A dual-rod cyclic microfluidic chip modified with aptamer and complementary strand, and its preparation method and application
By using aptamer and complementary chain modification technology on the microfluidic chip, combined with the principles of dual-disk circulation and fluorescence detection, the complex and time-consuming microbial detection in the existing technology is solved, and rapid, sensitive and specific detection of a variety of microorganisms is achieved.
Patent Information
- Application Number
- CN202211389090.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-08
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2042-11-08
AI Technical Summary
Existing microbial detection methods show superiority in sensitivity and specificity, but there is a problem of complex and cumbersome pretreatment, time-consuming and labor-intensive, and the analysis of only one foodborne pathogen at a time, making it difficult to achieve rapid, simple, high sensitivity and strong specificity screening of multiple microorganisms.
A double-rod cyclic microfluidic chip based on aptamer and complementary strand modification is used to specifically capture the target microorganisms through aptamers, and the signal is continuously amplified using the dual-disk cycling strategy. Combined with the fluorescence principle of SYBR GREEN I and DNA double strands, visual detection and on-site quantitative determination of a variety of microorganisms are achieved.
It realizes rapid detection of a variety of specific microorganisms, shortening the time to 20-30 minutes, which is suitable for emergency detection, improves detection sensitivity and specificity, and has the advantages of low cost, easy operation and immediate detection.
Smart Images

Figure CN116047067B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microbial detection, and in particular to a double-rod circulation microfluidic chip based on modification of aptamers and complementary chains, and a preparation method and application thereof. Background Art
[0002] Microorganisms are ubiquitous in nature; they are found in drinking water, fruits, and other foods. The widespread presence of pathogenic strains can lead to major epidemics and diseases. For example, staphylococcal disease is an acute or chronic infectious disease caused by Staphylococcus aureus, which can clinically cause various types of arthritis, tenosynovitis, foot pad swelling, navel inflammation, staphylococcal sepsis, etc. In developed or developing countries, water and food contaminated by bacteria are the main sources of microbial-mediated infections. According to statistics from the World Health Organization, approximately 600 million people become ill each year from eating food contaminated with Vibrio. In low- and middle-income countries, unsafe food causes economic losses of US$110 billion each year.
[0003] To date, a variety of methods have been developed for detecting foodborne pathogens, including plate counts, genomics-based polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), and enzyme-linked immunosorbent assay (EIA). Although these methods exhibit superior sensitivity and specificity, they also have drawbacks, such as complex and labor-intensive pretreatment, time-consuming and labor-intensive processes, and the ability to analyze only one foodborne pathogen at a time. However, in real-world food samples, multiple foodborne pathogens may be present simultaneously. Therefore, there is an urgent need to develop effective detection platforms for the simultaneous detection of multiple foodborne pathogens. Hyun-Joong Kim reported microarray analysis of four foodborne pathogens using specific probes prepared through comparative genomics. This method was highly sensitive (detecting 100 CFU / mL), but took up to two hours to perform, was complex to implement, and required specialized knowledge and sophisticated equipment. Therefore, achieving rapid, simple, sensitive, and specific screening for multiple foodborne pathogens remains a major challenge.
[0004] In recent years, the use of microfluidic chips for detecting pathogens has garnered increasing attention. Compared with traditional experimental platforms, they offer advantages such as high integration, low cost, high sensitivity, low reagent consumption, and short detection times. Furthermore, microfluidics' flexible combination of multiple unit operations and overall controllability align with the research approach of systems biology, making it a crucial technological platform in the field of biological research. The relatively closed environment created by microfluidic channels and the two-dimensional flow of fluid within them make it possible to perform more complex physical and chemical manipulations on bacteria. Consequently, microfluidic technology research targeting bacteria has attracted the attention of numerous researchers both domestically and internationally, has rapidly developed, and is now being used in the analysis of pathogenic bacteria and pathogenic strains.
[0005] Aptamers are DNA or RNA sequences that specifically bind to a target, obtained through several rounds of in vitro screening from a nucleic acid library using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technique. Aptamers have been applied in many fields, particularly in signal amplification in biosensors, due to their many advantages, such as a wide range of target substances, high specificity and affinity, and a short screening cycle. When combined with fluorescent dyes, they are suitable for the detection of microorganisms. Currently, various signal amplification methods have been used to further improve the sensitivity of fluorescent biosensors. However, these signal amplification methods are costly and susceptible to environmental factors (temperature, pH, etc.). They also require the use of large-scale instrumentation for testing, place high technical demands on test personnel, and significantly reduce detection efficiency. Therefore, there is an urgent need to develop a low-cost, low-tech, and rapid method for amplifying fluorescent signals that can be used for on-site testing to simultaneously detect multiple microorganisms. Summary of the Invention
[0006] The purpose of the present invention is to provide a double-rod circulating microfluidic chip based on modification of aptamers and complementary chains, and its preparation method and application. The double-rod circulating microfluidic chip can be used for microbial detection with high accuracy, simple operation and strong specificity.
[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0008] The present invention provides a double-rod circulation microfluidic chip based on modification of aptamers and complementary chains, comprising a glass plate and a PDMS-based template;
[0009] A plurality of detection units are arranged on the glass plate, each detection unit including two regions A and B, wherein the A region modifies the complex formed by the partial complementary chain and the aptamer, and the B region modifies the complete complementary chain;
[0010] The PDMS-based template includes an injection area, a microfluidic channel, and a detection area; the injection area is connected to a plurality of detection areas through a plurality of microfluidic channels; the injection area is a hollow design, and the microfluidic channel and the detection area are hollow and closed designs;
[0011] The PDMS-based template is bonded above the glass plate, and the detection area of the PDMS-based template overlaps with the detection unit on the glass plate.
[0012] The present invention also provides a method for preparing the above-mentioned dual-rod circulation microfluidic chip, comprising the following steps:
[0013] (1) Masking each detection unit of the glass plate is sprayed with gold. Region A is modified with a complex formed by a partial complementary chain and the aptamer, and region B is modified with a complete complementary chain.
[0014] (2) The chip mold is subjected to a hydrophobic treatment, and a mixture of PDMS and a curing agent is poured into the chip mold, and a PDMS-based template is obtained after curing;
[0015] (3) Bonding the modified glass plate obtained in step (1) to the PDMS-based template obtained in step (2) so that the detection unit on the glass plate falls into the detection area of the PDMS-based template, thereby obtaining a double-rod circulation microfluidic chip based on modification of the aptamer and the complementary chain.
[0016] Preferably, the glass plate is pretreated before the mask is sprayed with gold in step (1), and the pretreatment method is:
[0017] The glass plate was sequentially immersed in anhydrous ethanol, water, and anhydrous ethanol, and ultrasonically treated for 5 to 15 minutes respectively. After drying, the glass plate was immersed in a 0.05 to 0.15 mol / L PDDA aqueous solution for 0.5 to 1.5 hours. After drying, the glass plate was plasma treated for 0.5 to 1.5 minutes.
[0018] Preferably, the modification method of the A region in step (1) is:
[0019] The complex formed by the partially complementary chain and the aptamer is mixed with 0.5-1.5 mM Tcep at a molar ratio of 0.5:100-1.5:100, and reduced for 30-60 minutes. The complex formed by the reduced partially complementary chain and the aptamer is added dropwise to the A region and reacted for 20-30 minutes;
[0020] The modification method of region B is as follows: the fully complementary chain is mixed with 0.5-1.5 mM Tcep at a molar ratio of 0.5:100-1.5:100, reduced for 30-60 minutes, and the reduced fully complementary chain is added dropwise to region B for reaction for 20-30 minutes.
[0021] Preferably, the hydrophobic treatment method in step (2) is: placing the chip mold in a toluene solution of 1-4% octadecyltrichlorosilane; and the hydrophobic treatment time is 20-30 minutes.
[0022] Preferably, the mass ratio of the PDMS and the curing agent in step (2) is 10:0.5 to 10:1.5; and the curing treatment method is to first let it stand for 3 to 4 hours and then dry it at 55 to 65°C.
[0023] Preferably, the bonding method in step (3) is:
[0024] After the PDMS base template and the glass plate are plasma treated for 0.5 to 1.5 minutes, the two are placed together and bonded at 75 to 85° C. for 1 to 3 hours.
[0025] The present invention also provides application of the double-rod circulation microfluidic chip in microbial detection.
[0026] Preferably, the microorganism is one or more of Staphylococcus aureus, Vibrio parahaemolyticus and Salmonella typhimurium.
[0027] Compared with the prior art, the present invention has the following beneficial effects:
[0028] The dual-rod circulating microfluidic chip based on aptamers and complementary strands modified with the present invention uses aptamers to specifically capture target microorganisms, then continuously amplifies the signal using a dual-disk circulation strategy. Once the target microorganism is present, the aptamers on region A will specifically capture it and be pulled into the solution. Through rotation, the aptamers in the solution bind to the completely complementary strands on region B, releasing the target microorganism, and then continuously circulating, thereby achieving signal amplification. The reacting chip is placed in a black box, and the principle of SYBR GREEN I binding to double-stranded DNA to emit green fluorescence is used. Under the excitation of a light source, visual detection is achieved. At the same time, a mobile phone is used to read the RGB values to enable on-site quantitative determination of multiple microorganisms. This reduces the time required to detect multiple specific microorganisms to 20-30 minutes, making it suitable for practical emergency detection. The dual-rod circulating microfluidic chip based on aptamers and complementary strands modified with the present invention improves the sensitivity of detecting multiple specific microorganisms and has the advantages of high sensitivity, high accuracy, strong specificity, low detection limit, low cost, simple operation, and real-time detection. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 This is a schematic diagram of the preparation of a dual-rod circulating microfluidic chip based on modification of aptamers and complementary chains in Example 1. Part A shows the fabrication process of the dual-rod circulating microfluidic chip, and Part B shows the process of using the dual-rod circulating microfluidic chip to detect microorganisms.
[0030] Figure 2 for Figure 1 The design diagram of the double-rod circulation microfluidic chip based on aptamer and complementary chain modification;
[0031] Figure 3 for Figure 1 A photo of a double-rod circulating microfluidic chip based on aptamer and complementary chain modification;
[0032] Figure 4 This is a standard curve diagram for the detection of Salmonella typhimurium, Vibrio parahaemolyticus, and Staphylococcus aureus using a double-rod circulating microfluidic chip modified with aptamers and complementary chains;
[0033] Figure 5 A comparative diagram of the specificity of detecting different microorganisms based on a double-rod circulating microfluidic chip modified with aptamers and complementary chains (corresponding to the Staphylococcus aureus area). DETAILED DESCRIPTION
[0034] The present invention provides a double-rod circulation microfluidic chip based on modification of aptamers and complementary chains, comprising a glass plate and a PDMS-based template;
[0035] A plurality of detection units are arranged on the glass plate, each detection unit including two regions A and B, wherein the A region modifies the complex formed by the partial complementary chain and the aptamer, and the B region modifies the complete complementary chain;
[0036] The PDMS-based template includes an injection area, a microfluidic channel, and a detection area; the injection area is connected to a plurality of detection areas through a plurality of microfluidic channels; the injection area is a hollow design, and the microfluidic channel and the detection area are hollow and closed designs;
[0037] The PDMS-based template is bonded above the glass plate, and the detection area of the PDMS-based template overlaps with the detection unit on the glass plate.
[0038] In the present invention, the partially complementary chains in the dual-rod circulating microfluidic chip form a complex with the aptamer and are present on area A of the chip. When the target microorganism appears in the test liquid, it will interact with the aptamer on area A of the chip, bind with it, and be released into the test liquid together. Then, the double-disk circulation strategy is used to continuously amplify the signal. That is, once the target microorganism exists, the aptamer on area A will specifically capture it and be pulled into the solution. Through rotation, the aptamer in the solution will bind to the completely complementary chain on area B, releasing the target microorganism again, and then continue to circulate, thereby achieving signal amplification.
[0039] The present invention also provides a method for preparing the above-mentioned dual-rod circulation microfluidic chip, comprising the following steps:
[0040] (1) Masking each detection unit of the glass plate is sprayed with gold. Region A is modified with a complex formed by a partial complementary chain and the aptamer, and region B is modified with a complete complementary chain.
[0041] (2) The chip mold is subjected to a hydrophobic treatment, and a mixture of PDMS and a curing agent is poured into the chip mold, and a PDMS-based template is obtained after curing;
[0042] (3) Bonding the modified glass plate obtained in step (1) to the PDMS-based template obtained in step (2) so that the detection unit on the glass plate falls into the detection area of the PDMS-based template, thereby obtaining a double-rod circulation microfluidic chip based on modification of the aptamer and the complementary chain.
[0043] In the present invention, each detection unit of the glass plate is first masked and gold-sprayed, the A region is modified with a complex formed by a partial complementary chain and an aptamer, and the B region is modified with a complete complementary chain.
[0044] In the present invention, the glass plate is pretreated before the mask is sprayed with gold. The pretreatment method is as follows: the glass plate is sequentially immersed in anhydrous ethanol, water, and anhydrous ethanol, and ultrasonically treated for 5 to 15 minutes respectively. After drying, it is immersed in a 0.05 to 0.15 mol / L PDDA aqueous solution for 0.5 to 1.5 hours, and after drying, it is plasma treated for 0.5 to 1.5 minutes. The ultrasonic treatment time is 5 to 15 minutes, preferably 7 to 13 minutes, and more preferably 9 to 11 minutes; the concentration of the PDDA aqueous solution is 0.05 to 0.15 mol / L, preferably 0.06 to 0.14 mol / L, and more preferably 0.08 to 0.12 mol / L; the immersion time is 0.5 to 1.5 hours, preferably 1 hour; and the plasma treatment time is 0.5 to 1.5 minutes, preferably 1 minute.
[0045] In the present invention, the glass plate is preferably sprayed with gold using a gold spraying apparatus, the spraying time is 2 to 4 minutes, preferably 3 minutes; the thickness of the sprayed gold is 0.05 to 0.1 mm, preferably 0.06 to 0.09 mm, more preferably 0.07 to 0.08 mm.
[0046] In the present invention, the modification method of the A region is as follows: a complex formed by a partially complementary chain and an aptamer is mixed with 0.5 to 1.5 mM Tcep at a molar ratio of 0.5:100 to 1.5:100, and reduced for 30 to 60 minutes. The complex formed by the reduced partially complementary chain and the aptamer is added dropwise to the A region and reacted for 20 to 30 minutes. The concentration of the Tcep is 0.5 to 1.5 mM, preferably 0.6 to 1.4 mM, and more preferably 0.8 to 1.2 mM. ; The molar ratio of the complex formed by the partially complementary chain and the aptamer to Tcep is 0.5:100 to 1.5:100, preferably 0.7:100 to 1.3:100, and more preferably 0.9:100 to 1.1:100; the reduction time is 30 to 60 min, preferably 35 to 55 min, and more preferably 40 to 50 min; the reaction time is 20 to 30 min, preferably 22 to 28 min, and more preferably 24 to 26 min.
[0047] In the present invention, the modification method of the B region is as follows: the fully complementary chain and 0.5-1.5 mM Tcep are mixed at a molar ratio of 0.5:100 to 1.5:100, reduced for 30-60 min, and the reduced fully complementary chain is added dropwise to the B region for reaction for 20-30 min; the concentration of Tcep is 0.5-1.5 mM, preferably 0.6-1.4 mM, and more preferably 0.8-1.2 mM; the molar ratio of the fully complementary chain to Tcep is 0.5:100 to 1.5:100, preferably 0.7:100 to 1.3:100, and more preferably 0.9:100 to 1.1:100; the reduction time is 30-60 min, preferably 35-55 min, and more preferably 40-50 min; and the reaction time is 20-30 min, preferably 22-28 min, and more preferably 24-26 min.
[0048] In the present invention, after modification of the A and B regions, the A and B regions are preferably washed with a PBS solution and then dried.
[0049] In the present invention, the chip mold is subjected to a hydrophobic treatment, a mixture of PDMS and a curing agent is poured into the chip mold, and a PDMS-based template is obtained after curing treatment; the PDMS-based template includes a sampling area, a microfluidic channel, and a detection area; the chip mold is prepared by using AI mapping, importing the designed graphics into jdpaint software, setting its engraving path and depth, and engraving with an engraving machine to obtain the chip mold.
[0050] In the present invention, the hydrophobic treatment method is: placing the chip mold in a 1-4% octadecyltrichlorosilane toluene solution, the concentration of the octadecyltrichlorosilane toluene is preferably 1.5-3.5%, more preferably 2-3%; the hydrophobic treatment time is 20-30 minutes, preferably 22-28 minutes, more preferably 24-26 minutes.
[0051] In the present invention, after the hydrophobic treatment is completed, the chip mold is cleaned with analytically pure toluene and then dried.
[0052] In the present invention, the mass ratio of the PDMS and the curing agent is 10:0.5 to 10:1.5, preferably 10:0.7 to 10:1.3, and more preferably 10:0.9 to 10:1.1; the curing treatment method is to first stand for 3 to 4 hours, and then dry at 55 to 65°C, the standing time is 3 to 4 hours, preferably 3.5 hours, and the drying temperature is 55 to 65°C, preferably 56 to 64°C, and more preferably 58 to 62°C.
[0053] In the present invention, the modified glass plate obtained in step (1) is bonded to the PDMS-based template obtained in step (2), so that the detection unit on the glass plate falls into the detection area of the PDMS-based template, thereby obtaining a double-rod circulation microfluidic chip based on modification of aptamers and complementary chains; the bonding method is as follows: after the PDMS-based template and the glass plate are plasma-treated for 0.5 to 1.5 minutes, the two are bonded at 75 to 85° C. for 1 to 3 hours; the plasma treatment time is 0.5 to 1.5 minutes, preferably 1 minute; the bonding temperature is 75 to 85° C., preferably 76 to 84° C., and more preferably 78 to 82° C.; the bonding time is 1 to 3 hours, preferably 1.5 to 2.5 hours, and more preferably 2 hours.
[0054] The present invention also provides application of the double-rod circulation microfluidic chip in microbial detection.
[0055] In the present invention, the microorganism is one or more of Staphylococcus aureus, Vibrio parahaemolyticus and Salmonella typhimurium.
[0056] The present invention also provides a method for detecting microorganisms using the dual-rod circulation microfluidic chip, comprising the following steps:
[0057] (1) PBS buffer solution was used to prepare mixed microbial solutions of different concentrations. The concentrations of each microorganism in the mixed solution were independently 0, 20, 40, 60, 80, and 100 μM. Six chips were prepared. 0.5 to 1.0 mL of microbial solution of different concentrations was injected into each chip using a syringe. The solution was pressed into the chip and the chip was fixed on a rotator and rotated at a speed of 50 to 70 r / min for 15 to 25 min.
[0058] (2) Remove the chip and inject 0.5-1.0 mL of 1-5 μM SYBR Green Ι into each chip using a syringe. Press it into the chip and react for 5-10 minutes. Irradiate with ultraviolet light and read the RGB value using the "color selection" software. Draw a standard curve with the microbial concentration as the horizontal axis and the RGB value as the vertical axis.
[0059] (3) Read the RGB value when the sample to be tested is exposed to ultraviolet light, and substitute the obtained RGB value into the standard curve to obtain the concentration of multiple microorganisms in the sample to be tested.
[0060] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0061] Example 1
[0062] This embodiment provides a dual-rod circulation microfluidic chip for detecting Staphylococcus aureus, comprising a glass plate and a PDMS-based template; three detection units are arranged on the glass plate, each detection unit comprising two regions, A and B, region A modifies a complex formed by a partially complementary chain and an aptamer, and region B modifies a completely complementary chain; the PDMS-based template comprises an injection area, a microfluidic channel, and a detection area; the injection area is connected to the detection area via the microfluidic channel; the injection area has a hollow design, and the microfluidic channel and the detection area have a hollow and closed design; the PDMS-based template is bonded to the top of the glass plate, and the detection area of the PDMS-based template overlaps with the detection units on the glass plate.
[0063] The preparation method of the double-rod circulation microfluidic chip is as follows:
[0064] (1) Soak the glass slide in analytically pure anhydrous ethanol, deionized water, and analytically pure anhydrous ethanol, sequentially, ultrasonically treat each for 10 minutes, and dry. Then soak it in a 0.1 mol / L PDDA aqueous solution for 1 hour, rinse with deionized water, and dry. Then, plasma treat it in a plasma cleaner for 1 minute. Place a mask on the plasma-treated side of the glass slide (exposing only the portion to be gold-sprayed), and spray it with a gold sprayer for 3 minutes to a thickness of approximately 0.1 mm.
[0065] (2) Two regions, A and B, were designed on the gold-sprayed area of the glass slide. Region A was modified with a complex formed by a partial complementary chain of Staphylococcus aureus and an aptamer by mixing the complex formed by the partial complementary chain and the aptamer with 1.0 mM Tcep at a molar ratio of 1:100, reducing it for 60 minutes, and then evenly dropping the complex formed by the reduced partial complementary chain and the aptamer on 4 drops of region A and allowing it to react for 30 minutes. Region B was modified with a complete complementary chain of Staphylococcus aureus by mixing the complete complementary chain with 1.0 mM Tcep at a molar ratio of 1:100, reducing it for 60 minutes, and evenly dropping the complete complementary chain on 4 drops of region B and allowing it to react for 30 minutes. Regions A and B were then washed several times with PBS solution and dried.
[0066] The sequences of the partial complementary chain, aptamer and complete complementary chain of Staphylococcus aureus are as follows:
[0067] Staphylococcus aureus complete DNA complementary chain (SEQ ID NO. 1): HS-TTTTTACGGGCGTGATGCTTGCATGGCTGAAACGTTCCCACTGCTGCG;
[0068] Staphylococcus aureus aptamer (SEQ ID NO. 2): CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT;
[0069] Partial complementary DNA chain of Staphylococcus aureus (SEQ ID NO. 3): CCCACTGCTGCGGTGTGTTTTT-SH.
[0070] (3) Use AI graphics to set up the chip mold. Import the designed graphics into jdpaint software, set its engraving path and depth, and use an engraving machine to engrave the chip mold. Use 2% analytical grade octadecyltrichlorosilane (OTS) toluene solution for hydrophobic treatment for 30 minutes, then clean it with analytical grade toluene and dry it.
[0071] (4) Preparation of PDMS-based template: PDMS and curing agent were fully mixed and stirred evenly, with the mass ratio of PDMS to curing agent being 10:1. The mixture was poured into a hydrophobically treated chip mold, and air bubbles were removed by vacuuming. The mixture was placed at room temperature for 4 h, and then placed in a 60°C oven to completely cure to obtain a PDMS-based template.
[0072] (5) Plasma bonding of the glass plate and the PDMS-based template is performed by placing the PDMS-based template and the side of the glass sheet obtained in step (2) to be bonded together in a plasma cleaner for plasma treatment for 1 minute (with the side to be bonded facing upward), and then aligning the two and bonding them in an 80°C oven for bonding for 2 hours, thereby preparing a double-rod circulation microfluidic chip for detecting Staphylococcus aureus.
[0073] Example 2
[0074] This embodiment provides a double-rod circulating microfluidic chip for detecting Vibrio parahaemolyticus, comprising a glass plate and a PDMS-based template; three detection units are arranged on the glass plate, each detection unit comprising two regions A and B, region A modifies a complex formed by a partial complementary chain and an aptamer, and region B modifies a completely complementary chain; the PDMS-based template comprises an injection area, a microfluidic channel, and a detection area; the injection area is connected to the detection area through the microfluidic channel; the injection area is hollow in design, and the microfluidic channel and the detection area are hollow and closed in design; the PDMS-based template is bonded to the top of the glass plate, and the detection area of the PDMS-based template overlaps with the detection unit on the glass plate.
[0075] The preparation method of the double-rod circulation microfluidic chip is as follows:
[0076] (1) Soak the glass slide in analytically pure anhydrous ethanol, deionized water, and analytically pure anhydrous ethanol, sequentially, ultrasonically treat each for 5 minutes, and dry. Then soak it in a 0.15 mol / L PDDA aqueous solution for 0.5 hours, rinse with deionized water, and dry. Then, use a plasma cleaner to treat the glass slide for 1.5 minutes. Place a mask on the plasma-treated side of the glass slide (exposing only the portion to be gold-sprayed), and spray it with a gold sprayer for 2 minutes to a thickness of approximately 0.05 mm.
[0077] (2) Two regions, A and B, were designed on the gold-sprayed area of the glass slide. Region A was modified with a complex formed by a partial complementary chain of Vibrio parahaemolyticus and an aptamer by mixing the complex formed by the partial complementary chain and the aptamer with 1.5 mM Tcep at a molar ratio of 0.8:100, reducing it for 50 minutes, and then evenly dropping the complex formed by the reduced partial complementary chain and the aptamer onto 4 drops of region A and allowing it to react for 25 minutes. Region B was modified with a complete complementary chain of Vibrio parahaemolyticus by mixing the complete complementary chain with 1.5 mM Tcep at a molar ratio of 0.8:100, reducing it for 50 minutes, and then evenly dropping the complete complementary chain onto 4 drops of region B and allowing it to react for 25 minutes. Regions A and B were then washed several times with PBS solution and dried.
[0078] The sequences of the partial complementary chain, aptamer and complete complementary chain of Vibrio parahaemolyticus are as follows:
[0079] Vibrio parahaemolyticus complete DNA complementary chain (SEQ ID NO. 4): HS-TTTTTAGTATCTCAACGAGTCACTGTTTCTTTGCCCATTTTTAGA;
[0080] Vibrio parahaemolyticus aptamer (SEQ ID NO. 5): ATTCGTCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT;
[0081] Partial complementary DNA chain of Vibrio parahaemolyticus (SEQ ID NO. 6): ATTTTTAGACGAATTTTTT-SH.
[0082] (3) Use AI graphics to set up the chip mold. Import the designed graphics into jdpaint software, set its engraving path and depth, and use an engraving machine to engrave the chip mold. Use 3% analytical grade octadecyltrichlorosilane (OTS) toluene solution for hydrophobic treatment for 25 minutes, then clean it with analytical grade toluene and dry it.
[0083] (4) Preparation of PDMS-based template: PDMS and curing agent were fully mixed and stirred evenly, with the mass ratio of PDMS to curing agent being 10:1.2. The mixture was poured into a hydrophobically treated chip mold, and air bubbles were removed by vacuuming. The mixture was placed at room temperature for 3.5 h, and then placed in a 55°C oven to completely cure to obtain a PDMS-based template.
[0084] (5) Plasma bonding of the glass plate and the PDMS-based template is performed by placing the PDMS-based template and the side of the glass sheet obtained in step (2) to be bonded into a plasma cleaner for plasma treatment for 1.5 minutes (with the side to be bonded facing upwards), and then aligning and bonding the two and placing them in a 75°C oven for bonding for 2.5 hours, thereby preparing a double-rod circulation microfluidic chip for detecting Vibrio parahaemolyticus.
[0085] Example 3
[0086] This embodiment provides a dual-rod circulating microfluidic chip for detecting Salmonella typhimurium, comprising a glass plate and a PDMS-based template; three detection units are provided on the glass plate, each detection unit comprising two regions, A and B; region A modifies a complex formed by a partially complementary chain and an aptamer, and region B modifies a fully complementary chain; the PDMS-based template comprises an injection area, a microfluidic channel, and a detection area; the injection area is connected to the detection area via the microfluidic channel; the injection area has a hollow design, and the microfluidic channel and the detection area have a hollow, closed design; the PDMS-based template is bonded to the top of the glass plate, and the detection area of the PDMS-based template overlaps with the detection units on the glass plate.
[0087] The preparation method of the double-rod circulation microfluidic chip is as follows:
[0088] (1) Soak the glass slide in analytically pure anhydrous ethanol, deionized water, and analytically pure anhydrous ethanol, sequentially, ultrasonically treat each for 15 minutes, and dry. Then soak it in a 0.08 mol / L PDDA aqueous solution for 1.5 hours, rinse with deionized water, and dry. Then, plasma treat it in a plasma cleaner for 0.5 minutes. Attach a mask to the plasma-treated side of the glass slide (exposing only the portion to be gold-sprayed), and spray it with a gold sprayer for 3 minutes to a thickness of approximately 0.1 mm.
[0089] (2) Two regions, A and B, were designed on the gold-sprayed area of the glass slide. Region A was modified with a complex formed by the partial complementary chain of Salmonella typhimurium and the aptamer by mixing the complex formed by the partial complementary chain and the aptamer with 0.8 mM Tcep at a molar ratio of 1.2:100, reducing it for 45 minutes, and then evenly dropping the complex formed by the reduced partial complementary chain and the aptamer on 4 drops of region A and allowing it to react for 20 minutes. Region B was modified with the complete complementary chain of Salmonella typhimurium by mixing the complete complementary chain with 0.8 mM Tcep at a molar ratio of 1.2:100, reducing it for 45 minutes, and then evenly dropping the reduced complete complementary chain on 4 drops of region B and allowing it to react for 20 minutes. Regions A and B were then washed several times with PBS solution and dried.
[0090] The sequences of the partial complementary chain, adaptor and complete complementary chain of Salmonella typhimurium are as follows:
[0091] Salmonella typhimurium complete DNA complementary chain (SEQ ID NO. 7): HS-TTTTTCTGTCATAATGTCAAGTCCCCGTCGGGTGACGCCGCCATA;
[0092] Salmonella typhimurium aptamer (SEQ ID NO. 8): ATTCGTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG;
[0093] Partial complementary DNA chain of Salmonella typhimurium (SEQ ID NO. 9): GCCGCCATACGAATTTTTT-SH.
[0094] (3) Use AI graphics to set up the chip mold. Import the designed graphics into jdpaint software, set its engraving path and depth, and use an engraving machine to engrave the chip mold. Use 1% analytical grade octadecyltrichlorosilane (OTS) toluene solution for hydrophobic treatment for 30 minutes, then clean it with analytical grade toluene and dry it.
[0095] (4) Preparation of PDMS-based template: PDMS and curing agent were fully mixed and stirred evenly, with the mass ratio of PDMS to curing agent being 10:0.8. The mixture was poured into a hydrophobically treated chip mold, and air bubbles were removed by vacuuming. The mixture was placed at room temperature for 3 h, and then placed in a 65°C oven to completely cure to obtain a PDMS-based template.
[0096] (5) Plasma bonding of the glass plate and the PDMS-based template is performed by placing the PDMS-based template and the side of the glass sheet obtained in step (2) to be bonded together in a plasma cleaner for plasma treatment for 0.5 min (with the side to be bonded facing upward), and then aligning the two and bonding them in an 85°C oven for bonding for 2 h, thereby preparing a double-rod circulation microfluidic chip for detecting Salmonella typhimurium.
[0097] Experimental Example 1
[0098] The preparation principle diagram of the double-rod circulation microfluidic chip prepared in Examples 1 to 3 is as follows: Figure 1 The design diagram of the double-rod circulation microfluidic chip is shown in Figure 2 As shown in the figure, the double-rod circulation microfluidic chip based on the modification of aptamers and complementary chains is shown in Figure 3 shown.
[0099] The detection method for Staphylococcus aureus using a double-rod circulating microfluidic chip is as follows:
[0100] (1) A series of Staphylococcus aureus solutions of different concentrations were prepared using PBS buffer solution, such that the concentrations of Staphylococcus aureus were 0 μM, 20 μM, 40 μM, 60 μM, 80 μM, and 100 μM, respectively, to obtain 6 Staphylococcus aureus solutions of different concentrations.
[0101] (2) Signal amplification: Take the double-rod circulation microfluidic chip (6 pieces) prepared in Example 1, inject 1.0 mL of Staphylococcus aureus solution of different concentrations into the chip by pressing it with a syringe, and fix the chip on a rotator and rotate it at 60 r / min for 20 min.
[0102] (3) Reading RGB values: Remove the chip after the reaction in step (2), inject 1.0 mL of 2 μM SYBR Green Ι into each chip with a syringe, press it into the chip, react for 10 minutes, place it in the lower layer of the black box, irradiate it with ultraviolet light, place the smartphone on the upper end of the black box, read the RGB values using the "Color Picker" software, and draw a standard curve with the microbial concentration as the horizontal axis and the RGB value as the vertical axis.
[0103] The method for drawing the standard curves of Vibrio parahaemolyticus and Salmonella typhimurium is the same as above. The standard curves of the three microorganisms are as follows: Figure 4 The linear equation is shown in Table 1.
[0104] Table 1. Linear equations for Salmonella typhimurium, Vibrio parahaemolyticus, and Staphylococcus aureus
[0105]
[0106]
[0107] (4) Real sample processing and determination: After filtering the river water sample (from Yongjiang River, Ningbo City, Zhejiang Province), 1 mL was taken and placed in a 1.5 mL centrifuge tube. Centrifuge at 10,000 r / min for 5 minutes, remove the supernatant, and resuspend in 1 mL PBS buffer. Repeat the above steps (2) and (3) to obtain the RGB value data of the river water sample. Substitute it into the standard curve equation to calculate the concentration of the three microorganisms in the sample. The results of the three replicates of the sample were not detected (<5 μM). The spike recovery experiment was also carried out, with three replicates for each concentration, and the relative standard deviation was calculated. The results are shown in Table 2. This method proves that the recovery rate is very good.
[0108] Table 2. Concentrations and spike recovery results of Salmonella typhimurium, Vibrio parahaemolyticus, and Staphylococcus aureus in river water
[0109]
[0110] Experimental Example 2
[0111] The anti-interference ability of the dual-rod circulation microfluidic chip for detecting Staphylococcus aureus prepared in Example 1 was tested for other microorganisms, including Escherichia coli, Salmonella typhimurium, and Vibrio parahaemolyticus. The concentration of each microorganism was 60 μM. The results are as follows: Figure 5 As shown. Figure 5 It can be seen that the modification of the partial complementary chain, aptamer and complete complementary chain A and B regions corresponding to Staphylococcus aureus can only produce a significant signal increase and generate fluorescence, that is, read RGB values, for Staphylococcus aureus, while there is almost no fluorescence reaction for the other microorganisms. This shows that the double-rod circulating microfluidic chip based on the modification of aptamers and complementary chains of the present invention has strong specificity for the A and B regions modified to correspond to different microorganisms, and other microorganisms will not interfere with the detection system.
[0112] As can be seen from the above embodiments and experimental examples, the present invention provides a dual-rod circulating microfluidic chip based on aptamer and complementary chain modification, and its preparation method and application. The dual-rod circulating microfluidic chip can be used for microbial detection with high accuracy, simple operation and strong specificity.
[0113] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A dual-rod circulating microfluidic chip modified with aptamer and complementary strand, characterized in that, it includes a glass plate and a PDMS-based template; several detection units are arranged on the glass plate, and each detection unit includes two regions A and B. Region A is modified with a complex formed by a partial complementary strand and an aptamer, and region B is modified with a complete complementary strand; The PDMS-based template includes a sample injection area, a microfluidic channel and a detection area; the sample injection area is connected to several detection areas through several microfluidic channels respectively; the sample injection area is a hollowed-out design, and the microfluidic channel and the detection area are hollow and closed designs; The PDMS-based template is bonded above the glass plate, and the detection area of the PDMS-based template overlaps with the detection unit on the glass plate; The method for detecting microorganisms by the dual-rod circulating microfluidic chip includes the following steps: (1) Prepare microbial mixed solutions with different concentrations using PBS buffer solution. The concentration of each microorganism in the mixed solution is independently 0, 20, 40, 60, 80, 100 μM. Prepare 6 chips, and inject 0.5 - 1.0 mL of microbial solutions with different concentrations into each chip using a syringe, and enter the chip in a pressing manner. Fix the chip on a rotator and rotate it at a speed of 50 - 70 r / min for 5 - 25 min; (2) Remove the chip, inject 0.5 - 1.0 mL of 1 - 5 mM SYBR Green I into each chip using a syringe, and enter the chip in a pressing manner. React for 5 - 10 min, irradiate with ultraviolet light, read the RGB value using "Color" software, and plot a standard curve with the microbial concentration as the abscissa and the RGB value as the ordinate; (3) Read the RGB value when the sample to be detected is irradiated with ultraviolet light, and substitute the obtained RGB value into the standard curve to obtain the concentrations of various microorganisms in the sample to be detected.
2. The preparation method of the dual-rod circulating microfluidic chip according to claim 1, characterized in that, it includes the following steps: (1) Perform mask gold spraying on each detection unit of the glass plate. Region A is modified with a complex formed by a partial complementary strand and an aptamer, and region B is modified with a complete complementary strand; (2) Hydrophobically treat the chip mold, pour the PDMS and curing agent mixture into the chip mold, and obtain the PDMS-based template after curing; (3) Bond the modified glass plate obtained in step (1) with the PDMS-based template obtained in step (2) so that the detection unit on the glass plate falls into the detection area of the PDMS-based template, and obtain a dual-rod circulating microfluidic chip modified with aptamer and complementary strand.
3. According to the preparation method described in claim 2, characterized in that, before the mask gold spraying in step (1), the glass plate is pretreated, and the pretreatment method is: The glass plate is successively immersed in absolute ethanol, water, and absolute ethanol, ultrasonically treated for 5 - 15 min respectively, dried, soaked in 0.05 - 0.15 mol / L PDDA aqueous solution for 0.5 - 1.5 h, and dried and then plasma treated for 0.5 - 1.5 min.
4. According to the preparation method described in claim 2, characterized in that, the modification method of region A in step (1) is: Mix the complex formed by the partially complementary strand and the aptamer with Tcep at a concentration of 0.5 - 1.5 mM in a molar ratio of 0.5:100 - 1.5:100, and reduce for 30 - 60 min. Then, add the reduced complex formed by the partially complementary strand and the aptamer dropwise to region A and react for 20 - 30 min. The modification method for region B is as follows: Mix the fully complementary strand with Tcep at a concentration of 0.5 - 1.5 mM in a molar ratio of 0.5:100 - 1.5:100, and reduce for 30 - 60 min. Then, add the reduced fully complementary strand dropwise to region B and react for 20 - 30 min.
5. The preparation method according to claim 2, characterized in that, the hydrophobic treatment method in step (2) is: put the chip mold into an octadecyltrichlorosilane toluene solution with a concentration of 1 - 4%; the hydrophobic treatment time is 20 - 30 min.
6. The preparation method according to claim 2, characterized in that, the mass ratio of PDMS to the curing agent in step (2) is 10:0.5 - 10:1.5; the curing treatment method is to stand still for 3 - 4 h first, and then dry at 55 - 65 °C.
7. The preparation method according to claim 2, characterized in that, the bonding method in step (3) is: After plasma treating the PDMS-based template and the glass plate for 0.5 - 1.5 min, bond the two together at 75 - 85 °C for 1 - 3 h.
8. The application of the double-rod circulating microfluidic chip according to claim 1 in microbial detection.
9. The application according to claim 8, characterized in that, the microorganism is one or more of Staphylococcus aureus, Vibrio parahaemolyticus, and Salmonella typhimurium.
Citation Information
Patent Citations
Detection method of food-borne pathogenic bacteria based on micro-fluidic chip
CN113533719A