Methods for identifying the functions of genes related to the release of dormancy from peony flower buds and the application of gene PsmiR172b

Abstract

The invention discloses a method for identifying the function of dormancy release-related genes in peony flower buds and the application of gene PsmiR172b, belonging to the field of plant genetic engineering technology. The method transforms Agrobacterium EHA105 by constructing a target gene VIGS vector, disinfects the peony flower buds, infects the peony flower buds with Agrobacterium, co-cultivates for 3 days under 8°C dark conditions on a 1 / 2MS+100mM acetosyringone medium, transfers to a 1 / 2MS+200mg / mL timentin medium for light culture, and detects the target gene expression and flower bud growth state after 5 days. The invention creatively combines tissue culture with VIGS, and identifies dormancy release-related genes according to the change in the relative growth amount of flower buds after silencing the target gene, avoids the problems of difficult regeneration of peony tissue culture, long childhood, and inability to directly infect in a dormant state, and realizes the rapid identification of dormancy release-related genes.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and relates to a method for identifying the function of genes related to the release of dormancy in peony flower buds and gene application. Background Art

[0002] Peony (Paeonia suffruticosa Andr.) is a unique and precious flower native to China. It is also an important oil and medicinal plant and occupies an important position in the flower industry. Whether it is cultivated for ornamental or oil use, flowering is the guarantee for realizing its economic value, and the release of internal dormancy is the prerequisite for ensuring smooth flowering. Flowering during the Spring Festival is one of the main contents of the peony industry, and the early release of flower bud dormancy is one of the core processes of flower production. The regulation mechanism of flower bud internal dormancy is the theoretical basis for artificially regulating peony flowering. Researchers have discovered a large number of genes related to dormancy regulation using omics and molecular biology techniques. However, how to study the functions of these genes from a genetic perspective and prove that they regulate the internal dormancy of peony flower buds has become a difficult problem that researchers have to face. Peony tissue culture regeneration is difficult, and the juvenile period is as long as 3-5 years, making it difficult to achieve traditional gene function research methods. To this end, it is urgent to avoid the limitations of difficult regeneration and long juvenile period and establish an effective genetic transformation technology to identify the functions of dormancy release-related genes. The identified genes that promote dormancy release can provide candidate genes for molecular breeding of flowering period, establish corresponding breeding theories, and deepen the understanding of the dormancy regulation mechanism in plants.

[0003] Peony flower buds are mixed buds. From late September to mid-October, morphological differentiation is basically completed and they enter a dormant state with well-developed scales. Under natural conditions, dormancy is released after low temperature in winter, and flower buds sprout in the spring of the second year to form branches and flowers. Peony flower buds are widely used in the study of in vitro rapid propagation and the expansion of precious and rare varieties. In addition, root sucker buds, scale buds, axillary buds, and terminal buds are also used as materials for in vitro rapid propagation, but there are no reports on their use for gene transformation. Researchers have done a lot of work on the genetic transformation system of peony. Seed embryos, cotyledons, and leaves have all been tried as explants for genetic transformation, but progress is still slow. As the organ where peony dormancy occurs, flower buds urgently need to be used as receptors to establish an efficient transgenic system for studying dormancy regulation, identify the functions of candidate genes for dormancy regulation, provide sufficient evidence for identifying dormancy regulatory genes and analyzing regulatory mechanisms, provide candidate genes for molecular breeding of flowering period, and also provide reference for the identification of gene functions for dormancy regulation in other woody plants.

[0004] Virus-induced gene silencing (VIGS) is a post-transcriptional gene silencing phenomenon that has developed in recent years. It leads to the silencing of target genes through sequence-specific degradation of endogenous mRNA. VIGS has been widely used. Flowers, seedlings, leaves, etc. are often used as materials for infection. After infection, the materials are processed by vase insertion or planting to study gene function. However, in autumn, peonies will form buds, shed leaves, and enter a dormant state. This dormancy is for buds, that is, dormancy within the buds. Only after a certain period of low temperature or dormancy-releasing agents are treated can the buds germinate and bloom. As a dormant organ, peony buds are covered with thick scales and cannot be directly infected. How to ensure the success rate of infection and how to ensure their normal growth after infection are both difficult problems that need to be solved. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a transgenic method for identifying the function of genes related to peony flower bud dormancy release, wherein the method can identify whether the gene is related to peony flower bud dormancy so as to be subsequently used for releasing peony flower bud dormancy.

[0006] The present invention is achieved through the following technical solutions:

[0007] A transgenic method for identifying the function of a gene related to the release of dormancy in peony flower buds, comprising the steps of constructing a target gene VIGS vector to transform Agrobacterium EHA105, disinfecting the peony flower buds, infecting the peony flower buds with Agrobacterium, co-culturing the peony flower buds on a 1 / 2MS+100mM acetosyringone medium under 8°C dark conditions for 3 days, transferring the peony flower buds to a 1 / 2MS+200mg / mL timentin medium for light culture, detecting the target gene expression after 5 days, and determining that the silencing efficiency is ≥60%. The silencing efficiency is the percentage of buds with a silencing efficiency of ≥50%, indicating that the experiment is successful, and further identifying the gene as The growth status of flower buds was analyzed 10 days after infection. The growth status of flower buds was measured according to the ratio of the growth increment of the treatment group to the growth increment of the control group. If the ratio was greater than 1.5 or less than 0.67 and the difference was statistically significant (p<0.05), the gene was related to dormancy release. The expression level of dormancy release genes (DRGs, such as PsAP2, PsCYCD, PsEBB1, PsEBB3, PsBG6, etc.) was detected by quantitative PCR. If the expression level of DRGs gene after silencing the target gene was significantly higher or lower than that of the control group, the gene was related to dormancy release.

[0008] Furthermore, the gene VIGS vector is constructed by designing primers, amplifying the coding sequence or precursor sequence of the target gene, and inserting it into the TRV2 vector.

[0009] Further, peel off the outer 1-2 layers of bud scales of the peony flower buds, rinse with tap water for 40-60 minutes; soak in a detergent solution for 10 minutes; rinse off the detergent with running water for further disinfection; and remove residual sterilizing agent.

[0010] Furthermore, the method of infecting peony flower buds with Agrobacterium is as follows: the treated peony flower buds are placed in an infection solution, and the peony flower buds are sucked and infected with a vacuum pump. When the pressure is as low as 0.7 atmospheres, the pressure is maintained for 5 minutes and then the air is slowly released.

[0011] The present invention also provides application of the gene PsmiR172b in releasing the internal dormancy of peony flower buds.

[0012] The beneficial effects of the present invention compared with the prior art are as follows:

[0013] There is no effective method for identifying dormancy regulatory genes in peony. In the dormant state, the aboveground part only has highly lignified branches and dormant buds, and the buds are covered with 1-2 layers of scales, which are difficult to infect and difficult to culture. The present invention creatively combines tissue culture and VIGS, and identifies dormancy release-related genes based on the change in the relative growth of flower buds after silencing the target gene, avoiding the problems of difficult regeneration of peony tissue culture, long juvenile period, and inability to directly infect in the dormant state, and realizes the rapid identification of dormancy release-related genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Real-time quantitative PCR analysis of PsmiR172b gene silencing effect on November 15;

[0015] Figure 2 The expression changes of dormancy-release-related genes after silencing PsmiR172b;

[0016] Figure 3 Flower bud growth after silencing PsmiR172b;

[0017] Figure 4 The morphology of flower buds after 28 days of culture. DETAILED DESCRIPTION

[0018] The technical solution of the present invention is further explained below by comparing with the embodiments, but the protection scope of the present invention is not limited in any form by the embodiments.

[0019] Example 1

[0020] This example uses the method of the present invention to verify the function of the peony gene PsmiR172b in peony flower bud dormancy. The peony variety used is the widely cultivated Central Plains peony variety 'Luhehong' (Paeonia suffruticosa Andr. 'Luhehong'), planted in the variety resource garden of Qingdao Agricultural University.

[0021] The vectors used were TRV1 and TRV2.

[0022] LB solid medium composition and final concentration: (peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 1.5%, pH = 7.0, LB liquid medium without agar);

[0023] YEB medium composition and final concentration: (beef extract 5 g / L, yeast extract 1 g / L, peptone 5 g / L, sucrose 5 g / L, MgSO·H2O 0.5 g / L, pH 7.0);

[0024] 1 / 2MS medium composition and final concentration: (NH4NO3 825mg / L, KNO3 950mg / L, CaCl2·2H2O 220mg / L, MgSO4·7H2O185mg / L, KH2PO4 85mg / L, KI 0.83mg / L, H3BO3 6.2mg / L, MnSO4·H2O 16.9mg / L, ZnSO4·7H2O 8.6mg / L, Na2MoO4·2H2O 0.25mg / L, CuSO4·5H2O 0.025mg / L, CoCl2·6H2O0.025mg / L, FeSO4·7H2O 27.8mg / L, Na2-EDTA 37.3mg / L, inositol 100mg / L, niacin 0.5mg / L, thiamine hydrochloride 0.1mg / L, pyridoxine hydrochloride 0.5mg / L, glycine 2mg / L, sucrose 30g / L, agar 7g / L, pH 5.8-6.0).

[0025] The sequence of Pre-PsmiR172b is as follows:

[0026] CAUCCACAAACUUUACGUUUUAACCACUAGUAAAAGGCCACAUCAUCAUAUGCUGGUGUUACUGAGUAUGAAUGGGUACUUUUGGCAUUAAUGGAGGACGGUUGUUGUUUGCUGG UGUAGCACCAUCAAGAUUCACAUGAGAAUUUUUGCCAGCUCCGGUGGAAAUGACCCUAGAUCUACCAAUGUCUUGAACGUGAGAAUCUUGAUGAUGCUGCAUUGGCAAUAAACAA

[0027] 1. Gene cloning and vector construction

[0028] RNA was extracted from peony flower buds using the CTAB method. cDNA was synthesized using the TaKaRa PrimeScript TM RT reagent Kit with gDNA Eraser (Perfect Real Time) was used as described in the kit instructions. Primers were designed based on the Pre-PsmiR172b sequence (software CE Design V1.04). The primer sequence (F:gtgagtaaggttacc gaattc catccacaaactttacgttttaacca, R:cgtgagctcggtacc ggatcc ttgtttattgccaatgcagca), amplify the target sequence, and construct the PsmiR172b-TRV2 expression vector. TRV2 was linearized using EcoR I and BamH I, and the amplified band was II Recombination reaction ( II One Step Cloning Kit) to obtain recombinant plasmid DNA, and sequencing confirmed that the inserted fragment was Pre-PsmiR172b.

[0029] 2. Transformation of Recombinant Plasmid into Agrobacterium and Culture

[0030] Place the competent cells of Agrobacterium tumefaciens EHA105 on ice to slowly thaw in advance. Add 10 μL of recombinant plasmid DNA to 200 μL competent cells, mix gently with a gun, place in an ice bath for 30 minutes, then freeze in liquid nitrogen for 1 minute, then place in a 42°C water bath for 2 minutes, and then place in an ice bath for 2 minutes. Add 800 μL of YEB liquid medium and shake and culture at 100 rpm for 4 hours at 28°C. Centrifuge at 4 000 rpm for 10 minutes at room temperature to concentrate the bacterial solution, discard the supernatant, and use 100 μL of YEB liquid medium to lyse the bacteria. Spread 100 μL of bacterial solution evenly on the YEB+50mg / L Kan+50mg / L Rif plate, place in an incubator and culture upside down at 28°C for 2-3 days. Identify the correct recombinant clone and shake the bacteria for transformation.

[0031] Activation: EHA105 carrying TRV1 and TRV2 empty vectors and PsmiR172b-TRV2 was activated on LB solid medium (50 mg / L Kan+Rif).

[0032] Shake the cells: Pick a single colony and place it in a 50 mL tube containing 10 mL LB liquid medium and Kan + Rif antibiotics. Shake the cells overnight at 200 rpm and 28°C.

[0033] Propagation: After the bacterial solution PCR test is correct, dilute it 1:50 or 1:100 into 100mL LB (500mL Erlenmeyer flask) containing Kan+Rif antibiotics, and shake the bacteria at 200rpm and 28℃ overnight.

[0034] Collect bacteria: centrifuge at 5000 rpm for 10 min to remove the supernatant. After the bacteria are precipitated, resuspend them in infection buffer (10 mM MgCl2, 10 mM MES and 100 mM acetosyringone, pH = 5.6) to adjust OD600≈1.0. After standing at 25°C for 3 hours, use them immediately for infection.

[0035] 3. Preparation of Peony Flower Buds (Sterilization)

[0036] From November to January, select strong, plump and firm medium-sized peony top flower buds from dormant peony plants as materials and carefully break them off from the plants;

[0037] Peel off the outer 1-2 layers of bud scales, rinse with tap water for 40-60 minutes; soak in a detergent solution for 10 minutes; the detergent solution is prepared by adding one drop of detergent to 100 mL of water; rinse with running water for 15 minutes, and transfer to a clean bench for further disinfection; disinfect with 75% alcohol for 20 seconds, rinse with sterile distilled water once; disinfect with 0.1% mercuric chloride for 6-8 minutes, rinse with sterile distilled water 4-5 times to remove residual sterilant;

[0038] 4. Infection of flower buds

[0039] On the clean bench, place the peony flower buds processed in step 2 into the infecting solution, and use a vacuum pump to suck the infection out of the peony flower buds. When the pressure drops to 0.7 atmospheres, keep it for 5 minutes and then slowly release the air.

[0040] V. Co-culture after infection

[0041] After the infection treatment was completed, the flower buds were washed 2 to 3 times with distilled water, inserted into the co-cultivation medium (1 / 2MS + 100 mM acetosyringone), and cultured in the dark at 8°C for 3 days.

[0042] After dark culture, the flower buds were transferred from the co-culture medium to the growth medium (1 / 2MS + Timentin) for light culture (25°C, 16h / 8h). RNA was extracted after 5 days and the expression level was detected by qRT-PCR. The growth status of the flower buds was observed after 10 days.

[0043] 6. Gene Expression Analysis and Phenotypic Identification

[0044] Transferred to the growth medium, the expression of PsmiR172b gene in the flower buds of TRV1+PsmiR172b-TRV2 was detected after 5 days, and the flower buds of TRV1+TRV2 (empty vector) were used as the control. The silencing efficiency was calculated by (1-PsmiR172b-TRV2 / TRV2). Primer primier 5.0 and DNAMAN were used for qRT-PCR primer design, and the primer sequences are shown in Table 1.

[0045] (1) Preparation of cDNA template

[0046] After 5 days of growth and cultivation, flower bud RNA was extracted and reverse transcribed. The cDNA template after reverse transcription was diluted 2.5 times as the template for qRT-PCR reaction. Three technical replicates were set, Tubin was used as the internal reference, and 2 -△△Ct The relative expression was calculated by the method.

[0047] (2) Reaction system and reaction conditions

[0048] The general qRT-PCR system is 20 μL, including SYBR Premix Ex TaqⅡ10 μL, PCR forward primer (10 μM) 0.8 μL, PCR reverse primer (10 μM) 0.8 μL and ddH2O 6.4 μL, cDNA 2 μL, ROX II Dye (50×) 0.4 μL. Reaction conditions: Denaturation: 95℃10sec, qPCR×40Cycles: 95℃30sec; 55℃30sec; 72℃30sec, Dissociation Curve: 95℃60sec; 55℃30sec; 95℃30sec.

[0049] Table 1 Primer sequence information used in the present invention

[0050]

[0051] A total of 30 flower buds were tested for silencing efficiency, ranging from 11.5% to 69.3%. The percentage of silencing efficiency ≥ 50% was taken as the effective rate, and the effective rates of the three experiments were all above 60%, as shown in Table 2. Figure 1 As shown, this method has a high success rate and good repeatability, and can be used for the identification and functional analysis of dormancy release-related genes.

[0052] Table 2 Statistics of gene silencing efficiency

[0053]

[0054] Real-time quantitative PCR was used to analyze the expression of dormancy release-related genes, such as Figure 2As shown in the results, it was found that silencing PsmiR172b significantly increased the expression of genes such as AP2, CYCD, EBB1, EBB3, and BG6, further proving that PsmiR172b is a negative regulator of dormancy release.

[0055] (3) The growth of the transformed flower buds was observed. Figure 3 and Figure 4 As shown in the figure, after 14 days of growth and cultivation, the flower buds of the control group slightly elongated, but the leaflets did not stretch, while the leaflets of the flower buds of the silencing PsmiR172b group had stretched significantly, with the height growth being 3.10 times that of the control group, and the diameter growth being 1.51 times that of the control group; after 28 days, the leaflets of the flower buds of the control group still did not stretch significantly, with the height growth being 4.39 times that of the control group, and the diameter growth being 3.74 times that of the control group. It can be seen that silencing PsmiR172b can promote the release of dormancy of peony flower buds and accelerate their growth.

Claims

1. Application of gene PsmiR172b in relieving internal dormancy of peony flower buds, characterized in that: The application is to release the internal dormancy of peony flower buds by silencing the PsmiR172b gene, and the nucleotide sequence of the Pre-PsmiR172b gene is shown in SEQ ID NO.1.

Images