A real-time fluorescence nucleic acid isothermal amplification detection kit for simultaneously detecting six kinds of Candida, and its special primers and probes
Through the combination of real-time fluorescent nucleic acid constant temperature amplification technology and specific capture probes, the problems of low sensitivity and high contamination risk in the detection of Candida and Trichomonas vaginalis in the prior art are solved, and the simultaneous detection of six types of Candida and Trichomonas vaginalis are achieved with high efficiency and low pollution.
Patent Information
- Application Number
- CN202310045595.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-30
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2043-01-30
AI Technical Summary
In the prior art, when detecting Candida and Trichomonas vaginalis, there is a problem of low sensitivity, long time-consuming, easy to cause cross-contamination of samples and environmental pollution, and it is difficult to detect six types of Candida and Trichomonas vaginalis at the same time.
Real-time fluorescent nucleic acid constant temperature amplification technology is used, and a specific capture probe and primer probe combination is combined with SAT enzyme solution to achieve simultaneous detection of six Candida and Trichomonas vaginalis, avoiding temperature circulation and PCR reactions, and the amplification product is easy to degrade RNA and reduces the risk of contamination.
It realizes simultaneous detection of six high-sensitivity Candida and Trichomonas vaginalis, shortens detection time, reduces operational complexity and environmental pollution risks, and is suitable for automated applications.
Smart Images

Figure CN116042902B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedical detection technology, and specifically relates to a real-time fluorescent nucleic acid isothermal amplification detection kit for simultaneously detecting six species of Candida fungi and Trichomonas vaginalis and its special primers and probes, and more particularly to primers, probes and related kits used in real-time fluorescent nucleic acid isothermal amplification detection of Candida fungi and Trichomonas vaginalis using a combination of specific target capture technology and real-time fluorescent nucleic acid isothermal amplification detection technology (Simultaneous Amplification and Test, SAT) to detect Trichomonas vaginalis. Background Art
[0002] Vaginitis, or inflammation of the vagina, is a group of conditions that cause vulvovaginal symptoms such as itching, burning, irritation, and abnormal discharge. Common clinical conditions include bacterial vaginosis (22% to 50% of women with symptoms), candidal vaginitis (17% to 39%), trichomonas vaginitis (4% to 35%), senile vaginitis, and juvenile vaginitis.
[0003] Candidal vaginitis is caused by infection with Candida (also known as Candida spp., VVC). Among Candida species, Candida albicans is the most common pathogen, accounting for approximately 85% to 95% of cases. Among infections caused by non-albicans Candida, Candida glabrata and Candida tropicalis are the most common. Other infections include Candida krusei, Candida parapsilosis, and Candida dubliniemis, which primarily occur in immunocompromised women. In recent years, with the widespread use of antibiotics, the spectrum of pathogens causing candidal vaginitis has shifted. Cases of non-albicans Candida vaginitis have gradually increased, and the disease is resistant to traditional treatments. Candida glabrata and Candida krusei are the most resistant. Therefore, targeted detection of Candida, especially Candida glabrata and Candida krusei among Candida species, has important epidemiological and clinical therapeutic significance.
[0004] Trichomonas vaginitis is caused by infection with Trichomonas vaginalis (TV), a parasite that is invisible to the naked eye. These trichomonas are broadly pear-shaped or oval, 10 to 30 μm long and 10 to 20 μm wide, with four flagella on their heads, each the same length as the body. TV is found worldwide, with an estimated 180 million women infected annually. Therefore, targeted testing for T. vaginalis has important epidemiological and clinical implications.
[0005] Currently, the methods for detecting pathogenic Candida and Trichomonas vaginalis are mainly molecular biological methods, mainly including DNA probe hybridization technology and PCR technology. For example, patent document CN101638688A (hereinafter referred to as document 1) discloses a special probe for identifying pathogenic Candida (including Candida albicans, Candida glabrata, Candida krusei, Candida parapsilosis, Candida dubliniensis, and Candida tropicalis). The probe uses a pair of universal primers for Candida to perform PCR amplification, and uses DNA probes specific for each Candida species for hybridization. The presence of each Candida species is determined based on the hybridization results. Another example is patent document CN110551840A (hereinafter referred to as document 2) discloses a nucleic acid reagent for detecting invasive fungi, which includes A tube, B tube and C tube, wherein A tube contains a pair of universal primers for four kinds of Candida (Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis) and fluorescent labeling probes respectively for these four kinds of Candida, which can detect above four kinds of Candida simultaneously. Another example is patent document CN109971883A (hereinafter referred to as document 3) discloses a primer-probe combination for Candida species detection, which includes PCR amplification primers and detection probes respectively for Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis and Candida krusei, which can detect and determine whether there is one or more of the above five kinds of Candida infections. However, what above-mentioned document 1 adopts is the principle of DNA probe hybridization, and although multiple Candida can be detected and distinguished, its sensitivity is generally poor, and it takes a long time, and the required time is usually about 6 hours, and efficiency is relatively low. Furthermore, the methods disclosed in Documents 1-3 are all based on the fundamental principles of PCR, which requires temperature fluctuations and cycles during the PCR reaction. Consequently, the required detection time is also long (typically 2-3 hours), resulting in low efficiency. Furthermore, the PCR reaction product is DNA, which is not easily degraded, easily leading to cross-contamination of samples and contamination of the experimental environment. Furthermore, Documents 2-3 can only detect four or five Candida species simultaneously, not six, and certainly not all six Candida species and Trichomonas vaginalis.
[0006] Although there is a method for detecting Candida and Trichomonas vaginalis simultaneously in the art, for example, patent document US20210332421A1 (hereinafter referred to as document 4) discloses a method and composition for multiple detection of Candida species (including Candida glabrata, Candida albicans, Candida tropicalis, Candida dubliniensis, Candida parapsilosis, Candida krusei) and Trichomonas vaginalis, which includes primers and probes for detecting Candida glabrata, universal primers and probes for detecting four kinds of Candida (Candida albicans, Candida tropicalis, Candida dubliniensis and Candida parapsilosis), primers and probes for detecting Candida krusei and primers and probes for detecting Trichomonas vaginalis, it is possible to detect these Candida and Trichomonas vaginalis simultaneously. However, the method disclosed in the document 4 is still based on the basic principle of PCR, and there are still defects in low efficiency and easy to cause cross contamination of samples and pollution of experimental environment. Summary of the Invention
[0007] In response to one or more problems existing in the prior art, one aspect of the present invention provides a real-time fluorescent nucleic acid isothermal amplification detection kit for simultaneously detecting six species of Candida, named the first kit, which comprises:
[0008] (T1) a nucleic acid extract comprising a solid support containing a first specific capture probe, a second specific capture probe, and a third specific capture probe, wherein the first specific capture probe is used to capture a detection sequence of Candida albicans, Candida tropicalis, Candida parapsilosis, and / or Candida dubliniensis (these four Candida species are collectively referred to as Cspp), the second specific capture probe is used to capture a detection sequence of Candida glabrata, and the third specific capture probe is used to capture a detection sequence of Candida krusei;
[0009] (T2) Detection solution: comprising a first primer, a second primer, a first target detection probe, a third primer, a fourth primer, a second target detection probe, a fifth primer, a sixth primer, and a third target detection probe; wherein the first primer, the second primer, and the first target detection probe are used in combination to detect the target sequence of Cspp; the third primer, the fourth primer, and the second target detection probe are used in combination to detect the target sequence of Candida glabrata; the fifth primer, the sixth primer, and the third target detection probe are used in combination to detect the target sequence of Candida krusei; the first target detection probe, the second target detection probe, and the third target detection probe carry a fluorescent reporter group and a quencher group at both ends of the nucleotide sequence, respectively, and the fluorescent reporter groups carried by the three are different;
[0010] (T3) SAT enzyme solution: comprising at least one RNA polymerase and M-MLV reverse transcriptase;
[0011] in:
[0012] The first specific capture probe comprises the nucleotide sequence shown in SEQ ID NO: 17, the second specific capture probe comprises the nucleotide sequence shown in SEQ ID NO: 18, and the third specific capture probe comprises the nucleotide sequence shown in SEQ ID NO: 19;
[0013] The first primer comprises the nucleotide sequence shown in SEQ ID NO: 1, the second primer comprises the nucleotide sequence shown in SEQ ID NO: 9, and the first target detection probe comprises the nucleotide sequence shown in SEQ ID NO: 21;
[0014] The third primer comprises the nucleotide sequence shown in SEQ ID NO: 3, the fourth primer comprises the nucleotide sequence shown in SEQ ID NO: 11, and the second target detection probe comprises the nucleotide sequence shown in SEQ ID NO: 23;
[0015] The fifth primer comprises the nucleotide sequence shown in SEQ ID NO: 5, the sixth primer comprises the nucleotide sequence shown in SEQ ID NO: 13, and the third target detection probe comprises the nucleotide sequence shown in SEQ ID NO: 25.
[0016] Another aspect of the present invention provides a real-time fluorescent nucleic acid isothermal amplification detection kit for simultaneously detecting six species of Candida and Trichomonas vaginalis, which is named the second kit and further includes:
[0017] (a) a fourth specific capture probe: present in the nucleic acid extract, used to capture the detection sequence of Trichomonas vaginalis, and the fourth specific capture probe comprises the nucleotide sequence shown in SEQ ID NO: 20;
[0018] (b) A seventh primer, an eighth primer and a fourth target detection probe: The three are present in the detection solution and are used in conjunction with the target sequence for detecting Trichomonas vaginalis, wherein the seventh primer comprises a nucleotide sequence as shown in SEQ ID NO: 7, the eighth primer comprises a nucleotide sequence as shown in SEQ ID NO: 15, and the fourth target detection probe comprises a nucleotide sequence as shown in SEQ ID NO: 27, and a fluorescent reporter group and a quencher group are respectively carried at both ends of the nucleotide sequence of the fourth target detection probe, and the fluorescent reporter group carried is different from the fluorescent reporter groups carried by the first, second and third target detection probes.
[0019] In some embodiments, the kit further comprises:
[0020] (M1) washing solution: containing NaCl and SDS; preferably 5-50 mM HEPES, 50-500 mM NaCl, 0.5-1.5% SDS, 1-10 mM EDTA; and / or
[0021] (M2) mineral oil; and / or
[0022] (M3) Positive control: a system containing nucleic acid from Cspp, Candida glabrata, or Candida krusei, or further containing nucleic acid from Trichomonas vaginalis; and / or
[0023] (M4) Negative control: a system that does not contain nucleic acids from Cspp, Candida glabrata, or Candida krusei, or further does not contain nucleic acids from Trichomonas vaginalis.
[0024] In some embodiments, the components of the nucleic acid extract include: 250-800mM HEPES, 4-10% LLS (lithium dodecyl sulfate), 1-50μM of a first specific capture probe, 1-50μM of a second specific capture probe, 1-50μM of a third specific capture probe, and 50-500mg / L magnetic beads; optionally, the components of the nucleic acid extract also include 1-50μM of a fourth specific capture probe.
[0025] In some embodiments, the components of the detection solution include: 10-50mM Tris, 5-40mM KCl, 10-40mM MgCl2, 1-20mM NTP, 0.1-10mM dNTPs, 1-10% PVP40, 250-750 pmol / mL of a first primer, 250-750 pmol / mL of a second primer, 250-750 pmol / mL of a third primer, 250-750 pmol / mL of a fourth primer, 250-750 pmol / mL of a fifth primer, 250-750 pmol / mL of a sixth primer, 250-750 pmol / mL of a first target detection probe, 250-750 pmol / mL of a second target detection probe, and 250-750 pmol / mL of a third target detection probe; optionally, the components of the detection solution also include 250-750 pmol / mL of a seventh primer, 250-750 pmol / mL of an eighth primer, and 250-750 pmol / mL of a fourth target detection probe.
[0026] In some embodiments, the components of the SAT enzyme solution include: 16000-160000 U / mL of M-MLV reverse transcriptase, 8000-80000 U / mL of RNA polymerase, 2-10 mM HEPES pH 7.5, 10-100 mM N-acetyl-L-cysteine, 0.04-0.4 mM zinc acetate, 10-100 mM trehalose, 40-200 mM Tris-HCl pH 8.0, 40-200 mM KCl, 0.01-0.5 mM EDTA, 0.1-1% (v / v) Triton X-100 and 20-50% (v / v) glycerol.
[0027] In another aspect, the present invention provides a primer and probe combination for simultaneous detection of six species of Candida by real-time fluorescent nucleic acid isothermal amplification, designated as the first combination, comprising:
[0028] (i) Primers and probes for detecting Candida albicans, Candida tropicalis, Candida parapsilosis and / or Candida dubliniensis, comprising: a first specific capture probe comprising the nucleotide sequence shown in SEQ ID NO: 17, a first primer comprising the nucleotide sequence shown in SEQ ID NO: 1, a second primer comprising the nucleotide sequence shown in SEQ ID NO: 9, and a first target detection probe comprising the nucleotide sequence shown in SEQ ID NO: 21;
[0029] (ii) primers and probes for detecting Candida glabrata, comprising: a second specific capture probe comprising the nucleotide sequence shown in SEQ ID NO: 18, a third primer comprising the nucleotide sequence shown in SEQ ID NO: 3, a fourth primer comprising the nucleotide sequence shown in SEQ ID NO: 11, and a second target detection probe comprising the nucleotide sequence shown in SEQ ID NO: 23;
[0030] (iii) primers and probes for detecting Candida krusei, comprising: a third specific capture probe comprising the nucleotide sequence shown in SEQ ID NO: 19, a fifth primer comprising the nucleotide sequence shown in SEQ ID NO: 5, a sixth primer comprising the nucleotide sequence shown in SEQ ID NO: 13, and a third target detection probe comprising the nucleotide sequence shown in SEQ ID NO: 25;
[0031] The first target detection probe, the second target detection probe, and the third target detection probe respectively carry a fluorescent reporter group and a quencher group at both ends of their nucleotide sequences, and the fluorescent reporter groups carried by the three are different.
[0032] In another aspect, the present invention provides a primer and probe combination for simultaneous detection of six species of Candida and Trichomonas vaginalis by real-time fluorescent nucleic acid isothermal amplification, designated as a second combination, which, in addition to the first combination, further comprises:
[0033] (iv) Primers and probes for detecting Trichomonas vaginalis, comprising: a third specific capture probe comprising a nucleotide sequence as shown in SEQ ID NO: 20, a seventh primer comprising a nucleotide sequence as shown in SEQ ID NO: 7, an eighth primer comprising a nucleotide sequence as shown in SEQ ID NO: 15, and a fourth target detection probe comprising a nucleotide sequence as shown in SEQ ID NO: 27; wherein the nucleotide sequence of the fourth target detection probe carries a fluorescent reporter group and a quencher group at both ends, respectively, and the fluorescent reporter group carried is different from the fluorescent reporter groups carried by the first, second, and third target detection probes.
[0034] In another aspect, the present invention provides a non-disease diagnostic method for simultaneously detecting six species of Candida species, designated as the first method, comprising the following steps:
[0035] 1) Adding nucleic acid extraction solution to the sample to be tested to extract nucleic acid and obtain an analytical test sample;
[0036] 2) adding a detection solution to the analysis and detection sample to perform a first step reaction to obtain a first step reaction solution;
[0037] 3) adding SAT enzyme solution to the first step reaction solution to carry out the second step reaction, and performing real-time fluorescence detection to obtain the dt value of real-time fluorescence detection;
[0038] 4) Determine the result based on the dt value of the real-time fluorescence detection obtained in step 3):
[0039] If an "S"-shaped amplification curve appears in the channel corresponding to the first target detection probe, and dt≤35, the sample to be tested contains Cspp nucleic acid, that is, it contains one or more of Candida albicans, Candida tropicalis, Candida parapsilosis, and Candida dubliniensis nucleic acids; if no "S"-shaped amplification curve appears, or an "S"-shaped amplification curve appears but dt>35, the sample to be tested does not contain Cspp nucleic acid;
[0040] If an "S"-shaped amplification curve appears in the channel corresponding to the second target detection probe, and dt≤35, then the sample to be tested contains Candida glabrata nucleic acid; if no "S"-shaped amplification curve appears, or if an "S"-shaped amplification curve appears but dt>35, then the sample to be tested does not contain Candida glabrata nucleic acid;
[0041] If an "S"-shaped amplification curve appears in the channel corresponding to the third target detection probe and dt≤35, the sample to be tested contains Candida krusei nucleic acid; if no "S"-shaped amplification curve appears, or an "S"-shaped amplification curve appears but dt>35, the sample to be tested does not contain Candida krusei nucleic acid.
[0042] Another aspect of the present invention provides a non-disease diagnostic method for simultaneously detecting six species of Candida and Trichomonas vaginalis, which, based on the above-mentioned first method, also includes the following judgment criteria: if the channel corresponding to the fourth target detection probe shows an "S"-shaped amplification curve and dt≤35, then the sample to be tested contains Trichomonas vaginalis nucleic acid; if no "S"-shaped amplification curve appears, or if an "S"-shaped amplification curve appears but dt>35, then the sample to be tested does not contain Trichomonas vaginalis nucleic acid.
[0043] In some embodiments, the first reaction in step 2) is carried out at 40° C.-45° C. for 3-15 minutes.
[0044] In some embodiments, the SAT enzyme solution in step 3) is preheated before use, and the preheating temperature is 41-43°C.
[0045] In some embodiments, the second step reaction in step 3) is carried out at 41° C.-43° C. for 30-50 min.
[0046] In some embodiments, the samples to be tested include medical samples and non-medical samples whose sources include sputum, blood products, and dairy products.
[0047] The dedicated primers and probes for real-time fluorescent nucleic acid isothermal amplification detection for simultaneous detection of six Candida species provided based on the above technical solution are optimized based on Candida ribonuclease P RNA (RNAseP RNA), and the dedicated primers and probes for real-time fluorescent nucleic acid isothermal amplification detection for simultaneous detection of six Candida species and Trichomonas vaginalis are optimized based on Candida ribonuclease P RNA (RNAseP RNA) and Trichomonas vaginalis 16S rRNA. The real-time fluorescent nucleic acid isothermal amplification detection kit provided based on the primers and probes includes a nucleic acid extract, a detection solution, a SAT enzyme solution, and the like. The nucleic acid extract may include a first specific capture probe commonly used for binding to detection sequences of Candida albicans, Candida tropicalis, Candida parapsilosis, and Candida dubliniensis (these four Candida species are collectively referred to as Cspp), a second specific capture probe for binding to a Candida glabrata detection sequence, a third specific capture probe for binding to a Candida krusei detection sequence, or further include a fourth specific capture probe for binding to a Trichomonas vaginalis detection sequence. The detection solution may include primers and probes for specific binding to Cspp target sequences, primers and probes for specific binding to Candida glabrata target sequences, primers and probes for specific binding to Candida krusei target sequences, or further include primers and probes for specific binding to Trichomonas vaginalis target sequences. The SAT enzyme solution contains the RNA polymerase and reverse transcriptase required for the reaction process. Based on the SAT constant-temperature amplification detection technology, all primers and probes are included in the same test solution during use, resulting in a relatively simple reaction system. This allows for the simultaneous detection of six Candida species, or six Candida species and Trichomonas vaginalis, and can distinguish between the highly drug-resistant Candida glabrata and Candida krusei. In addition to its use in the medical reproductive field for the detection of Candida and Trichomonas vaginalis, the present invention can also be used to detect Candida in wounds and skin, as well as for the detection of non-medical samples such as sputum, blood products, and dairy products, making it suitable for widespread deployment.
[0048] Compared with existing detection methods, the present invention has the following advantages:
[0049] (1) The primers and probes provided by the present invention are optimized and designed based on the RNAseP RNA of Candida albicans, or further based on the 16S rRNA of Trichomonas vaginalis. During the detection process, by combining the upstream and downstream primers and probes into a detection solution, it is possible to simultaneously detect six species of Candida albicans, or simultaneously detect six species of Candida albicans and Trichomonas vaginalis, and can distinguish between Candida glabrata and Candida krusei, which have high drug resistance.
[0050] (2) The present invention can achieve higher sensitivity detection by adding different components step by step during the detection process. The results of the examples show that the detection limit of the kit and method provided by the present invention for Candida albicans, Candida tropicalis, Candida parapsilosis, Candida dubliniensis, as well as Candida glabrata, Candida krusei and Trichomonas vaginalis is 100 copies / reaction, which is significantly lower than the detection limit (1000 copies / reaction) of the method disclosed in the above document 4 for the above six Candida species, or for the combination of the six Candida species and Trichomonas vaginalis. Therefore, the kit and method provided by the present invention can meet the requirements of higher sensitivity.
[0051] (3) The present invention uses real-time fluorescent nucleic acid constant temperature amplification detection technology to detect Candida, or the combination of Candida and Trichomonas vaginalis, avoiding the heating, centrifugation, in vitro reverse transcription and other operations for extracting RNA in the above-mentioned Documents 1 to 4. Its experimental steps and reaction system are simpler and easy to automate, reducing errors caused by human operation and reducing the risk of infection for operators.
[0052] (4) The present invention performs nucleic acid amplification and detection simultaneously in the same closed system. The entire process does not involve temperature fluctuations or cycles. Therefore, compared with the methods disclosed in Documents 1 to 4, the time required for detection is greatly shortened, which can improve detection efficiency and reduce the design and production costs of the PCR instrument used.
[0053] (5) The amplified product of the present invention is RNA, which is easily degraded in nature. Compared with the PCR amplification of DNA in the above-mentioned Documents 1 to 4, the contamination is easy to control, the cross-influence is small, and it will not cause environmental pollution. BRIEF DESCRIPTION OF THE DRAWINGS
[0054] Figure 1 The amplification curves of the primer and probe combinations of Group 1 (A), Group 2 (B), Group 3 (C), and Group 4 (D) in Example 1 for Candida albicans in Cspp.
[0055] Figure 2 The amplification curves of the primer and probe combinations of Group 1 (A), Group 2 (B), Group 3 (C) and Group 4 (D) in Example 1 for Candida tropicalis in Cspp.
[0056] Figure 3 The amplification curves of the primer and probe combinations of Group 1 (A), Group 2 (B), Group 3 (C) and Group 4 (D) in Example 1 for Candida parapsilosis in Cspp.
[0057] Figure 4 The amplification curves of the primer and probe combinations of Group 1 (A), Group 2 (B), Group 3 (C), and Group 4 (D) in Example 1 for Candida dubliniensis in Cspp.
[0058] Figure 5 The amplification curves of the primer and probe combinations of Group 1 (A), Group 2 (B), Group 3 (C), and Group 4 (D) in Example 1 for Candida glabrata, respectively;
[0059] Figure 6 The amplification curves of the primer and probe combinations of Group 1 (A), Group 2 (B), Group 3 (C), and Group 4 (D) in Example 1 for Krusei are shown respectively;
[0060] Figure 7 The amplification curves of Trichomonas vaginalis for the primer and probe combinations of Group 5 (A), Group 6 (B), Group 7 (C) and Group 8 (D) in Example 2 are shown;
[0061] Figure 8 These are the amplification curves of Cspp culture-1 (A), Cspp culture-2 (B), Candida glabrata culture (C), Candida krusei culture (D), and Trichomonas vaginalis culture (E) using the kit provided in Example 5 in Example 6. DETAILED DESCRIPTION
[0062] In response to the defects of the existing methods for detecting Candida and Trichomonas vaginalis, the present invention uses a nucleic acid constant-temperature synchronous amplification detection method to simultaneously detect six species of Candida, as well as six species of Candida and Trichomonas vaginalis. It also provides a nucleic acid constant-temperature simultaneous amplification detection kit for the combined detection of six species of Candida, and six species of Candida and Trichomonas vaginalis, as well as its dedicated primers and probes, and a detection method.
[0063] The present invention is described in detail below with reference to specific embodiments and accompanying drawings.
[0064] Hereinafter, only certain exemplary embodiments are briefly described. As will be appreciated by those skilled in the art, the described embodiments may be modified in various ways without departing from the spirit or scope of the present invention. Therefore, the drawings and description are to be considered as illustrative in nature and not restrictive.
[0065] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).
[0066] The methods for obtaining the various biological materials described in the examples merely provide experimental methods for achieving the disclosed objectives and should not be construed as limiting the sources of the biological materials used in the present invention. In fact, the sources of the biological materials used are diverse, and any legally and ethically accessible biological material may be substituted for and used as indicated in the examples.
[0067] All primers, capture probes, fluorescent probes and in vitro transcribed RNA products mentioned in the present invention are synthesized using existing technologies.
[0068] Example 1: Design of primers and probes for real-time fluorescent nucleic acid isothermal amplification to detect six species of Candida
[0069] The present inventors obtained the RNAseP RNA nucleic acid sequence of Candida albicans disclosed in the Genbank database (the Genbank accession number of the RNAseP RNA nucleic acid sequence of Candida albicans is: XR_002086389.1, the Genbank accession number of the RNAseP RNA nucleic acid sequence of Candida tropicalis is: DQ660439.1, the Genbank accession number of the RNAseP RNA nucleic acid sequence of Candida parapsilosis is: DQ660436.1, the Genbank accession number of the RNAseP RNA nucleic acid sequence of Candida dubliniensis is: DQ660438.1, the Genbank accession number of the RNAseP RNA nucleic acid sequence of Candida glabrata is: GQ251341.1, and the Genbank accession number of the RNAseP RNA nucleic acid sequence of Candida krusei is: DQ660435.1). The detection sequence is determined by starting with sequences on RNA that are highly conserved for Candida albicans, Candida tropicalis, Candida parapsilosis and Candida dubliniensis (these four Candida species are collectively referred to as Cspp), specific for Candida glabrata and Candida krusei respectively, and significantly different from other Candida species. Primers and probes are designed according to the principles of primer and probe design so that they can be effectively used in real-time fluorescent nucleic acid isothermal amplification detection of six Candida species at the same time.
[0070] In this embodiment, multiple sets of primers and probes were designed, of which the following four sets of primers and probes were selected (Set 1, Set 2, Set 3, and Set 4; the primer-probe combination for Cspp in each set could achieve a minimum detection limit of 10 copies / reaction when detecting Candida albicans, Candida tropicalis, Candida parapsilosis, and Candida dubliniensis separately; the primer-probe combination for Candida glabrata in each set could achieve a minimum detection limit of 10 copies / reaction when detecting Candida glabrata separately; the primer-probe combination for Candida krusei in each set could achieve a minimum detection limit of 10 copies / reaction when detecting Candida glabrata separately. Real-time fluorescent nucleic acid isothermal amplification detection was performed on a Candida positive control (described in detail below) and a negative control (a system that does not contain the six Candida target nucleic acid sequences or does not contain the six Candida species, such as deionized water or sample preservation solution (commercially available)) (for specific detection methods, see Example 3 below), from which primers and probe sets with good sensitivity for simultaneous detection of the six Candida species and differentiation between Candida glabrata and Candida krusei were screened.
[0071] Group 1:
[0072] First specific capture probe for Cspp:
[0073] TGGGAAATTCGGTGGTACGCTCCAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 17);
[0074] First primer for Cspp: ATGGGCGGCGTTACAAGAA (SEQ ID NO: 1);
[0075] Second primer for Cspp:
[0076] AATTTAATACGACTCACTATAGGGAGACATATTGCACTAAACAGC (SEQ ID NO: 9);
[0077] The first target detection probe for Cspp: CGCCUUGGAUGGUUGGCUGGCG (SEQ ID NO: 21);
[0078] The 5' end and 3' end of the first target detection probe are respectively labeled with a FAM fluorescent reporter group and a fluorescent quencher group (such as DABCYL, BHQ-1 or BHQ-2, etc.), the same below;
[0079] Second specific capture probe for Candida glabrata:
[0080] TTTTCCTCTTCACCTTTCTGCTTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A (SEQ ID NO: 18);
[0081] The third primer for Candida glabrata: GGGGAACCCGGCCGGTAAGATTA (SEQ ID NO: 3);
[0082] Fourth primer for Candida glabrata:
[0083] AATTTAATACGACTCACTATAGGGAGATAGACAGGCCCATACGTCTCT(SEQ IDNO:11);
[0084] Second target detection probe for Candida glabrata: CGACGUGCUGAAAUCUGUCGUCG (SEQ ID NO: 23);
[0085] The 5' and 3' ends of the second target detection probe are respectively labeled with a ROX fluorescent reporter group and a fluorescent quencher group (such as DABCYL, BHQ-1 or BHQ-2); and the quencher group labeled at the 3' end can be the same as or different from that of the first target detection probe, the same below.
[0086] The third specific capture probe for Candida krusei:
[0087] GGGGGGCGATGCGGAGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 19);
[0088] The fifth primer for Candida krusei: CTCCACTGGGAGTGTTCT (SEQ ID NO: 5);
[0089] The sixth primer for Candida krusei:
[0090] AATTTAATACGACTCACTATAGGGAGAAGGATCCACGCATTGCACTCAA(SEQ IDNO:13);
[0091] The third target detection probe for Candida glabrata: CGCCGUGCUUGUACAACUUUGGCG (SEQ ID NO: 25);
[0092] The 5' and 3' ends of the third target detection probe are respectively labeled with a CY5 fluorescent reporter group and a fluorescent quencher group (such as DABCYL, BHQ-1 or BHQ-2, etc.); and the quencher group labeled at the 3' end can be the same as or different from that of the first target detection probe or the second target detection probe, the same below.
[0093] Group 2:
[0094] a first specific capture probe for Cspp (SEQ ID NO: 17);
[0095] First primer-1 for Cspp: GCGCATGGGCGGCGTTACAA (SEQ ID NO: 2);
[0096] Second primer for Cspp-1:
[0097] AATTTAATACGACTCACTATAGGGAGAGTTCGCATATTGCACTAAA (SEQ ID NO: 10);
[0098] First target detection probe for Cspp-1: CGCACUAUGGGAAUGGCGUGCG (SEQ ID NO: 22);
[0099] The 5' end and 3' end of the first target detection probe-1 are respectively labeled with a FAM fluorescent reporter group and a fluorescent quencher group (such as DABCYL, BHQ-1 or BHQ-2);
[0100] a second specific capture probe for Candida glabrata (SEQ ID NO: 18);
[0101] The third primer-1 for Candida glabrata: ACCCGGCCGGTAAGATTAAGT (SEQ ID NO: 4);
[0102] The fourth primer for Candida glabrata-1:
[0103] AATTTAATACGACTCACTATAGGGAGATACGTCTCTGCCCTACCCTTATC(SEQ IDNO:12);
[0104] Second target detection probe-1 for Candida glabrata: CGAGCUAUCUGCUGAAAUCAGCUCG (SEQ ID NO: 24);
[0105] The 5' and 3' ends of the second target detection probe-1 are respectively labeled with a ROX fluorescent reporter group and a fluorescent quencher group (such as DABCYL, BHQ-1 or BHQ-2, etc.); and the quencher group labeled at the 3' end can be the same as or different from that of the first target detection probe-1, the same below.
[0106] a third specific capture probe for Candida krusei (SEQ ID NO: 19);
[0107] The fifth primer-1 for Candida krusei: TTCCCACGAATCCCGTCTCT (SEQ ID NO: 6);
[0108] The sixth primer for Candida krusei-1:
[0109] AATTTAATACGACTCACTATAGGGAGATCAAGATGACAAGGATCCACG (SEQ IDNO: 14);
[0110] The third target detection probe for Candida glabrata-1: CACCUUGCUUGUACAACUAGGUG (SEQ ID NO: 26);
[0111] The 5' end and 3' end of the third target detection probe-1 are respectively labeled with a CY5 fluorescent reporter group and a fluorescent quencher group (such as DABCYL, BHQ-1 or BHQ-2, etc.); and the quencher group labeled at the 3' end can be the same as or different from that of the first target detection probe-1 or the second target detection probe-1, the same below.
[0112] Group 3:
[0113] a first specific capture probe for Cspp (SEQ ID NO: 17);
[0114] First primer for Cspp (SEQ ID NO: 1);
[0115] Second primer-1 for Cspp (SEQ ID NO: 10);
[0116] a first target detection probe against Cspp (SEQ ID NO: 21);
[0117] a second specific capture probe for Candida glabrata (SEQ ID NO: 18);
[0118] a third primer for Candida glabrata (SEQ ID NO: 3);
[0119] the fourth primer-1 for Candida glabrata (SEQ ID NO: 12);
[0120] a second target detection probe for Candida glabrata (SEQ ID NO: 23);
[0121] a third specific capture probe for Candida krusei (SEQ ID NO: 19);
[0122] a fifth primer against Candida krusei (SEQ ID NO: 5);
[0123] The sixth primer-1 for Candida krusei (SEQ ID NO: 14);
[0124] A third target detection probe for Candida glabrata (SEQ ID NO: 25).
[0125] Group 4:
[0126] a first specific capture probe for Cspp (SEQ ID NO: 17);
[0127] First primer-1 for Cspp (SEQ ID NO: 2);
[0128] a second primer for Cspp (SEQ ID NO: 9);
[0129] a first target detection probe against Cspp (SEQ ID NO: 21);
[0130] a second specific capture probe for Candida glabrata (SEQ ID NO: 18);
[0131] the third primer-1 for Candida glabrata (SEQ ID NO: 4);
[0132] a fourth primer for Candida glabrata (SEQ ID NO: 11);
[0133] a second target detection probe for Candida glabrata (SEQ ID NO: 23);
[0134] a third specific capture probe for Candida krusei (SEQ ID NO: 19);
[0135] The fifth primer-1 for Candida krusei (SEQ ID NO: 6);
[0136] a sixth primer against Candida krusei (SEQ ID NO: 13);
[0137] A third target detection probe for Candida glabrata (SEQ ID NO: 25).
[0138] The preparation method of the positive control in this embodiment includes the following steps:
[0139] (1) RNAseP RNA fragments of Candida albicans, Candida tropicalis, Candida parapsilosis, Candida dubliniensis, Candida glabrata, and Candida krusei (corresponding to XR_002086389.1, DQ660439.1, DQ660436.1, DQ660438.1, GQ251341.1, and DQ660435.1, respectively) were synthesized by chemical synthesis and constructed into a common plasmid vector containing a T7 promoter sequence;
[0140] (2) RNA fragments were transcribed using a commercial T7 promoter in vitro transcription kit (Sigma). After purification, the RNA copy number was calculated by ultraviolet light. In vitro transcribed RNAs of Candida albicans, Candida tropicalis, Candida parapsilosis, Candida dubliniensis, Candida glabrata, and Candida krusei were used as positive controls.
[0141] The four sets of primers and probes (set 1, set 2, set 3 and set 4) were used to detect the gradient concentration samples of positive control containing each Candida species (Cspp (here one of Candida albicans, Candida tropicalis, Candida parapsilosis, Candida dubliniensis), Candida glabrata and Candida krusei) (the gradient concentrations of in vitro transcribed RNA of Cspp, Candida glabrata and Candida krusei were 10 5 copies / reaction, 10 4 copies / reaction, 10 3 copies / reaction, 10 2 The real-time fluorescence nucleic acid isothermal amplification detection (triplet detection) was performed on the negative control. The specific detection method is described in Example 4 below. For the convenience of display, the amplification curves of Group 1, Group 2, Group 3 and Group 4 for each Candida species are shown separately. Figure 1-6 In each figure, 1, 2, 3, and 4 represent RNA concentrations of 10 5 copies / reaction, 10 4 copies / reaction, 10 3 copies / reaction, 10 2 copies / reaction. Among them, Figure 1 The AD amplitudes are the amplification curves of the primer and probe combinations of group 1, group 2, group 3 and group 4 for Candida albicans in Cspp. It can be seen that the minimum detection limit of Candida albicans by the primers and probes of group 1 and group 2 can reach 10 2 copies / reaction, while the primers and probes in groups 3 and 4 could only detect 10 copies / reaction. 3 copies / reactions; Figure 2The AD amplitudes are the amplification curves of the primers and probes in group 1, group 2, group 3 and group 4 for Candida tropicalis in Cspp. It can be seen that the minimum limit of detection of Candida tropicalis by the primers and probes in group 1 and group 3 can reach 10 2 copies / reaction, while the primers and probes in groups 2 and 4 could only detect 10 copies / reaction. 3 copies / reactions; Figure 3 The AD amplitudes are the amplification curves of the primers and probes in group 1, group 2, group 3 and group 4 for Candida parapsilosis. It can be seen that the minimum limit of the primers and probes in group 1 for detecting Candida parapsilosis can reach 10 2 The detection limit of primers and probes in groups 2, 3 and 4 for Candida parapsilosis was only 10 copies / reaction. 3 copies / reactions; Figure 4 The AD amplitudes are the amplification curves of the primers and probes in group 1, group 2, group 3 and group 4 for Candida dubliniensis. It can be seen that the minimum limit of detection of Candida dubliniensis by the primers and probes in group 1 and group 4 can reach 10 2 copies / reaction, while the primers and probes in groups 2 and 3 only reached a minimum limit of 10 for detecting Candida dubliniensis. 3 copies / reactions; Figure 5 The AD amplitudes are the amplification curves of the primers and probes in group 1, group 2, group 3 and group 4 for Candida glabrata. It can be seen that the minimum limit of detection of Candida glabrata by the primers and probes in group 1 and group 4 can reach 10 2 The primers and probes in groups 2 and 3 can only detect 10 copies / reaction. 3 copies / reactions; Figure 6 The AD amplitudes are the amplification curves of the primers and probes in group 1, group 2, group 3 and group 4 for Candida krusei. It can be seen that the detection sensitivity of the primers and probes in group 1, group 2 and group 4 for Candida krusei can reach 10 2 The primers and probes in group 3 can only detect 10 copies / reaction. 3 copies / reactions.
[0142] Based on the above sensitivity test results, it can be seen that when a primer-probe combination with good sensitivity detection effect for each Candida species is used for multiple detection, the mutual interference between different primers and probes may cause a decrease in detection sensitivity, but different combinations have different effects on the final sensitivity detection effect. Compared with the primers and probes of groups 2 to 4, the primer and probe combination of group 1 has higher sensitivity for the three Candida species in triple detection. In another experiment, it was also verified that the primer and probe combination of group 1 has the same detection sensitivity (all up to 10) when triple detection is performed on gradient concentration samples containing positive controls of each Candida species (Cspp (here, in vitro transcribed RNA of Candida albicans, Candida tropicalis, Candida parapsilosis, and Candida dubliniensis mixed at a concentration of 1:1:1:1), Candida glabrata, and Candida krusei). 2 copies / reaction), therefore, the present invention determines that the primers and probes of group 1 are used for simultaneous real-time fluorescent nucleic acid isothermal amplification detection of the above six species of Candida, and can also distinguish and identify Candida glabrata and Candida krusei.
[0143] In this embodiment, the inventors also synthesized primers and probes for Cspp (Candida albicans, Candida tropicalis, Candida parapsilosis, Candida dubliniensis), primers and probes for Candida glabrata, and primers and probes for Candida krusei according to the disclosure of the above-mentioned document 4, and used the PCR method to perform triple detection on the gradient concentration samples containing the positive control of each Candida. The results showed that the primer-probe combination disclosed in the document 4 could only detect Cspp, Candida glabrata, and Candida krusei up to 10 3 The detection limit of the primer and probe combination of group 1 for the above six Candida species is significantly higher than that of the primer and probe combination of group 1 determined by the present invention. In addition, compared with the PCR method used in document 4, which takes a long time (generally 2-3 hours), the detection efficiency of the present invention can be completed within 1 hour (even 40 minutes), which significantly improves the detection efficiency. In addition, the amplification product of the present invention is RNA, which is easy to degrade and basically does not cause cross-contamination of samples or contamination of the laboratory environment.
[0144] Example 2: Design of primers and probes for real-time fluorescence nucleic acid isothermal amplification to detect six species of Candida and Trichomonas vaginalis
[0145] 2.1. Design and screening of primers and probes for real-time fluorescent nucleic acid isothermal amplification for the detection of Trichomonas vaginalis
[0146] Based on the Trichomonas vaginalis 16S RNA published in the Genbank database (the Genbank accession number of the Trichomonas vaginalis 16S RNA gene sequence is: U17510.1), the inventors determined the detection sequence from a highly conserved sequence that is significantly different from other similar pathogens. Primers and probes were designed according to the primer and probe design principles to perform real-time fluorescent nucleic acid isothermal amplification detection of Trichomonas vaginalis.
[0147] In this embodiment, multiple sets of primers and probes were designed for Trichomonas vaginalis. The following four sets of primers and probes (16S-1, 16S-2, 16S-3 and 16S-4, as shown in Table 1 below) were selected to test a series of concentrations of samples (concentrations of 10, ... 5 copies / reaction, 10 4 copies / reaction, 10 3 copies / reaction, 10 2 Real-time fluorescent nucleic acid isothermal amplification (RT-PCR) was performed using 100 copies / reaction, 10 copies / reaction, and 1 copy / reaction, respectively, and a negative control (a system containing no Trichomonas vaginalis nucleic acid sequence, such as deionized water or commercially available sample storage solution) (for specific detection methods, see Example 4 below). Primer and probe combinations capable of highly sensitive detection of Trichomonas vaginalis were screened. The results are shown in Table 2 below, where "+" indicates detection and "-" indicates non-detection.
[0148] The preparation method of the Trichomonas vaginalis positive control in this embodiment includes the following steps:
[0149] (1) Trichomonas vaginalis 16S rRNA fragments (corresponding to U17510.1) were synthesized by chemical synthesis and constructed into a common plasmid vector containing a T7 promoter sequence;
[0150] (2) RNA fragments were transcribed using a commercial T7 promoter in vitro transcription kit (Sigma). After purification, the RNA copy number was calculated by ultraviolet light. Trichomonas vaginalis in vitro transcribed RNA was used as a positive control.
[0151] Table 1: Information of four sets of primers and probes for real-time fluorescent nucleic acid isothermal amplification detection of Trichomonas vaginalis
[0152]
[0153] Table 2: Detection results of the four primer and probe groups shown in Table 1 for different concentrations of Trichomonas vaginalis
[0154]
[0155] As shown in Table 2 above, the sensitivity results of each primer and probe combination for the detection of Trichomonas vaginalis positive standards alone indicate that all four primer and probe combinations (16S-1 to 16S-4) can detect the positive standard at a concentration of 10 copies / reaction when detecting Trichomonas vaginalis alone. Therefore, the primer and probe combinations 16S-1 to 16S-4 can all be used alone for the high-sensitivity detection of Trichomonas vaginalis.
[0156] 2.2 Determination of primer and probe combinations for real-time fluorescence nucleic acid isothermal amplification detection of six Candida species and Trichomonas vaginalis
[0157] The primer-probe combination (16S-1 to 16S-4) determined in step 2.1 above that can be used alone for high-sensitivity detection of Trichomonas vaginalis was combined with the primers and probes of group 1 that can detect six species of Candida with high sensitivity as determined in Example 1, respectively, to obtain a total of 4 new primer and probe groups (groups 5, 6, 7, and 8, with specific combinations shown in Table 3 below). These 4 new primer and probe groups were used to perform PCR amplification of gradient concentration samples containing positive controls of various Candida species (Cspp (here, in vitro transcribed RNAs of Candida albicans, Candida tropicalis, Candida parapsilosis, and Candida dubliniensis were mixed at a concentration of 1:1:1:1), Candida glabrata, and Candida krusei) and Trichomonas vaginalis (wherein the gradient concentrations of in vitro transcribed RNAs of Cspp, Candida glabrata, Candida krusei, and Trichomonas vaginalis were all 10 5 copies / reaction, 10 4 copies / reaction, 10 3 copies / reaction, 10 2 Real-time fluorescent nucleic acid isothermal amplification detection (quadruple detection) was performed on 100 samples of the positive control (100 copies / reaction) and a negative control. The specific detection method is described in Example 6 below. The test results are shown in Table 4 below, where "+" indicates detection and "-" indicates non-detection.
[0158] According to the results recorded in Table 4, it can be seen that only the primer and probe combination of group 5 can reach a minimum limit of 10 for six Candida species and Trichomonas vaginalis in the quadruple test. 2 copies / reaction; while the primer and probe combination of group 6 can detect up to 10 copies / reaction for Trichomonas vaginalis in the quadruple test. 2 copies / reaction, but only 10 copies / reaction can be detected for Candida glabrata and Candida krusei 3 The primer and probe combination of group 7 can only detect up to 10 copies / reaction for Trichomonas vaginalis. 3 The primer and probe combination of group 8 could only detect up to 10 copies / reaction for Trichomonas vaginalis and Candida krusei. 3 copies / reactions. Figure 7Panels AD in the middle show exemplary amplification curves of primer and probe combinations of groups 5 to 8 for Trichomonas vaginalis. In the figure, 1, 2, 3, and 4 represent RNA concentrations of 10 5 copies / reaction, 10 4 copies / reaction, 10 3 copies / reaction, 10 2 copies / reactions.
[0159] Table 3: Different primer and probe combinations for real-time fluorescence nucleic acid isothermal amplification detection of six Candida species and Trichomonas vaginalis
[0160] Primer probe combination number Primer-probe combination Group 5 16S-1+Group 1 Group 6 16S-2+Group 1 Group 7 16S-3+Group 1 Group 8 16S-4+Group 1
[0161] Table 4: Sensitivity test results of different primer and probe combinations shown in Table 3 and the method disclosed in Reference 4
[0162]
[0163]
[0164] The above results show that even though the primer probe combinations 16S-1 to 16S-4 all have good sensitivity detection results when detecting Trichomonas vaginalis alone (all can reach 10 copies / reaction), when these primer probe combinations are combined again with the primer probe combination (Group 1) for simultaneous detection of six Candida species determined in Example 1 to simultaneously perform quadruple detection of six Candida species and Trichomonas vaginalis, the sensitivity results of the quadruple detection may be affected. Specifically, when the primer probes 16S-2 to 16S-4 are further combined with the primer probes of Group 1, the new primer probe combinations (i.e., Groups 6 to 8) will all result in the detection limit of one or more of Candida and Trichomonas vaginalis not reaching 10 2 copies / reaction, and only when the primer probe of 16S-1 was further combined with the primer probe of group 1 (i.e., group 5) could it still be detected with higher sensitivity (the minimum limit was 10 2 Therefore, the present invention identifies the primer and probe combination of Group 5 as the optimal combination for simultaneous detection of six species of Candida and Trichomonas vaginalis and suitable for real-time fluorescent nucleic acid isothermal amplification detection.
[0165] In this example, the inventors further synthesized primers and probes for Trichomonas vaginalis according to the disclosure of the above-mentioned document 4, and used the PCR method to perform quadruple detection on the gradient concentration samples containing the positive control of each Candida and Trichomonas vaginalis. The results are shown in Table 4 above. It can be seen that the primer-probe combination disclosed in the document 4 can only detect up to 10 3 copies / reaction, which is significantly higher than the minimum detection limit of the primer and probe combination of Group 5 determined by the present invention for the above six species of Candida and Trichomonas vaginalis.
[0166] Example 3: Real-time fluorescent nucleic acid constant temperature amplification detection kit for simultaneous detection of six species of Candida
[0167] The kit for detecting Cspp, Candida glabrata, and Candida krusei provided in this embodiment is a kit based on the principle of RNA nucleic acid isothermal amplification detection (also referred to herein as the first kit), specifically comprising the following components:
[0168] (T1) Nucleic acid extraction solution: used to extract and purify Candida nucleic acid in a sample, which may include a solid support (e.g., magnetic beads) containing a first specific capture probe (SEQ ID NO: 17), a second specific capture probe (SEQ ID NO: 18), and a third specific capture probe (SEQ ID NO: 19), wherein the first specific capture probe is used to capture the Cspp detection sequence; the second specific capture probe is used to capture the Candida glabrata detection sequence; and the third specific capture probe is used to capture the Candida krusei detection sequence. Specifically, the nucleic acid extraction solution may include: 250-800 mM HEPES, 4-10% LLS (lithium dodecyl sulfate), 1-50 μM of the first specific capture probe, 1-50 μM of the second specific capture probe, 1-50 μM of the third specific capture probe, and 50-500 mg / L of magnetic beads;
[0169] (T2) Detection solution: comprising a first primer (SEQ ID NO: 1), a second primer (SEQ ID NO: 9), a first target detection probe (SEQ ID NO: 21), a third primer (SEQ ID NO: 3), a fourth primer (SEQ ID NO: 11), a second target detection probe (SEQ ID NO: 23), a fifth primer (SEQ ID NO: 5), a sixth primer (SEQ ID NO: 13), and a third target detection probe (SEQ ID NO: 25); wherein the first primer cooperates with the second primer and the first target detection probe to detect the target sequence of Cspp; the third primer cooperates with the fourth primer and the second target detection probe to detect the target sequence of Candida glabrata; the fifth primer cooperates with the sixth primer and the third target detection probe to detect the target sequence of Candida krusei. Specifically, the detection solution may contain: 10-50mM Tris, 5-40mM KCl, 10-40mM MgCl2, 1-20mM NTP, 0.1-10mM dNTPs, 1-10% PVP40, 250-750pmol / mL of a first primer, 250-750pmol / mL of a second primer, 250-750pmol / mL of a third primer, 250-750pmol / mL of a fourth primer, 250-750pmol / mL of a fifth primer, 250-750pmol / mL of a sixth primer, 250-750pmol / mL of a first target detection probe, 250-750pmol / mL of a second target detection probe, and 250-750pmol / mL of a third target detection probe; and
[0170] (T3) SAT enzyme solution: It may contain at least one RNA polymerase and M-MLV reverse transcriptase; specifically, the SAT enzyme solution contains: 16000-160000 U / mL of M-MLV reverse transcriptase, 8000-80000 U / mL of RNA polymerase, 2-10 mM HEPES pH 7.5, 10-100 mM N-acetyl-L-cysteine, 0.04-0.4 mM zinc acetate, 10-100 mM trehalose, 40-200 mM Tris-HCl pH 8.0, 40-200 mM KCl, 0.01-0.5 mM EDTA, 0.1-1% (v / v) Triton X-100 and 20-50% (v / v) glycerol.
[0171] To facilitate detection, the kit provided in this embodiment may also include the following components:
[0172] (M1) Washing solution: used for washing the magnetic beads in aqueous phase. Its formula can be HEPES 5-50mM, NaCl 50-500mM, 0.5-1.5% SDS, EDTA 1-10mM;
[0173] (M2) Mineral oil: mineral oil used for cleaning the organic phase of magnetic beads;
[0174] (M3) positive control; can be dilutions of in vitro transcribed RNA of Cspp, Candida glabrata, and Candida krusei (prepared in Example 1);
[0175] (M4) Negative control: It can be a system that does not contain the above six Candida nucleic acid sequences or the above six Candida species, such as physiological saline and sample preservation solution (which contains high-concentration detergent and physiological saline).
[0176] Example 4: Real-time fluorescent nucleic acid isothermal amplification method for simultaneous detection of six species of Candida
[0177] The method of this embodiment is based on the principle of RNA isothermal amplification detection to simultaneously detect Candida albicans, Candida tropicalis, Candida parapsilosis, Candida dubliniensis (the above four Candida species are collectively referred to as Cspp), Candida glabrata, and Candida krusei. The kit provided in Example 3 is used to detect whether the sample contains the above six Candida nucleic acids. The specific operating steps are as follows:
[0178] 4.1 Sample preparation
[0179] 2 mL of microbial culture was mixed with 2 mL of sample preservation solution (Shanghai Rendu Biotechnology Co., Ltd.) at a ratio of 1:1 and used as the sample to be tested.
[0180] 4.2 RNA Extraction
[0181] (1) Add 100 μL-800 μL of nucleic acid extract and 400 μL of the sample to be tested to the sample processing tube, mix well, incubate at 60°C for 10 minutes, and let stand at room temperature for 10 minutes;
[0182] (2) Place the sample processing tube on the magnetic bead separation device and let it stand for 3-5 minutes. After the magnetic beads are adsorbed on the tube wall, keep the sample processing tube on the magnetic bead separation device, aspirate and discard the waste liquid, and retain the magnetic beads. Add 1mL of washing solution, shake evenly and let it stand for 3-5 minutes, then add 800μL of washing solution and 200μL of mineral oil, shake evenly and let it stand for 3-5 minutes, aspirate and discard the waste liquid, and retain the magnetic beads;
[0183] (3) Remove the sample processing tube from the magnetic bead separation device. The tube contains the magnetic bead-nucleic acid complex and is ready for use (the magnetic beads should be clearly visible at this step).
[0184] 4.3 SAT nucleic acid amplification test
[0185] (1) Add 40 μL of detection solution to the sample processing tube (containing magnetic beads-nucleic acid complex) after step 4.2 and shake to resuspend the magnetic beads;
[0186] (2) Take 40 μL of the shaken and mixed detection solution to a clean micro reaction tube, add 50 μL of mineral oil to the micro reaction tube, preheat the micro reaction tube at 42 ° C for 5-10 minutes, and add 13 μL of SAT enzyme solution preheated to 42 ° C to the micro reaction tube. Quickly transfer the micro reaction tube to a constant temperature fluorescence detection instrument, react at 42 ° C for 40 minutes, and set it to collect fluorescence signals once per minute. Select FAM, ROX, and CY5 channels for the fluorescence channel (that is, the 5' end of the first target detection probe in the detection solution is labeled with a FAM fluorescent reporter group, the 5' end of the second target detection probe is labeled with a ROX fluorescent reporter group, and the 5' end of the third target detection probe is labeled with a CY5 fluorescent reporter group). Synchronously detect the negative control according to the above steps.
[0187] 4.4 Result Determination
[0188] Based on the curve obtained from the SAT amplification results, the software automatically reads the dt value and determines the result.
[0189] The result judgment criteria are:
[0190] If dt ≤ 35 in the FAM channel, the sample is Cspp positive, which means that the sample contains Cspp nucleic acid;
[0191] If dt>35 in the FAM channel, the sample is Cspp negative, that is, the sample does not contain Cspp nucleic acid;
[0192] If dt of the ROX channel is ≤35, the sample is positive for Candida glabrata, that is, the sample contains Candida glabrata nucleic acid;
[0193] If dt of the ROX channel is > 35, the sample is negative for Candida glabrata, that is, the sample does not contain Candida glabrata nucleic acid;
[0194] If dt of the CY5 channel is ≤35, the sample is positive for Candida krusei, that is, the sample contains Candida krusei nucleic acid;
[0195] If dt>35 in the CY5 channel, the sample is negative for Candida krusei, that is, the sample does not contain Candida krusei nucleic acid.
[0196] The above method was used to detect the presence of 19 common vaginal microorganisms or pathogens (sample 1 was a culture of Candida albicans (ATCC 18804), sample 2 was a culture of Candida tropicalis (ATCC 750), sample 3 was a culture of Candida parapsilosis (ATCC 22019), sample 4 was a culture of Candida dubliniensis (MYA-646), sample 5 was a culture of Candida glabrata (ATCC 2001), sample 6 was a culture of Candida krusei (ATCC 32196), sample 7 was a mixed culture of Candida albicans, Candida tropicalis, Candida parapsilosis, Candida dubliniensis, Candida glabrata and Candida krusei, sample 8 was a culture of Candida guillemot (ATCC 14242), sample 9 was a culture of Candida kefir (ATCC 4135), sample 10 was a culture of Candida portuguesa (ATCC 34449) culture, sample 11 was a culture of Lactobacillus crispatus (ATCC 33820), sample 12 was a culture of Lactobacillus gasseri (ATCC 33323), sample 13 was a culture of Gardnerella vaginalis (ATCC 14018), sample 14 was a culture of Escherichia coli (ATCC 25922), sample 15 was a culture of Mycoplasma genitalium (ATCC 33530), sample 16 was a culture of Neisseria gonorrhoeae (ATCC 19424), sample 17 was a culture of Ureaplasma urealyticum (ATCC 27618), sample 18 was a culture of Chlamydia trachomatis (ATCC VR-571B), and sample 19 was a culture of Staphylococcus aureus (ATCC12600) for Candida albicans fluorescent nucleic acid isothermal amplification detection. The concentration of the cultures was 1×10 6 CFU / mL or 1×10 5 cell / mL, and simultaneously detected the positive control (exogenously transcribed RNA of Candida albicans, Candida glabrata, and Candida krusei prepared in Example 1 (4×10 5 The results are shown in Table 5 below. Among the 19 common vaginal microorganism or pathogen culture samples, 4 samples (samples 1-4) were positive for the FAM channel, 1 sample (sample 5) was positive for the ROX channel, 1 sample (sample 6) was positive for the CY5 channel, and 1 sample (sample 7) was positive for the FAM, ROX, and CY5 channels. Twelve samples (samples 8-19) were negative, which is consistent with the actual situation of the samples. The positive and negative control test results were normal, demonstrating that this method is effective and has good detection specificity. It can be used to simultaneously detect Cspp, Candida glabrata, and Candida krusei, and can distinguish Candida glabrata from Candida krusei.
[0197] Table 5: Test results of 19 common vaginal microorganisms or pathogens
[0198]
[0199]
[0200] With reference to this embodiment, the same method (especially steps 4.1-4.4) can also be used to detect other medical samples (such as wounds, skin, etc.) or non-medical samples (sputum, blood products, dairy products, etc.).
[0201] Example 5: Real-time fluorescent nucleic acid constant temperature amplification detection kit for simultaneous detection of six species of Candida and Trichomonas vaginalis
[0202] The kit for detecting Cspp, Candida glabrata, Candida krusei, and Trichomonas vaginalis provided in this embodiment is a kit based on the principle of RNA nucleic acid isothermal amplification detection (also referred to herein as the second kit), specifically comprising the following components:
[0203] (T1) Nucleic acid extraction solution: used to extract and purify Candida and Trichomonas vaginalis nucleic acids in a sample, which may include a solid support (e.g., magnetic beads) containing a first specific capture probe (SEQ ID NO: 17), a second specific capture probe (SEQ ID NO: 18), a third specific capture probe (SEQ ID NO: 19), and a fourth specific capture probe (SEQ ID NO: 20), wherein the first specific capture probe is used to capture the Cspp detection sequence; the second specific capture probe is used to capture the Candida glabrata detection sequence; the third specific capture probe is used to capture the Candida krusei detection sequence; and the fourth specific capture probe is used to capture the Trichomonas vaginalis detection sequence. Specifically, the nucleic acid extraction solution may include: 250-800 mM HEPES, 4-10% LLS (lithium dodecyl sulfate), 1-50 μM of the first specific capture probe, 1-50 μM of the second specific capture probe, 1-50 μM of the third specific capture probe, 1-50 μM of the fourth specific capture probe, and 50-500 mg / L of magnetic beads;
[0204] (T2) detection solution: comprising a first primer (SEQ ID NO: 1), a second primer (SEQ ID NO: 9), a first target detection probe (SEQ ID NO: 21), a third primer (SEQ ID NO: 3), a fourth primer (SEQ ID NO: 11), a second target detection probe (SEQ ID NO: 23), a fifth primer (SEQ ID NO: 5), a sixth primer (SEQ ID NO: 13), a third target detection probe (SEQ ID NO: 25), a seventh primer (SEQ ID NO: 7), an eighth primer (SEQ ID NO: 15), a fourth target detection probe (SEQ ID NO: 23), a fifth primer (SEQ ID NO: 5), a sixth primer (SEQ ID NO: 13), a third target detection probe (SEQ ID NO: 25), a seventh primer (SEQ ID NO: 7), an eighth primer (SEQ ID NO: 15), a fourth target detection probe (SEQ ID NO: 23), a fifth primer (SEQ ID NO: 5), a sixth primer (SEQ ID NO: 13), a third target detection probe (SEQ ID NO: 25), a seventh primer (SEQ ID NO: 7), a ... NO:27); wherein the first primer cooperates with the second primer and the first target detection probe to detect the target sequence of Cspp; the third primer cooperates with the fourth primer and the second target detection probe to detect the target sequence of Candida glabrata; the fifth primer cooperates with the sixth primer and the third target detection probe to detect the target sequence of Candida krusei; the seventh primer cooperates with the eighth primer and the fourth target detection probe to detect the target sequence of Trichomonas vaginalis. Specifically, the detection solution may contain: 10-50mMTris, 5-40mM KCl, 10-40mM MgCl2, 1-20mM NTP, 0.1-10mM dNTPs, 1-10% PVP40, 250-750 pmol / mL of a first primer, 250-750 pmol / mL of a second primer, 250-750 pmol / mL of a third primer, 250-750 pmol / mL of a fourth primer, 250-750 pmol / mL of a fifth primer, 250-750 pmol / mL of a sixth primer, 250-750 pmol / mL of a seventh primer, 250-750 pmol / mL of an eighth primer, 250-750 pmol / mL of a first target detection probe, 250-750 pmol / mL of a second target detection probe, 250-750 pmol / mL of a third target detection probe, 250-750 pmol / mL of a fourth target detection probe; and
[0205] (T3) SAT enzyme solution: It may contain at least one RNA polymerase and M-MLV reverse transcriptase; specifically, the SAT enzyme solution contains: 16000-160000 U / mL of M-MLV reverse transcriptase, 8000-80000 U / mL of RNA polymerase, 2-10 mM HEPES pH 7.5, 10-100 mM N-acetyl-L-cysteine, 0.04-0.4 mM zinc acetate, 10-100 mM trehalose, 40-200 mM Tris-HCl pH 8.0, 40-200 mM KCl, 0.01-0.5 mM EDTA, 0.1-1% (v / v) Triton X-100 and 20-50% (v / v) glycerol.
[0206] To facilitate detection, the kit provided in this embodiment may also include the following components:
[0207] (M1) Washing solution: used for washing the magnetic beads in aqueous phase. Its formula can be HEPES 5-50mM, NaCl 50-500mM, 0.5-1.5% SDS, EDTA 1-10mM;
[0208] (M2) Mineral oil: mineral oil used for cleaning the organic phase of magnetic beads;
[0209] (M3) positive control; can be a dilution of in vitro transcribed RNA of Cspp, Candida glabrata, Candida krusei, and Trichomonas vaginalis (prepared in Example 1);
[0210] (M4) Negative control: It can be a system that does not contain the above six Candida and Trichomonas vaginalis nucleic acid sequences or the above six Candida and Trichomonas vaginalis, such as physiological saline and sample preservation solution (which contains high concentration detergent and physiological saline).
[0211] Example 6: Real-time fluorescent nucleic acid isothermal amplification method and sensitivity test for simultaneous detection of six species of Candida and Trichomonas vaginalis
[0212] The method of this example is based on the principle of RNA isothermal amplification detection to simultaneously detect Candida albicans, Candida tropicalis, Candida parapsilosis, Candida dubliniensis (the above four Candida species are collectively referred to as Cspp), Candida glabrata, Candida krusei, and Trichomonas vaginalis. It uses the kit provided in Example 5 above to detect whether a sample (e.g., a microbial culture) contains nucleic acids of the above six Candida species and Trichomonas vaginalis. The specific operating steps are similar to steps 4.1 to 4.4 in Example 4. The only difference is:
[0213] (1) In step 4.3, the fluorescein channel selects FAM, ROX, CY5 and HEX channels (i.e., the 5' end of the first target detection probe in the detection solution is labeled with a FAM fluorescent reporter group, the 5' end of the second target detection probe is labeled with a ROX fluorescent reporter group, the 5' end of the third target detection probe is labeled with a CY5 fluorescent reporter group and the 5' end of the fourth target detection probe is labeled with a HEX fluorescent reporter group).
[0214] (2) In step 4.4, the result judgment criteria are:
[0215] If dt ≤ 35 in the FAM channel, the sample is Cspp positive, which means that the sample contains Cspp nucleic acid;
[0216] If dt>35 in the FAM channel, the sample is Cspp negative, that is, the sample does not contain Cspp nucleic acid;
[0217] If dt of the ROX channel is ≤35, the sample is positive for Candida glabrata, that is, the sample contains Candida glabrata nucleic acid;
[0218] If dt of the ROX channel is > 35, the sample is negative for Candida glabrata, that is, the sample does not contain Candida glabrata nucleic acid;
[0219] If dt of the CY5 channel is ≤35, the sample is positive for Candida krusei, that is, the sample contains Candida krusei nucleic acid;
[0220] If dt>35 in the CY5 channel, the sample is negative for Candida krusei, meaning that the sample does not contain Candida krusei nucleic acid;
[0221] If dt≤35 in the HEX channel, the sample is positive for Trichomonas vaginalis, that is, the sample contains Trichomonas vaginalis nucleic acid;
[0222] If dt>35 in the HEX channel, the sample is negative for Trichomonas vaginalis, that is, the sample does not contain Trichomonas vaginalis nucleic acid.
[0223] The above method was used to prepare a gradient concentration mixture of Cspp culture-1 (a mixture of Candida albicans (ATCC 18804) culture, Candida tropicalis (ATCC 750) culture, Candida parapsilosis (ATCC 22 019) culture, and Candida dubliniensis (MYA-646) culture at a concentration ratio of 1:1:1:1), Candida glabrata (ATCC 2001) culture, Candida krusei (ATCC 32196) culture, and Trichomonas vaginalis (ATCC PRA-98) culture (in this gradient concentration mixture, the gradient concentrations of Cspp culture-1, Candida glabrata culture, and Candida krusei culture were 10, ... 4 CFU / mL, 10 3 CFU / mL, 102 CFU / mL, 10 1 CFU / mL, 10 0 CFU / mL; gradient concentrations of Trichomonas vaginalis culture were 1 Cells / mL, 0.1 Cells / mL, 0.01 Cells / mL, 0.001 Cells / mL, 0.0001 Cells / mL), and a gradient concentration mixture of Cspp culture-2 (Candida albicans (ATCC 18804) culture), Candida glabrata (ATCC 2001) culture, Candida krusei (ATCC 32196) culture, and Trichomonas vaginalis (ATCC PRA-98) culture (gradient concentrations are the same as above) were performed in quadruple detection.
[0224] The results are as follows Figure 8 As shown, for the convenience of observation, the amplification curves for Cspp, Candida glabrata, Candida krusei and Trichomonas vaginalis cultures are displayed separately, as shown in FIG. Figure 8 Panels A to E illustrate exemplary amplification curves for quadruple detection of Cspp culture-1, Cspp culture-2, Candida glabrata culture, Candida krusei culture, and Trichomonas vaginalis culture using the kit provided in Example 5. It can be seen that the lower limits of detection for Cspp culture (Cspp culture-1 or Cspp culture-2), Candida glabrata culture, and Candida krusei culture can all reach 10 CFU / mL, and the lower limit of detection for Trichomonas vaginalis culture can reach 0.001 cells / mL.
[0225] Example 7: Real-time fluorescent nucleic acid isothermal amplification specificity test for simultaneous detection of six Candida species and Trichomonas vaginalis
[0226] The method of this embodiment is based on the principle of RNA constant temperature amplification detection to simultaneously detect Candida albicans, Candida tropicalis, Candida parapsilosis, Candida dubliniensis (the above four Candida species are collectively referred to as Cspp), Candida glabrata, Candida krusei and Trichomonas vaginalis. It uses the kit provided in the above Example 5 to detect whether the sample contains the above six Candida species and Trichomonas vaginalis nucleic acids. For specific operating steps, see Example 6.
[0227] The above method was used to detect the presence of 20 common vaginal microorganisms or pathogens (sample 1 was a culture of Candida albicans (ATCC 18804), sample 2 was a culture of Candida tropicalis (ATCC 750), sample 3 was a culture of Candida parapsilosis (ATCC 22019), sample 4 was a culture of Candida dubliniensis (MYA-646), sample 5 was a culture of Candida glabrata (ATCC 2001), sample 6 was a culture of Candida krusei (ATCC 32196), sample 7 was a culture of Trichomonas vaginalis (ATCC PRA-98), sample 8 was a mixed culture of Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, Candida dubliniensis, Candida krusei and Trichomonas vaginalis, sample 9 was a culture of Candida guillemot (ATCC 14242), sample 10 was a culture of Candida kefir (ATCC 4135) culture, sample 11 is Candida albicans (ATCC 34449) culture, sample 12 is Lactobacillus crispatus (ATCC 33820) culture, sample 13 is Lactobacillus gasseri (ATCC 33323) culture, sample 14 is Gardnerella vaginalis (ATCC 14018) culture, sample 15 is Escherichia coli (ATCC 25922) culture, sample 16 is Mycoplasma genitalium (ATCC 33530) culture, sample 17 is Neisseria gonorrhoeae (ATCC 19424), sample 18 is Ureaplasma urealyticum (ATCC 27618) culture, sample 19 is Chlamydia trachomatis (ATCC VR-571B) culture, sample 20 is Staphylococcus aureus (ATCC 12600) culture), and Candida fluorescent nucleic acid isothermal amplification detection was performed. The concentration of the cultures was 1×10 6 CFU / mL or 1×10 5 Cells / mL, and simultaneously detected the positive controls (Candida albicans, Candida glabrata, Candida krusei prepared in Example 1 and Trichomonas vaginalis prepared in Example 2 in vitro transcribed RNA (4×10 5 The results are shown in Table 6 below. Among the 20 common vaginal microorganism or pathogen culture samples, 4 samples (samples 1-4) tested positive for the FAM channel, 1 sample (sample 5) tested positive for the ROX channel, 1 sample (sample 6) tested positive for the CY5 channel, 1 sample (sample 7) tested positive for the HEX channel, and 1 sample (sample 8) tested positive for the FAM, ROX, CY5, and HEX channels. Twelve samples (samples 9-20) tested negative, which is consistent with the actual conditions of the samples. The positive and negative control test results were normal, demonstrating that this method is effective and has good detection specificity and can be used for the simultaneous detection of Cspp., glabrata, Candida krusei, and Trichomonas vaginalis.
[0228] Table 6: Test results of 20 common vaginal microorganisms or pathogens culture samples
[0229]
[0230]
[0231] With reference to this embodiment, the same method can also be used to detect other medical samples (such as wounds, skin, etc.) or non-medical samples (sputum, blood products, dairy products, etc.).
[0232] Example 8: Detection of clinical vaginal swab samples
[0233] This example uses the kit provided in Example 5 to detect whether 1194 clinical vaginal swab samples (in 2 mL of normal saline) contain Cspp, Candida glabrata, Candida krusei, and Trichomonas vaginalis nucleic acids. The specific operating steps are shown in Example 6.
[0234] The test results are shown in Table 7 below. It can be seen that among the 1,194 clinical vaginal swab samples tested, a total of 215 positive samples were detected. Among these positive samples, the proportions of Cspp-positive, Candida glabrata-positive, Candida krusei-positive, and Trichomonas vaginalis-positive samples were 76.74%, 17.21%, 3.26%, and 5.12%, respectively. This is basically consistent with the proportions of Candida and Trichomonas vaginalis-positive samples reported in the existing technical literature, proving that the present method and kit are effective and can be used for clinical sample detection.
[0235] Table 7: Test results of 1194 clinical vaginal swab samples
[0236] target Proportion of clinical vaginal samples (1194 cases) Proportion of positive samples (1194 cases) Cspp positive 13.9%(165 / 1194) 76.74%(165 / 215) Candida glabrata positive 3.09%(37 / 1194) 17.21%(37 / 215) Candida krusei positive 0.51%(7 / 1194) 3.26%(7 / 215) Trichomonas vaginalis positive 0.92%(11 / 1194) 5.12%(11 / 215) Cspp&Trichomonas vaginalis mixed positive 0.08%(1 / 1194) 0.46%(1 / 215) Cspp & smooth mixed positive 0.16%(2 / 1194) 0.93%(2 / 215) Smooth and soft mixed positive 0.16%(2 / 1194) 0.93%(2 / 215) Cspp, smooth and kro mixed positive 0.08%(1 / 1194) 0.46%(1 / 215)
[0237] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or substitute equivalents for some of the technical features therein. Any equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall be considered as part of the disclosure of the present invention.
Claims
1. A real-time fluorescence nucleic acid isothermal amplification detection kit for simultaneously detecting six kinds of Candida, named the first kit, characterized in that, Comprising: (T1) Nucleic acid extraction solution: It contains a solid support having a first specific capture probe, a second specific capture probe, and a third specific capture probe, wherein the first specific capture probe is used to capture the detection sequences of Candida albicans, Candida tropicalis, Candida parapsilosis, and / or Candida dubliniensis. The above four Candida species are collectively referred to as Cspp. The second specific capture probe is used to capture the detection sequence of Candida glabrata, and the third specific capture probe is used to capture the detection sequence of Candida krusei. (T2) Detection solution: It contains a first primer, a second primer, a first target detection probe, a third primer, a fourth primer, a second target detection probe, a fifth primer, a sixth primer, and a third target detection probe; Wherein the first primer, the second primer, and the first target detection probe cooperate to detect the target sequence of Cspp; The third primer, the fourth primer, and the second target detection probe cooperate to detect the target sequence of Candida glabrata; the fifth primer, the sixth primer, and the third target detection probe cooperate to detect the target sequence of Candida krusei; At both ends of the nucleotide sequences of the first target detection probe, the second target detection probe, and the third target detection probe, there are respectively carried a fluorescent reporter group and a quenching group, and the fluorescent reporter groups carried by the three are different, and (T3) SAT enzyme solution: It contains at least one RNA polymerase and M-MLV reverse transcriptase; Wherein: The nucleotide sequence of the first specific capture probe is as shown in SEQ ID NO:17, the nucleotide sequence of the second specific capture probe is as shown in SEQ ID NO:18, and the nucleotide sequence of the third specific capture probe is as shown in SEQ ID NO:19; The nucleotide sequence of the first primer is as shown in SEQ ID NO:1, the nucleotide sequence of the second primer is as shown in SEQ ID NO:9, and the nucleotide sequence of the first target detection probe is as shown in SEQ ID NO:21; The nucleotide sequence of the third primer is as shown in SEQ ID NO:3, the nucleotide sequence of the fourth primer is as shown in SEQ ID NO:11, and the nucleotide sequence of the second target detection probe is as shown in SEQ ID NO:23; The nucleotide sequence of the fifth primer is as shown in SEQ ID NO:5, the nucleotide sequence of the sixth primer is as shown in SEQ ID NO:13, and the nucleotide sequence of the third target detection probe is as shown in SEQ ID NO:
25.
2. A real-time fluorescence nucleic acid isothermal amplification detection kit for simultaneously detecting six kinds of Candida and Trichomonas vaginalis, named the second kit, characterized in that, The second kit further includes on the basis of the first kit according to claim 1: (a) Fourth specific capture probe: It exists in the nucleic acid extraction solution and is used to capture the detection sequence of Trichomonas vaginalis, and the nucleotide sequence of the fourth specific capture probe is as shown in SEQ ID NO:20, and (b) The seventh primer, the eighth primer, and the fourth target detection probe: The three are present in the detection solution and are used in combination to detect the target sequence of Trichomonas vaginalis. The nucleotide sequence of the seventh primer is as shown in SEQ ID NO:7, the nucleotide sequence of the eighth primer is as shown in SEQ ID NO:15, and the nucleotide sequence of the fourth target detection probe is as shown in SEQ ID NO:
27. A fluorescent reporter group and a quenching group are respectively carried at both ends of the nucleotide sequence of the fourth target detection probe, and the carried fluorescent reporter group is different from the fluorescent reporter groups carried by the first, second, and third target detection probes.
3. The kit according to claim 1 or 2, characterized in that, The kit further includes: (M1) Wash solution: It contains NaCl and SDS; and / or (M2) Mineral oil; and / or (M3) Positive control: A system containing Cspp nucleic acid, Candida glabrata nucleic acid, and Candida krusei nucleic acid, or further containing Trichomonas vaginalis nucleic acid; and / or (M4) Negative control: A system that does not contain Cspp nucleic acid, Candida glabrata nucleic acid, and Candida krusei nucleic acid, or further does not contain Trichomonas vaginalis nucleic acid.
4. The kit according to claim 3, wherein The wash solution is 5 - 50 mM HEPES, 50 - 500 mM NaCl, 0.5 - 1.5% SDS, and 1 - 10 mM EDTA.
5. The kit according to claim 1 or 2, wherein The components of the nucleic acid extraction solution include: 250 - 800 mM HEPES, 4 - 10% lithium dodecyl sulfate, 1 - 50 μΜ of the first specific capture probe, 1 - 50 μΜ of the second specific capture probe, 1 - 50 μΜ of the third specific capture probe, and 50 - 500 mg / L magnetic beads; The components of the detection solution include: 10 - 50 mM Tris, 5 - 40 mM KCl, 10 - 40 mM MgCl2, 1 - 20 mM NTP, 0.1 - 10 mM dNTPs, 1 - 10% PVP40, 250 - 750 pmol / mL of the first primer, 250 - 750 pmol / mL of the second primer, 250 - 750 pmol / mL of the third primer, 250 - 750 pmol / mL of the fourth primer, 250 - 750 pmol / mL of the fifth primer, 250 - 750 pmol / mL of the sixth primer, 250 - 750 pmol / mL of the first target detection probe, 250 - 750 pmol / mL of the second target detection probe, and 250 - 750 pmol / mL of the third target detection probe; The components of the SAT enzyme solution include: M-MLV reverse transcriptase at 16,000 - 160,000 U / mL, RNA polymerase at 8,000 - 80,000 U / mL, 2 - 10 mM HEPES pH 7.5, 10 - 100 mM N-acetyl-L-cysteine, 0.04 - 0.4 mM zinc acetate, 10 - 100 mM trehalose, 40 - 200 mM Tris-HCl pH 8.0, 40 - 200 mM KCl, 0.01 - 0.5 mM EDTA, Triton X-100 at 0.1 - 1% v / v, and glycerol at 20 - 50% v / v.
6. The kit according to claim 5, characterized in that, The components of the nucleic acid extraction solution further include a fourth specific capture probe at 1 - 50 μM.
7. The kit according to claim 5, characterized in that, The components of the detection solution further include a seventh primer at 250 - 750 pmol / mL, an eighth primer at 250 - 750 pmol / mL, and a fourth target detection probe at 250 - 750 pmol / mL.
8. A primer and probe combination for real-time fluorescence nucleic acid isothermal amplification detection for simultaneously detecting six Candida species, named the first combination, which includes: (i) Primers and probes for detecting Candida albicans, Candida tropicalis, Candida parapsilosis, and / or Candida dubliniensis, which include: a first specific capture probe with a nucleotide sequence as shown in SEQ ID NO:17, a first primer with a nucleotide sequence as shown in SEQ ID NO:1, a second primer with a nucleotide sequence as shown in SEQ ID NO:9, and a first target detection probe with a nucleotide sequence as shown in SEQ ID NO:
21. (ii) Primers and probes for detecting Candida glabrata, which include: a second specific capture probe with a nucleotide sequence as shown in SEQ ID NO:18, a third primer with a nucleotide sequence as shown in SEQ ID NO:3, a fourth primer with a nucleotide sequence as shown in SEQ ID NO:11, and a second target detection probe with a nucleotide sequence as shown in SEQ ID NO:
23. (iii) Primers and probes for detecting Candida krusei, which include: a third specific capture probe with a nucleotide sequence as shown in SEQ ID NO:19, a fifth primer with a nucleotide sequence as shown in SEQ ID NO:5, a sixth primer with a nucleotide sequence as shown in SEQ ID NO:13, and a third target detection probe with a nucleotide sequence as shown in SEQ ID NO:
25. Wherein the nucleotide sequences of the first target detection probe, the second target detection probe, and the third target detection probe are respectively carried with a fluorescent reporter group and a quenching group at both ends, and the fluorescent reporter groups carried by the three are different.
9. A primer and probe combination for real-time fluorescence nucleic acid isothermal amplification detection for simultaneously detecting six Candida species and Trichomonas vaginalis, named the second combination, which further includes on the basis of the first combination described in claim 8: (iv)Primers and probes for detecting Trichomonas vaginalis, including: a third specific capture probe with a nucleotide sequence as shown in SEQ ID NO: 20, a seventh primer with a nucleotide sequence as shown in SEQ ID NO: 7, an eighth primer with a nucleotide sequence as shown in SEQ ID NO: 15, and a fourth target detection probe with a nucleotide sequence as shown in SEQ ID NO: 27; wherein both ends of the nucleotide sequence of the fourth target detection probe are respectively carried with a fluorescent reporter group and a quenching group, and the carried fluorescent reporter group is different from the fluorescent reporter groups carried by the first, second, and third target detection probes.
10. A non-disease diagnosis method for simultaneously detecting six species of Candida using the kit according to claim 1, named the first method, characterized in that, The first method includes the following steps: 1) Add a nucleic acid extraction solution to the sample to be tested for nucleic acid extraction to obtain an analysis and detection sample. 2) Add a detection solution to the analysis and detection sample for the first-step reaction to obtain a first-step reaction solution. 3) Add SAT enzyme solution to the first-step reaction solution for the second-step reaction, and perform real-time fluorescence detection to obtain the dt value of the real-time fluorescence detection, and 4) Determine the result according to the dt value of the real-time fluorescence detection obtained in step 3): If an "S"-type amplification curve appears in the channel corresponding to the first target detection probe and dt ≤ 35, then the sample to be tested contains Cspp nucleic acid, that is, contains one or more of the nucleic acids of Candida albicans, Candida tropicalis, Candida parapsilosis, and Candida dubliniensis; if an "S"-type amplification curve does not appear, or an "S"-type amplification curve appears but dt > 35, then the sample to be tested does not contain Cspp nucleic acid. If an "S"-type amplification curve appears in the channel corresponding to the second target detection probe and dt ≤ 35, then the sample to be tested contains Candida glabrata nucleic acid; if an "S"-type amplification curve does not appear, or an "S"-type amplification curve appears but dt > 35, then the sample to be tested does not contain Candida glabrata nucleic acid. If an "S"-type amplification curve appears in the channel corresponding to the third target detection probe and dt ≤ 35, then the sample to be tested contains Candida krusei nucleic acid; if an "S"-type amplification curve does not appear, or an "S"-type amplification curve appears but dt > 35, then the sample to be tested does not contain Candida krusei nucleic acid. Wherein the sample to be tested is a blood product or a dairy product.
11. A non-disease diagnosis method for simultaneously detecting six species of Candida and Trichomonas vaginalis using the kit according to claim 2, named the second method, characterized in that, The second method further includes the following determination criteria on the basis of the first method described in claim 10: If an "S"-type amplification curve appears in the channel corresponding to the fourth target detection probe and dt ≤ 35, then the sample to be tested contains Trichomonas vaginalis nucleic acid; if an "S"-type amplification curve does not appear, or an "S"-type amplification curve appears but dt > 35, then the sample to be tested does not contain Trichomonas vaginalis nucleic acid.
12. The method according to claim 10 or 11, wherein The conditions for the first-step reaction in step 2) are to keep warm at 40°C - 45°C for 3 - 15 min; and / or The SAT enzyme solution in step 3) is preheated before use, and the preheating temperature is 41 - 43°C; and / or The conditions for the second-step reaction in step 3) are to react at 41°C - 43°C for 30 - 50 min.
Citation Information
Patent Citations
Special probe and gene chip for identifying pathogenic candida
CN101638688A
Candida categorized detection primer and probe composition, kit, detection method and application of composition
CN109971883A
Nucleic acid reagent, kit, system and method for detecting invasive fungi
CN110551840A
Methods and compositions for detecting candida species
CN108779499A
Multiplex detection of vulvovaginal candidiasis, trichomoniasis and bacterial vaginosis
US20210332421A1