Application of AsNADP-ME 1 gene in improving drought tolerance of plants

By introducing the Oat AsNADP-ME 1 gene, the drought tolerance of plants under drought conditions is improved, and the problem of insufficient drought tolerance in the prior art is solved, and the effect of significantly improving the seed germination rate is achieved.

CN116042673BActive Publication Date: 2025-06-17INNER MONGOLIA AGRICULTURAL UNIVERSITY +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211295214.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-21
Publication Date
2025-06-17
Estimated Expiration
2042-10-21

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the drought tolerance of C3 plants, especially the problem of low seed germination rate under drought stress.

Method used

Recombinant plant expression vectors were constructed by introducing the NADP-dependent malicase gene AsNADP-ME 1 in oats and expressed the gene in host cells to improve drought tolerance of plants under drought conditions.

Benefits of technology

It significantly improves the seed germination rate of transgenic plants under drought stress, enhances the drought resistance of plants, and provides a broader gene source for biological breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116042673B_ABST
    Figure CN116042673B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of the AsNADP-ME1 gene in improving the drought tolerance of plants. It belongs to the technical field of genes regulating the malic acid metabolic pathway and their applications. The AsNADP-ME1 gene of the present invention can improve the drought tolerance of plants, significantly improve the seed germination ability of transgenic Arabidopsis under drought stress, and is of great significance for cultivating new transgenic plant varieties with improved seed germination rate under drought stress. It can provide a broader gene source for the directional editing and improvement of the drought resistance of oats and the biological breeding of various plants and crops. It can increase the understanding of the action pathway of the NADP-dependent malic enzyme gene in C3 plants in resisting drought stress.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genes regulating the malic acid metabolic pathway and their applications, and more specifically to the application of the AsNADP-ME 1 gene in improving the drought tolerance of plants. Background Art

[0002] Under natural conditions, plants constantly encounter various environmental stresses that limit plant growth and development and restrict crop productivity. NADP-dependent malic enzyme (NADP-ME) is considered to play an important role in various stress responses of plants. NADP-ME is one of the essential enzymes for metabolizing malic acid and is important for stabilizing cytoplasmic pH, controlling stomatal aperture, and increasing resistance to aluminum excess and pathogens. Another product of the NADP-ME reaction, pyruvate, is involved in the synthesis of defense compounds such as flavonoids and lignin, which are related to stress tolerance such as mechanical damage and pathogen invasion. On the other hand, NADPH is crucial for the reactive oxygen species (ROS) metabolic system (such as the ascorbate-glutathione pathway and NADPH-dependent thioredoxin reductase), and is also required for apoplastic oxidative bursts in most plant-pathogen interactions. It has been found that two NADP-ME genes play important roles in the responses of wheat to ABA, SA, low temperature, salinity, darkness, and drought stress, and the NADP-ME gene in cucumber plays an important role in resisting salt stress and low osmotic stress. NADP-MEs have been well studied in C4 plants, but less studied in C3 plants.

[0003] Oats belong to C3 plants, and their main production areas are mainly distributed on marginal cultivated lands with drought, salinity, and poor soil. During the long-term adaptation to the harsh growth environment, many unique environmentally acquired traits have been formed, and there is a strong advantage in resistance gene resources. Therefore, excavating the key genes regulating the drought tolerance of oats at each growth and development stage can provide excellent gene sources for using biotechnology breeding to synergistically and directionally improve the yield and quality of major crops. Summary of the Invention

[0004] In view of this, the present invention provides the application of the AsNADP-ME 1 gene in improving the drought tolerance of plants.

[0005] One object of the present invention is to provide the coding sequence of the oat NADP-dependent malic enzyme gene AsNADP-ME 1 and the application of the protein encoded thereby in improving the drought tolerance of plants;

[0006] Another object of the present invention is to provide the application of a recombinant plant expression vector containing the above AsNADP-ME 1 gene and a host cell containing the expression vector in improving the drought tolerance of plants.

[0007] A third object of the present invention is to apply the AsNADP-ME 1 gene to a new variety of transgenic plants for improving the seed germination rate of plants under drought stress.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] Application of the AsNADP-ME 1 gene in improving the drought tolerance of plants, wherein the nucleotide sequence of the gene is as shown in SEQ ID NO: 1;

[0010] Or a nucleotide sequence having a homology of more than 90% with the nucleotide sequence of SEQ ID NO: 1 and encoding an amino acid as shown in SEQ ID NO: 2.

[0011]

[0012] MLGPHRSSLARIASTTREAWAATAAASRRRIGSPRAAQYGAMAGGRSGEEEGRNGGVPPSSDAAMAGVATGGVEDPYGEDRATEDQPVTPWAVCIASGHSLLRDPRHNKGLSFTEKERDAHYLRGLLPPAVLPQELQEKRLLQNVRQLEVPLQRYMFLMDLQERNERLFYKLMIDNVEELLPVVYTPTVGEACQKYGSIFRRSQGLYISLRDKGRVLELLRNWPEKSIQVIVVTDGERILGLGDLGCQGMGIPVGKLALYTALGGVRPSAALPITIDVGTNNEELLNDEFYIGLRQRRATGQEYAELLDEFMAAVKQNYGQKALVQFEDFANHNAFTLLEKYKGTHLVFNDDIQGTAAVVLAGLIAGLKFVGGTLADHRFLFFGAGEAGTGIAELVALEMSMQVVAVKFCLLRSGVC, SEQ ID NO: 2.

[0013] Use of a protein or a substance that regulates the expression of the gene encoding the protein in improving the drought tolerance of plants, wherein the amino acid sequence of the protein is as shown in SEQ ID NO: 2;

[0014] or a protein with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID NO: 2.

[0015] Use of a biological material related to the above gene or the above protein in improving the drought tolerance of plants, wherein the biological material is any one of the following:

[0016] A: a nucleic acid molecule with a nucleotide sequence as described above or a nucleic acid molecule encoding the above protein;

[0017] B: an expression cassette containing the nucleic acid molecule described in A;

[0018] C: an expression vector containing the nucleic acid molecule described in A, or a recombinant vector containing the expression cassette described in B;

[0019] D: a recombinant microorganism containing the nucleic acid molecule described in A, or a recombinant microorganism containing the expression cassette described in B, or a recombinant microorganism containing the recombinant vector described in C.

[0020] The term "expression cassette" refers to DNA that can express the protein described in the above application in a host cell. This DNA can not only include a promoter that initiates the transcription of the protein-coding gene, but also include a terminator that terminates the transcription of the protein-coding gene. Further, the expression cassette may also include enhancer sequences.

[0021] Further, the plant is oats or Arabidopsis thaliana.

[0022] Further, the improvement of plant drought tolerance is to improve the germination rate of seeds of the plant under drought stress.

[0023] A method for cultivating transgenic plants resistant to drought stress, which transfers the AsNADP-ME 1 gene into plant tissues or plant cells.

[0024] From the above technical solutions, it can be seen that compared with the prior art, the beneficial effects obtained by the present invention are as follows: The AsNADP-ME 1 gene of the present invention can improve the drought tolerance of plants, can significantly improve the seed germination ability of transgenic Arabidopsis thaliana under drought stress, and is of great significance for cultivating new varieties of transgenic plants with improved seed germination rate under drought stress. It can provide a broader gene source for the directional editing and improvement of the drought resistance of oats and the biological breeding of various plants and crops. It can increase the understanding of the action pathway of the NADP-dependent malic enzyme gene in C3 plants in resisting drought stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative efforts.

[0026] Figure 1 The drawing is an evolutionary tree analysis of the AsNADP-ME 1 gene in Example 1 of the present invention;

[0027] Figure 2 The drawing is the expression level of the AsNADP-ME 1 gene under different drought stress degrees in Example 2 of the present invention; among them, ** indicates a significant difference compared with normal water supply (soil water content 70%) (P<0.01);

[0028] Figure 3 The drawing is the seed germination phenotypes of wild-type and transgenic Arabidopsis thaliana under different PEG concentration treatments in Example 3 of the present invention;

[0029] Figure 4The attached figure shows the germination rates of wild-type and transgenic Arabidopsis thaliana seeds under different PEG concentrations in Example 3 of the present invention; where, ** indicates a significant difference compared with the transgenic line (OE) (P<0.01), and a indicates a significant difference compared with the normal growth condition (CK). Detailed implementation manners

[0030] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the attached figures in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0031] In the following embodiments, the experimental methods are all conventional methods unless otherwise specified; the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0032] Example 1 Isolation and sequence analysis of oat NADP-dependent malic enzyme gene AsNADP-ME 1

[0033] Oat cultivar (Baiyan No. 2) was planted in the soil and cultivated in a greenhouse with 14 hours of light at 22°C / 10 hours of darkness at 18°C. The soil water content was controlled by the weighing method. The relative soil water contents of the three treatments were: severe drought (S) 45%, moderate drought (M) 60%, and normal water supply control (CK) 70%. Samples were taken for transcriptome sequencing when the symptoms of leaf wilting and water loss appeared during the drought treatment. According to the transcriptome sequencing data, primers were designed to isolate the CDS sequence.

[0034] The primer sequences are as follows:

[0035] Forward: 5'atgctcgggccacaccgcagcagct3', SEQ ID NO: 3;

[0036] Reverse: 5'ctaacacactccagagcgcaacaag3', SEQ ID NO: 4.

[0037] Through sequencing analysis, the sequence with SEQ ID NO: 1 was obtained, and this gene was named AsNADP-ME 1. The cDNA sequence of this gene is 1254 bp long, the open reading frame starts from 1 bp and ends at 1254 bp, encoding a beta-glucosidase like protein composed of 417 amino acid residues.

[0038] Sequence homology analysis showed that the AsNADP-ME 1 gene in the present invention has a relatively close genetic relationship with the NADP-ME genes in wheat, Brachypodium distachyon, and Lolium perenne( Figure 1 ).

[0039] Example 2 Induced expression analysis of the AsNADP-ME 1 gene

[0040] Oats planted in soil were subjected to controlled watering, and the relative soil water content was measured for drought treatment. The three treatment gradients were: severe drought 40%, moderate drought 55%, and normal condition (CK) 70%. Samples were taken for drought-induced expression analysis of the AsNADP-ME 1 gene when the symptoms of leaf wilting and water loss appeared during drought treatment.

[0041] The results showed that the transcriptional expression of the AsNADP-ME 1 gene was induced by drought stress. Compared with the normal condition (soil water content 70%), the expression level of the AsNADP-ME 1 gene increased significantly under moderate and severe drought stresses (P<0.01), and the expression level increased significantly between the moderate and severe drought treatments with the increase in the intensity of drought stress( Figure 2 ).

[0042] The above results indicate that the transcriptional expression of the AsNADP-ME 1 gene was significantly induced by drought stress.

[0043] Example 3 Functional identification of the AsNADP-ME 1 gene

[0044] To study whether the AsNADP-ME 1 gene plays a role in the response of oats to drought stress, its function was first analyzed and identified by transgenic Arabidopsis thaliana.

[0045] (1) Construction of the 35S:AsNADP-ME 1 expression vector

[0046] Primers containing the restriction enzyme sites of the vector sequence were designed as follows:[[]]

[0047] Forward: 5'atttggagagaacacgggggactttgcaacatgctcgggccacaccgcagcagct 3', SEQ ID NO: 5;

[0048] Reverse: 5'ggcccagtactgaagacagagctagttacactaacacactccagagcgcaacaag 3', SEQ ID NO: 6.

[0049] PCR amplification procedure for the target fragment: 94°C for 5 min, 94°C for 30 sec, 50°C for 45 sec, 72°C for 25 sec, 72°C for 10 min, with 30 cycles.

[0050] Vector digestion system and reaction conditions: Nuclease-free Water, 13 μL; 10*Buffer, 2 μL; BsaI / Eco31I, 1 μL; pBWA(V)BS-ccdB, 4 μL. Digest at 37°C for 1 hour.

[0051] Recombination reaction: Biorun 2*EasyClone Mix, 10 μL; cDNA, 5 μL; pBWA(V)BS-ccdB(D), 5 μL; Total 20 μL. React at 37°C for 30 hours.

[0052] Transform 10 μL of the ligation product into Escherichia coli competent cells DH5α, spread on kanamycin-resistant plates, culture at 37°C for 12 hours, and identify positive clones by PCR for sequencing.

[0053] (2) Screening of positive transgenic Arabidopsis plants

[0054] Extract the plasmid of the sequenced AsNADP-ME1-pBWA(V)BS vector and transfer it into Agrobacterium tumefaciens GV3101, then transform Arabidopsis by the floral dip method. Screen for positive plants with T0 and T1 seeds on 1 / 2 MS medium containing 2 / 1000 glufosinate. After true leaves and primary roots grow on the medium containing glufosinate, transplant them into the soil to harvest seeds.

[0055] (3) Overexpression of the AsNADP-ME1 gene improves the seed germination rate of Arabidopsis under drought stress

[0056] Use the homozygous T2 generation transgenic Arabidopsis identified by PCR as the material to analyze the function of the AsNADP-ME1 gene in response to drought stress. Sow the T2 generation transgenic seeds and wild-type Arabidopsis thaliana (Columbia) seeds in 1 / 2 MS medium simultaneously. After treating with different concentrations of PEG (polyethylene glycol) for 3 days, start counting the germination rate.

[0057] Figure 3 The phenotypic differences after 3 days of germination are shown. Figure 4The displayed germination rate statistics show that: under normal growth conditions (CK), there is no significant difference in the germination rates of wild-type (WT) and transgenic (OE) Arabidopsis thaliana seeds. However, the germination rate of transgenic Arabidopsis thaliana seeds reached 42% on the 3rd day of germination, while that of the wild type was only 20%. Under PEG treatment, the germination rate of transgenic Arabidopsis thaliana seeds was significantly higher than that of the wild type. After PEG200 treatment, the germination of wild-type seeds was significantly inhibited, and the germination rate decreased significantly (P<0.01); while the germination rate of transgenic Arabidopsis thaliana seeds decreased, but the germination rate did not decrease significantly. After PEG300 treatment, the changes in the germination rates of wild-type and transgenic seeds were consistent with those under PEG200 treatment. This indicates that the expression of the AsNADP-ME 1 gene plays a role in increasing the germination rate of seeds under drought stress.

[0058] The various embodiments in this specification are described in a progressive manner. Each embodiment focuses on the differences from other embodiments. For the same or similar parts among the various embodiments, reference can be made to each other.

[0059] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of the AsNADP-ME 1 gene in improving plant drought tolerance, characterized in that, The nucleotide sequence of the said gene is as shown in SEQ ID NO: 1; or a nucleotide sequence having a homology of more than 90% with the nucleotide sequence of SEQ ID NO: 1 and encoding an amino acid as shown in SEQ ID NO: 2; The said plant is oat or Arabidopsis thaliana.

2. Application of a protein in improving plant drought tolerance, characterized in that, The amino acid sequence of the said protein is as shown in SEQ ID NO: 2; The said plant is oat or Arabidopsis thaliana.

3. Application of a biological material related to the gene described in claim 1 or the protein described in claim 2 in improving plant drought tolerance, characterized in that, The said biological material is any one of the following: A: a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO: 1; B: an expression cassette containing the nucleic acid molecule described in A; C: an expression vector containing the nucleic acid molecule described in A, or a recombinant vector containing the expression cassette described in B; D: a recombinant microorganism containing the nucleic acid molecule described in A, or a recombinant microorganism containing the expression cassette described in B, or a recombinant microorganism containing the recombinant vector described in C; The said plant is oat or Arabidopsis thaliana.

4. The application according to any one of claims 1 to 3, characterized in that, The said improvement of plant drought tolerance is to improve the germination rate of seeds of plants under drought stress; The said plant is oat or Arabidopsis thaliana.

5. A method for cultivating a transgenic plant resistant to drought stress, characterized in that, Transfer the AsNADP-ME 1 gene into plant tissues or plant cells; The said plant is oat or Arabidopsis thaliana; The nucleotide sequence of the said AsNADP-ME 1 gene is as shown in SEQ ID NO: 1.

Citation Information

Patent Citations

  • Application of CsNADP-ME4 in improving drought sensitivity of cucumber

    CN117683808A