and has good application prospects in the field of detection of Phaeocystis globosa. BRIEF DESCRIPTION OF DRAWINGS
[0015] Figure 1 is a secondary structure prediction diagram of the nucleic acid aptamer as shown in SEQ ID NO. 1;
[0016] Figure 2is the test result of the sample FAM fluorescence value detected by flow cytometry in test example 1;
[0017] Figure 3 is the intensity of the mutual combination of the hydroxyl fluorescein (FAM) labeled nucleic acid aptamer as shown in SEQ ID NO. 1 and the Phaeocystis globosa cells in example 3. DETAILED DESCRIPTION
[0018] In order for those skilled in the art to better understand the present application, the technical solutions in the embodiments of the present application will be described clearly and completely below. Obviously, the described embodiments are only a part of the embodiments of the present application, not all.
[0019] Example 1
[0020] The screening and preparation of the nucleic acid aptamer for detecting Phaeocystis globosa include the following steps:
[0021] S1. Construction of the first ssDNA library and synthesis of the primer
[0022] The first ssDNA library Library 50 is designed and synthesized, and its nucleotide sequence is as follows: 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC, wherein the two ends are fixed sequences, and the middle 50 nucleotides are random sequences.
[0023] The upstream primer includes the nucleotide sequence as shown in SEQ ID NO. 2 and is labeled with hydroxyl fluorescein (FAM), and its specific sequence is: 5'-FAM-GACGCTTACTCAGGTGTGACTCG-3'.
[0024] The downstream primer includes the nucleotide sequence as shown in SEQ ID NO. 3 and is labeled with biotin (Biotin), and its specific sequence is: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3'.
[0025] The first ssDNA library and the primer are both synthesized by Shanghai Sangon Biotech Co., Ltd.
[0026] S2. SELEX screening to obtain nucleic acid aptamer specifically recognizing Phaeocystis globosa (positive screening)
[0027] S2.1. 10 nmol of the above first ssDNA library is dissolved in 500 μL PBS, and then incubated in a 92℃ constant temperature water bath for 5 min, followed by rapid insertion into ice, and then incubated in ice bath for 10 min. The treated first ssDNA library is incubated with Phaeocystis globosa on ice for 1 h;
[0028] S2.2 After the incubation is completed, centrifugal removal of supernatant, 10 mL of PBS was used to wash the sphaeroma globosum 92 ℃ constant temperature water bath for 10 min, 12000 g centrifugal collection of supernatant, which was the second ssDNA library specific to sphaeroma globosum.
[0029] S3. PCR amplification
[0030] 100 μL of the second ssDNA library screened was taken and subjected to PCR amplification with upstream primer and downstream primer. The PCR reaction system was as follows (1000 μL): 10×Buffer 100 μL, dNTP Mix (2.5 mM) 80 μL, upstream primer 40 μL, downstream primer 40 μL, second ssDNA library 100 μL, rTaq enzyme 12.5 μL, and ddH2O 627.5 μL. The PCR amplification was performed according to the following procedure: 92 ℃ for 5 min, 92 ℃ for 1 min, 60 ℃ for 30 s, 72 ℃ for 1 min, 25 cycles, and 72 ℃ for 5 min. The supernatant obtained after the first cycle of screening was used for subsequent PCR amplification, and the amplified dsDNA library was obtained.
[0031] S4. Preparation of third ssDNA library
[0032] 100 μL of streptavidin-labeled magnetic beads was incubated with the dsDNA library at room temperature for 20 min. The dsDNA library was combined to the surface of the magnetic beads by the affinity between the biotin on the dsDNA library and the streptavidin on the magnetic beads. The supernatant was removed by using a magnetic separator, and the magnetic beads were washed with 2 mL of PBS. Then, 200 μL of NaOH solution (200 mM) was added to the EP tube, and the reaction was carried out at room temperature for 15 min to denature the dsDNA library. The single-stranded DNA with biotin was combined with the streptavidin and remained on the magnetic beads. The single-stranded DNA combined with the magnetic beads was used as the third ssDNA library, and the supernatant was recovered by using a magnetic separator. The forward single-stranded nucleic acid in the supernatant was purified and recovered by using a PCR purification and recovery kit, and the collected solution was used for the next round of screening.
[0033] S5. Repeated screening
[0034] The third ssDNA library obtained in S4 was replaced by the first ssDNA library, and the positive screening process, PCR amplification and single-stranded DNA library preparation process shown in S2-S4 were repeated 9 times.
[0035] S6. Negative screening
[0036] In the second round of S5 and the screening after the second round, the ssDNA library obtained after the screening of S5 was subjected to negative screening to improve the screening efficiency, using Skeletonema costatum cells as a control. The specific process of negative screening was as follows: the ssDNA library obtained by screening was dissolved, and was incubated with Skeletonema costatum at 92°C for 1 h in an ice bath. After the incubation, the supernatant was collected by centrifugation, and was used as the ssDNA library subjected to negative screening.
[0037] S7.9 rounds of screening
[0038] The supernatant containing the ssDNA library collected in S6 was subjected to PCR amplification of S3 and preparation of the ssDNA library of S4, and then the process of S6, S2, S3 and S4 was repeated in sequence. The change in the recognition ability of the obtained ssDNA library to Phaeocystis globosa was detected by flow cytometry. The screening was repeated for 6 rounds, and the ssDNA library obtained at this time had the strongest recognition ability to Phaeocystis globosa. After the amplified product was subjected to cloning and sequencing analysis, the nucleic acid aptamer used for detecting Phaeocystis globosa in this example was finally obtained, and the nucleotide sequence thereof was as follows:
[0039] TCGGTCGGGTGGTTGGGGTGGGTGGTCGGTTTCTCTCTGCGTGGGCTT GGTGTGGTTGGATC (SEQ IN NO. 1),
[0040] The secondary structure of the nucleic acid aptamer as shown in SEQ ID NO. 1 was predicted online by using MFOLD software (http: / / mfold.rna.albany.edu / ?q=mfold / DNA-Folding-Form), and the prediction result was as shown in SEQ ID NO. 2. The nucleic acid aptamer as shown in SEQ ID NO. 1 formed special stem-loop structures and hairpin structures. Figure 1
[0041] Example 2
[0042] In this example, the nucleic acid aptamer as shown in SEQ ID NO. 1 screened in Example 1 was incubated with Phaeocystis globosa cells. The specific operation included the following steps: hydroxyl fluorescein (FAM)-labeled SEQ ID NO. 1 nucleic acid aptamer was dissolved in 500 μL PBS to prepare a solution with a concentration of 500 nmol / L. The solution was subjected to constant temperature water bath at 92°C for 5 min, and then was quickly inserted into ice for 10 min. The treated nucleic acid aptamer was incubated with Phaeocystis globosa cells on ice for 1 h. After the incubation and combination, the cells were centrifuged and washed for 3 times, and were resuspended with 300 μL PBS buffer to obtain a resuspension.
[0043] Example 3
[0044] The nucleic acid aptamer as shown in SEQ ID NO. 1 screened in Example 1 was incubated with Phaeocystis globosa cells in this example. The specific operation included the following steps: the hydroxyl fluorescein (FAM) labeled SEQ ID NO. 1 nucleic acid aptamer was dissolved in 500 μL PBS to prepare solutions with concentrations of 62.5, 125, 500 nmol / L, respectively. The solution was incubated in a 92°C constant temperature water bath for 5 min, then quickly inserted into ice, and ice-bathed for 10 min. The treated nucleic acid aptamer was incubated with Phaeocystis globosa cells on ice for 1 h. After the incubation and combination were completed, the cells were centrifuged and washed 3 times, and resuspended with 300 μL PBS buffer to obtain a resuspension.
[0045] Comparative Example 1
[0046] In this comparative example, PBS solution was incubated with Phaeocystis globosa cells according to Example 2. The difference between this example and Example 2 is that the FAM labeled nucleic acid aptamer as shown in SEQ ID NO. 1 in Example 2 was replaced by 500 μL FAM labeled PBS solution. Except for the above difference, the other components and process operations used in this comparative example were strictly the same as those in Example 2.
[0047] Test Example 1
[0048] 1. Test object: The solutions obtained in Examples 2, 3 and Comparative Example 1 were used as test objects in this test example.
[0049] 2. Test items:
[0050] (1) The combination of nucleic acid aptamer and Phaeocystis globosa cells: the combination effect and specificity of the solutions obtained in Examples 2 and Comparative Example 1 on Phaeocystis globosa cells were detected by flow cytometry.
[0051] (2) The mutual combination strength of nucleic acid aptamer and Phaeocystis globosa cells: the fluorescence average value of the specific combination of Phaeocystis globosa cells in the resuspension obtained in Example 3 was detected by flow cytometry, and then the dissociation equilibrium constant (Kd) of the nucleic acid aptamer binding to the target cells was calculated using Sigmaplot software.
[0052] 3. Test results
[0053] The test results of the combination of the nucleic acid aptamer as shown in SEQ ID NO. 1 and Phaeocystis globosa cells are shown in Table 1. Figure 2 The results confirmed that the hydroxyl fluorescein (FAM) labeled nucleic acid aptamer as shown in SEQ ID NO. 1 had higher affinity and specificity for Phaeocystis globosa cells compared with Comparative Example 1.
[0054] The test results of the mutual binding strength of the nucleic acid aptamer as shown in SEQ ID NO. 1 and the cells of Phaeocystis globosa are shown in Table 1. Figure 3 The affinity of the above-mentioned nucleic acid aptamer as shown in SEQ ID NO. 1 to Phaeocystis globosa is 607.71 nmol / L. Thus, it is illustrated that the nucleic acid aptamer as shown in SEQ ID NO. 1 has high specific recognition ability to the cells of Phaeocystis globosa.
[0055] The above examples are only used to illustrate the technical solutions of the present application and are not a limitation on the protection scope of the present application. Although the present application has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present application can be modified or replaced equivalently without departing from the essence and scope of the technical solutions of the present application.
Claims
1. A nucleic acid aptamer for detecting *Phaeocystis globosa*, characterized in that, The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.
1.
2. The nucleic acid aptamer for detecting *Phaeocystis globosa* as described in claim 1, characterized in that, The nucleotide sequence is phosphorylated, thiolated, methylated, aminoized, or isotopized.
3. The nucleic acid aptamer for detecting *Phaeocystis globosa* as described in claim 1, characterized in that, The secondary structure of the nucleotide sequence shown in SEQ ID NO. 1 is as follows:
4. The nucleic acid aptamer for detecting *Phaeocystis globosa* as described in any one of claims 1 to 3, characterized in that, The nucleotide sequence has a functional group, which is selected from at least one of biotinylate markers, luminescent markers, and enzyme markers.
5. The use of the nucleic acid aptamer for detecting *Phaeocystis globosa* as described in any one of claims 1 to 3 in the preparation of a product for detecting *Phaeocystis globosa*, wherein the use does not include its use in disease diagnosis.
6. The application as described in claim 5, characterized in that, The product for detecting *Phaeocystis globosa* includes a fluorescent molecular probe, and the nucleic acid aptamer for detecting *Phaeocystis globosa* is conjugated with a luminescent label.
7. A product for detecting *Phaeocystis globosa*, characterized in that, Includes the nucleic acid aptamer for detecting *Phaeocystis globosa* as described in any one of claims 1 to 3.
8. The product as described in claim 7, characterized in that, The products are molecular probes and / or detection kits.