Biaryl derivatives useful as diacylglycerol acyltransferase 2 inhibitors and their uses

Abstract

The present invention relates to a biaryl derivative compound which exhibits diacylglycerol acyltransferase 2 (DGAT2) inhibitory activity and is represented by chemical formula (1), a pharmaceutical composition comprising the compound as an active ingredient, and use thereof.

Description

Technical Field

[0001] The present invention relates to a biaryl derivative compound represented by formula (1) which exhibits inhibitory activity against diacylglycerol acyltransferase 2 (DGAT2), a pharmaceutical composition comprising the compound as an active ingredient, and use thereof. Background Art

[0002] Along with economic development, the raising of living standard, the frequent consumption of instant food and the change of eating habits mainly based on meat, cause the excessive accumulation of heat in the body.These changes in modern people's diet and life also cause the reduction of caloric consumption caused by lack of exercise, cause the serious prevalence of metabolic diseases such as obesity, hyperlipidemia, diabetes, cardiovascular disease, coronary artery disease.Specifically, obesity is one of rapidly increasing diseases, and is reported to be the cause of metabolic diseases such as diabetes.The function of the enzyme of the biosynthetic pathway of triglyceride participating in the main cause of obesity is developed to be used for the therapeutic agent of metabolic diseases, which is causing people's concern.

[0003] Neutral fats such as triglycerides (TG) play a very important role in storage function as an energy source in the body. However, when neutral fats are excessively accumulated in organs or tissues, they cause obesity, hypertriglyceridemia, fatty liver, etc., thereby causing serious diseases such as diabetes, arteriosclerosis, metabolic disorders and organ dysfunction. Diacylglycerol acyltransferase is a key enzyme in triglyceride biosynthesis, present in various different tissues of mammals, and is an enzyme that synthesizes TG by combining fatty acyl-CoA with the hydroxyl group of diacylglycerol in the last step of the phosphoglycerol pathway, which is the main pathway for triglyceride synthesis. It is currently known that there are two subtypes, DGAT1 and DGAT2. Although their biochemical functions are similar, the difference is that DGAT1 is mainly expressed in the small intestine and adipose tissue, while DGAT2 is mainly expressed in the liver and adipose tissue. In addition, in terms of gene family, DGAT1 belongs to the ACAT family, while DGAT2 belongs to the MGAT family. Therefore, it is expected that their roles in TG biosynthesis are also different.

[0004] Several studies, including animal studies, show that DGAT2 contributes mainly to the biosynthesis of TG in vivo. Unlike DGAT2 knockout mice, which hardly synthesize TG and die shortly after birth due to skin layer abnormalities, DGAT1 knockout mice show a slight decrease in TG levels, and there is no problem with the survival of mice (Stone SJ et al., 2000. Nat. Genet. 25: 87-90). In addition, as a result of reducing the expression level of DGAT1 or DGAT2 by using antisense oligonucleotides (ASO) in fatty liver animal models, fatty liver symptoms will only be alleviated when the amount of DGAT2 is reduced, and the production rate of glucose in the liver will be significantly reduced (Choi CS et al., 2007. Hepatology. 45: 1366-74).

[0005] The underlying molecular mechanisms have not yet been fully elucidated, but it is believed that inhibition of DGAT2 leads to down-regulation of the expression of genes encoding multiple proteins involved in lipid production, such as sterol regulatory element binding protein 1c (SREBP1c) and stearoyl-CoA-desaturase 1 (SCD1). At the same time, it is believed that the oxidative pathway is induced by an increase in genes such as carnitine palmitoyltransferase 1 (CPT1). This change in turn leads to a decrease in liver DAG and TAG lipid levels, thereby improving insulin responsiveness in the liver. In addition, inhibition of DGAT2 inhibits liver VLDL TAG secretion and reduces circulating cholesterol levels. Finally, plasma apolipoprotein B (APOB) levels are suppressed, which is believed to be caused by a reduced supply of TAG in the lipidation of newly synthesized APOB protein. That is, when DGAT2 is inhibited, beneficial effects on both blood sugar control and plasma cholesterol profiles are shown, which means that inhibition of DGAT2 can be applied to the treatment of metabolic disorders. Summary of the invention

[0006] Technical issues

[0007] An object of the present invention is to provide a novel biaryl derivative compound represented by formula (1) which exhibits inhibitory activity against diacylglycerol acyltransferase 2 (DGAT2).

[0008] Another object of the present invention is to provide a method for preparing the biaryl derivative compound.

[0009] Another object of the present invention is to provide a pharmaceutical composition comprising the biaryl derivative compound as an active ingredient for treating metabolic diseases associated with DGAT2 and a preparation method thereof.

[0010] Another object of the present invention is to provide a method for treating a metabolic disease associated with DGAT2 in a subject, wherein the efficacy in a disease animal model is improved and the efficacy and convenience of administration in the subject are improved by using a biaryl derivative compound having improved physical and chemical properties compared to conventional compounds as an active ingredient.

[0011] Technical Solutions

[0012] In order to achieve the above object, the present invention provides a compound of the following formula (1) or a pharmaceutically acceptable salt or isomer thereof:

[0013] [Formula (1)]

[0014]

[0015] in

[0016] A, D and E are each independently CH or N;

[0017] R1 is alkyl, cycloalkyl or haloalkyl;

[0018] R2 is -GJL;

[0019] wherein G is -C(=O)- or a direct bond;

[0020] J is alkylene, alkenylene, alkylene-arylene, alkenylene-arylene, alkyleneoxy-arylene, arylene, heteroarylene-heterocycloalkylene, heteroarylene-arylene, or heteroarylene-oxy-cycloalkylene;

[0021] L is hydrogen, halogen, amino, nitro, carboxyl (-COOH), carboxylalkyl, carboxylalkoxy, cycloalkyl or aryl;

[0022] wherein the alkyl, alkylene, carboxyalkyl, carboxyalkoxy or aryl is optionally substituted with one or more substituents selected from hydroxy, halogen, alkyl and alkoxy; and

[0023] The heterocycloalkylene or heteroarylene group includes one or more heteroatoms selected from N, O and S.

[0024] The compound of formula (1) according to the present invention can form a pharmaceutically acceptable salt. Pharmaceutically acceptable salts can include acid addition salts formed from the following acids: inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrobromic acid and hydroiodic acid, organic acids such as tartaric acid, formic acid, citric acid, acetic acid, trichloroacetic acid, trifluoroacetic acid, gluconic acid, benzoic acid, lactic acid, fumaric acid, maleic acid and salicylic acid, or sulfonic acids such as methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid and p-toluenesulfonic acid, the acid forming a non-toxic acid addition salt comprising a pharmaceutically acceptable anion. In addition, pharmaceutically acceptable carboxylates include salts with alkali metals or alkaline earth metals such as lithium, sodium, potassium, calcium and magnesium, salts with amino acids such as lysine, arginine and guanidine, organic salts such as dicyclohexylamine, N-methyl-D-glucamine, tris(hydroxymethyl)methylamine, diethanolamine, choline and triethylamine. The compound of formula (1) according to the present invention can be converted into their salts by conventional methods.

[0025] Meanwhile, since the compounds of formula (1) according to the present invention may have an asymmetric carbon center and an asymmetric axis or plane, they may exist as E- or Z-isomers, R- or S-isomers, racemic mixtures or diastereomeric mixtures and each diastereoisomer, all of which are within the scope of the present invention.

[0026] Herein, unless otherwise indicated, the term "compound of formula (1)" is used to refer to all compounds of formula (1), including pharmaceutically acceptable salts and isomers thereof.

[0027] Herein, the compounds of formula (1) are defined using the following concepts for the definition of substituents.

[0028] The term "halogen" or "halo" means fluorine (F), chlorine (Cl), bromine (Br) or iodine (I).

[0029] The term "alkyl" or "alkylene" means a straight or branched chain hydrocarbon, which may contain single, double or triple bonds, and is preferably C1-C 10 Alkyl or C1-C 10 Alkylene or C1-C7 alkyl or C1-C7 alkylene. Examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, ethynyl, vinyl, trifluoromethyl, etc.

[0030] The term "alkenyl" or "alkenylene" means a straight or branched chain hydrocarbon having at least one carbon-carbon double bond, and preferably a C2-C 10 Alkenyl or C2-C 10 Alkenylene or C2-C7 alkenyl or C2-C7 alkenylene. Examples of alkenyl include, but are not limited to, vinyl, allyl, butenyl, isopropenyl, isobutenyl, etc.

[0031] The term "cycloalkyl" means a partially or fully saturated monocyclic or fused-cyclic hydrocarbon, and is preferably C3-C 10 - Cycloalkyl. Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and the like.

[0032] Unless otherwise defined, the term "alkoxy" means an alkoxy group having 1 to 10 carbon atoms.

[0033] The term "aryl" or "arylene" means an aromatic hydrocarbon, preferably a C5-C 12 Aryl or C5-C 12 Arylene, more preferably C6-C 10 Aryl or C6-C 10 Arylene, and includes but is not limited to phenyl, naphthyl, and the like.

[0034] The term "heteroaryl" or "heteroarylene" means a 3- to 12-membered, more preferably a 5- to 12-membered aromatic hydrocarbon, which forms a monocyclic or fused ring (which may be fused to a benzene ring or a C3-C8 cycloalkyl) including one or more heteroatoms selected from N, O and S as ring members. Examples of heteroaryl include, but are not limited to, pyridyl, pyrimidinyl, pyridazinyl, pyrazinyl, Oxazolyl, iso Oxazolyl, tetrazolyl, triazolyl, indolyl, indazolyl, iso Azolyl, oxazolyl, thiazolyl, isothiazolyl, furanyl, benzofuranyl, imidazolyl, thiophenyl, benzothiazole, benzimidazole, quinolyl, indolyl, 1,2,3,4-tetrahydroisoquinolyl, 3,4-dihydroisoquinolyl, thiazolopyridyl, 2,3-dihydrobenzofuran, 2,3-dihydrothiophene, 2,3-dihydroindole, benzo[1,3]dihydro Chroman, thiochroman, 1,2,3,4-tetrahydroquinoline, 4H-benzo[1,3]diol 2,3-Dihydrobenzo[1,4]-dihydro English: English, 6,7-dihydro-5H-cyclopenta[d]pyrimidine, etc.

[0035] The term "heterocycloalkyl" or "heterocycloalkylene" means a partially or fully saturated hydrocarbon that forms a monocyclic or condensed ring including one or more heteroatoms selected from N, O and S, and is preferably a 3- to 12-membered heterocycloalkyl or heterocycloalkylene or a 5- to 12-membered heterocycloalkyl or heterocycloalkylene. Examples of heterocycloalkyl or heterocycloalkylene include, but are not limited to, pyrrolidinyl, piperidinyl, morpholinyl, imidazolinyl, piperazinyl, tetrahydrofuran, tetrahydrothiofuran, and the like.

[0036] According to one embodiment of the present invention, in the above formula (1)

[0037] A, D and E are each independently CH or N;

[0038] R1 is C1-C7 alkyl, C3-C 10 Cycloalkyl or halo-C1-C7 alkyl;

[0039] R2 is -GJL;

[0040] wherein G is -C(=O)- or a direct bond;

[0041] J is C1-C7 alkylene, C2-C7 alkenylene, C1-C7 alkylene-C6-C 10 Arylene, C2-C7 alkenylene-C6-C 10 Arylene, C1-C7 alkyleneoxy-C6-C 10 Arylene, C6-C 10 arylene, 5 to 12 membered heteroarylene-5 to 12 membered heterocycloalkylene, 5 to 12 membered heteroarylene-C6-C 10 Arylene or 5 to 12 membered heteroarylene-oxy-C3-C 10 Cycloalkylene;

[0042] L is hydrogen, halogen, amino, nitro, carboxyl, carboxyl-C1-C7 alkyl, carboxyl-C1-C7 alkoxy, C3-C 10 Cycloalkyl or C6-C 10 Aryl;

[0043] wherein the alkyl, alkylene, carboxyalkyl, carboxyalkoxy or aryl is optionally substituted with 1 to 4 substituents selected from hydroxy, halogen, C1-C7 alkyl and C1-C7 alkoxy; and

[0044] The heterocycloalkylene or heteroarylene group includes 1 to 4 heteroatoms selected from N, O and S.

[0045] Representative compounds of formula (1) according to the present invention include but are not limited to the following compounds:

[0046] N-(6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)-3-phenylpropanamide;

[0047] Methyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)acetate;

[0048] 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)acetic acid;

[0049] 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)acetic acid;

[0050] Methyl 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)-2-methylpropanoate;

[0051] Ethyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-difluoroacetate;

[0052] 3-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-dimethylpropanoic acid;

[0053] (R)-1-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid;

[0054] 3-(3-(6-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid;

[0055] N-(6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)-3-phenylpropanamide;

[0056] 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)acetic acid;

[0057] 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)acetic acid;

[0058] 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenoxy)-2-methylpropanoic acid;

[0059] 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl-2,2-difluoroacetic acid;

[0060] 3-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-dimethylpropanoic acid;

[0061] 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)-2-methylpropanoic acid;

[0062] (E)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-ketopropan-1-phenyl-1-yl)phenyl)-2-methylpropanoic acid;

[0063] 3-(4-(1-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-methyl-1-ketopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid;

[0064] 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenoxy-2-methylpropanoic acid;

[0065] 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)phenyl)acetic acid;

[0066] (1r,4r)-4-((2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)oxy)cyclohexane-1-carboxylic acid;

[0067] N-(6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)-3-phenylpropanamide;

[0068] 3-(4-(2-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-dimethylpropanoic acid;

[0069] (R)-1-(2-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid;

[0070] 3-(3-(6-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid;

[0071] 2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)-2-methylpropanoic acid;

[0072] 3-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-dimethylpropanoic acid;

[0073] 2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenoxy)-2-methylpropanoic acid;

[0074] 3-(4-(1-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-methyl-1-ketopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid;

[0075] 2-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenoxy)-2-methylpropanoic acid;

[0076] (R)-1-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid;

[0077] 3-(3-(6-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid; and

[0078] (1r,4r)-4-((2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)oxy)cyclohexane-1-carboxylic acid.

[0079] Unless otherwise specified, the terms and abbreviations used herein retain their original meanings.

[0080] The present invention also provides a method for preparing a compound of formula (1). Hereinafter, the method for preparing a compound of formula (1) will be explained on the basis of exemplary reactions to illustrate the present invention. However, those skilled in the art can prepare the compound of formula (1) by various different methods based on the structure of formula (1), and such methods should be interpreted as being within the scope of the present invention. That is, the compound of formula (1) can be prepared by the methods described herein or by combining various different methods disclosed in the prior art, and these methods should be interpreted as being within the scope of the present invention. Therefore, the method for preparing the compound of formula (1) is not limited to the following method.

[0081] The compound of formula (1) of the present invention can be prepared by directly introducing a substituted amine group into compound (2) according to the method of the following reaction scheme 1, or by introducing a protected amine into compound (2), removing the protecting group to obtain compound (3), and performing an amidation reaction on compound (3).

[0082] [Reaction Scheme 1]

[0083]

[0084] Compound (2) can be prepared according to the method of the following reaction scheme 2 using 2-ethoxyphenol as a starting material.

[0085] [Reaction Scheme 2]

[0086]

[0087] Alternatively, compound (3) can be prepared according to the method of the following reaction scheme 3.

[0088] [Reaction Scheme 3]

[0089]

[0090] In the compounds of formula (4), amide derivatives can be obtained by treating a suitable acid with thionyl chloride or oxalyl chloride and then treating with ammonia. For example, methyl 4-(3-amino-3-ketopropyl)benzoate can be prepared according to the method of the following reaction scheme 4. In the compounds of formula (4), amine derivatives can be obtained by introducing an amino group into a compound obtained by a cross-coupling reaction between a dioxaborolane core intermediate and various types of chloroaryl compounds to synthesize an aminoaryl intermediate. For example, ethyl 2-(4-(2-aminopyrimidin-4-yl)phenyl)acetate can be prepared according to the method of the following reaction scheme 5.

[0091] [Reaction Scheme 4]

[0092]

[0093] [Reaction Scheme 5]

[0094]

[0095] A compound not specifically described in the production method of the present specification is a known compound or a compound that can be easily synthesized from a known compound by a known synthesis method or a method similar to that of the known compound.

[0096] The compound of formula (1) obtained by the above method can be isolated or purified from the reaction product by a conventional method such as recrystallization, iontophoresis, silica gel column chromatography or ion exchange chromatography.

[0097] As explained above, the compounds according to the present invention, the starting materials or intermediates used to prepare them can be prepared by a variety of different methods, which should be interpreted as being within the scope of the present invention with respect to the preparation of the compounds of formula (1).

[0098] The compound of formula (1) according to the present invention exhibits inhibitory activity against diacylglycerol acyltransferase 2 (DGAT2). Therefore, the present invention provides a pharmaceutical composition for treating a disease associated with DGAT2, comprising a compound of formula (1) or a pharmaceutically acceptable salt or isomer thereof and a pharmaceutically acceptable carrier. Various types of prodrugs that are converted into compounds of formula (1) in vivo are also within the scope of the present invention.

[0099] Exemplary diseases associated with DGAT2 that can be treated by the pharmaceutical composition of the present invention include, but are not limited to, diseases selected from fatty liver, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), diabetes, obesity, hyperlipidemia, atherosclerosis, and hypercholesterolemia.

[0100] In the present invention, in addition to the active ingredient of the present invention, "pharmaceutical composition" may also include other components such as carriers, diluents, excipients, etc. Therefore, if necessary, the pharmaceutical composition may include a pharmaceutically acceptable carrier, diluent, excipient or a combination thereof. The pharmaceutical composition facilitates the administration of the compound in the body. Various different methods of administering the compound include, but are not limited to, oral, injection, aerosol, parenteral and topical administration.

[0101] As used herein, "carrier" means a compound that facilitates the addition of a compound to cells or tissues. For example, dimethyl sulfoxide (DMSO) is a common carrier that facilitates the administration of many organic compounds into living cells or tissues.

[0102] In this article, "diluent" means a compound that not only stabilizes the biologically active form, but also dilutes the compound in the solvent in which the compound is dissolved. In the art, salts dissolved in buffers are used as diluents. A commonly used buffer is phosphate buffered saline, which simulates the salt form in body fluids. Since buffer solutions can control the pH of the solution at low concentrations, buffer diluents hardly change the biological activity of the compound.

[0103] As used herein, "pharmaceutically acceptable" means properties that do not impair the biological activity and physical properties of the compound.

[0104] The compound according to the present invention can be formulated into various pharmaceutical dosage forms. In the preparation of the pharmaceutical composition of the present invention, the active ingredient, specifically the compound of formula (1) or its pharmaceutically acceptable salt or isomer, is mixed with a pharmaceutically acceptable carrier selected in consideration of the dosage form to be prepared. For example, if necessary, the pharmaceutical composition of the present invention can be formulated into an injection, an oral preparation, etc.

[0105] The compounds of the present invention can be prepared by conventional methods using known pharmaceutical carriers and excipients, and inserted into a unit or multi-unit container. The preparation can be a solution, suspension or emulsion in an oil or aqueous solvent, and contains a conventional dispersant, suspending agent or stabilizer. In addition, the compound can be, for example, in the form of a dry powder, which is dissolved in sterilized pyrogen-free water before use. The compounds of the present invention can be formulated into suppositories using conventional suppository bases such as cocoa butter or other glycerides. Solid forms for oral administration include capsules, tablets, pills, powders and granules. Capsules and tablets are preferred. Tablets and pills are preferably enteric coated. The solid form is prepared by mixing the compound of the present invention with at least one carrier selected from an inert diluent such as sucrose, lactose or starch, a lubricant such as magnesium stearate, a disintegrant, a binder, etc.

[0106] If necessary, the compounds according to the present invention or pharmaceutical compositions containing them may be administered in combination with other drugs such as other metabolic disorder therapeutic agents.

[0107] The dosage of the compound of formula (1) of the present invention is determined by the prescription prescribed by the doctor according to the patient's body weight, age and disease condition. According to the frequency and intensity of administration, the typical dosage of an adult is in the scope of about 0.3 to 500mg every day. The typical daily dosage of adult intramuscular or intravenous administration is in the scope of about 1 to 300mg every day, and it can be administered in a unit dose. Some patients need a higher daily dosage.

[0108] As used herein, the term "treat" is used to mean preventing, delaying, or ameliorating the progression of a disease in a subject exhibiting symptoms of the disease.

[0109] Beneficial effects

[0110] The novel biaryl derivative compounds of formula (1) according to the present invention exhibit excellent inhibitory activity against diacylglycerol acyltransferase 2 (DGAT2), and thus can be usefully used for the prevention, alleviation or treatment of metabolic disorders associated with DGAT2. In addition, the novel biaryl derivative compounds of formula (1) according to the present invention exhibit increased lipophilicity and liver selectivity, thereby improving efficacy by increasing exposure to the liver, and are expected to have the advantage of convenient administration due to a relatively long half-life in disease animal models and clinical practice. DETAILED DESCRIPTION

[0111] Hereinafter, the present invention is explained in more detail using the following examples. However, it must be understood that the protection scope of the present invention is not limited to the examples.

[0112] In the following examples, M represents molar concentration and N represents equivalent concentration. In addition, the abbreviations and terms used in the reaction schemes, preparation examples and examples are described as follows:

[0113] DCM: dichloromethane

[0114] DIPEA: N,N-diisopropylethylamine

[0115] DMF: N,N-dimethylformamide

[0116] DMSO: dimethyl sulfoxide

[0117] NMP: N-methylpyrrolidone

[0118] Pd(dppf)Cl2.CH2Cl2:[1,1'-Bis(diphenylphosphino)ferrocene]palladium(II) dichloride dichloromethane complex (1:1)

[0119] TEA: triethylamine

[0120] THF: Tetrahydrofuran

[0121] PyBroP: tripyrrolidinylphosphonium bromide hexafluorophosphate

[0122] Preparation Example 1: Synthesis of 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine

[0123]

[0124] Step 1: Synthesis of 3-bromo-5-(2-ethoxyphenoxy)pyridine

[0125] 60% sodium hydride (1.82 g, 46 mmol) was added to NMP (100 ml) at 0 ° C, and 2-ethoxyphenol (6.1 g, 44 mmol) was slowly added dropwise thereto in the presence of nitrogen. After the reaction solution was stirred at room temperature for 1 hour, 3,5-dibromopyridine (7.2 g, 30.4 mmol) was added dropwise thereto and stirred at 150 ° C for 72 hours. After the reaction was completed, the reaction mixture was cooled to room temperature, diluted with water (120 ml), 5N sodium hydroxide aqueous solution (15 ml) was added, and extracted with ether. After dehydration on magnesium sulfate, the solvent was removed under reduced pressure and purified by column chromatography to obtain the desired product (yield: 19.5%).

[0126] 1H NMR (500 MHz, chloroform-D): δ8.32 (d, J = 1.2 Hz, 1H), 8.26 (d, J = 2.4 Hz, 1H), 7.28 (s, 1H), 7.20 (s, 1H), 7.09 (d, J = 7.9 Hz, 1H), 7.04-6.87 (m, 2H), 4.01 (t, J = 7.0 Hz, 2H), 1.24 (t, J = 7.0 Hz, 3H)

[0127] Step 2: Synthesis of (5-(2-ethoxyphenoxy)pyridin-3-yl)boronic acid

[0128] 3-Bromo-5-(2-ethoxyphenoxy)pyridine (1.74 g, 5.92 mmol), 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(1,3,2-dioxaborolane) (2.25 g, 8.87 mmol, 1.5 eq), potassium acetate (2.32 g, 23.66 mmol) and Pd(dppf)Cl2.CH2Cl2 (48 mg, 0.06 mmol) were added to toluene (30 ml) and stirred at 120° C. reflux for 12 hours. After the reaction was completed, the reaction mixture was filtered through a celite pad, washed with toluene, the solvent was removed under reduced pressure, and the next reaction was carried out without a separate purification process.

[0129] m / z(M+H) + :C 13 H 14 The calculated value of BNO4 is 259.0 and the measured value is 260.1

[0130] Step 3: Synthesis of 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine

[0131] To 1,4-di To alkane (20 ml) / water (1 ml) was added (5-(2-ethoxyphenoxy)pyridin-3-yl)boronic acid (1.53 g, 5.92 mmol), 2,6-dichloropyrazine (0.97 g, 6.5 mmol, 1.1 eq), sodium carbonate (1.25 g, 11.81 mmol) and Pd(dppf)Cl2.CH2Cl2 (48 mg, 0.06 mmol) obtained in step 2, and stirred at 120°C under reflux for 12 hours. After the reaction was completed, the obtained material was filtered through a celite pad, washed with toluene, the solvent was removed under reduced pressure, and purified by column chromatography to obtain the desired product (two-step yield: 39%).

[0132] 1H-NMR (400 MHz, chloroform-D) δ8.90 (s, 2H), 8.57 (s, 1H), 8.41 (d, j = 4 Hz, 1H), 7.81 (d, J = 4 Hz, 1H), 7.20 (m, 1H), 7.13 (m, 1H), 7.02 (m, 2H), 4.06 (q, 2H), 1.24 (t, 3H)

[0133] Preparation Example 2: Synthesis of 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine

[0134]

[0135] Step 1: Synthesis of 1-(3-bromophenoxy)-2-ethoxybenzene

[0136] 2-Ethoxyphenol (4.33 g, 31.4 mmol), 1-bromo-3-iodobenzene (6 ml, 47.1 mmol), cuprous chloride (I) (1.553 g, 15.69 mmol), 2,2,6,6-tetramethyl-3,5-heptanedione (1.310 ml, 6.27 mmol) and cesium carbonate (10.22 g, 31.4 mmol) were dissolved in 70 ml NMP and heated to 120°C. After stirring for 16 hours, the reaction mixture was cooled to room temperature. The reaction was terminated with 1N aqueous hydrochloric acid solution and then extracted with diethyl ether. The organic layer was washed with brine, dehydrated over magnesium sulfate, and the organic solvent was removed under reduced pressure. Purification was performed by silica gel column (ethyl acetate: hexane = 1: 5) to obtain the desired product (yield: 96%).

[0137] 1 H-NMR (500 MHz, chloroform-D) δ: 7.14-7.12 (m, 3H), 7.04-7.03 (m, 2H), 7.00-6.98 (m, 1H), 6.97-6.93 (m, 1H), 6.88-6.86 (m, 1H), 4.03 (q, 2H, J = 7.35 Hz), 1.26 (t, 3H, J = 7.03 Hz)

[0138] Step 2: 2-(3-(2-ethoxyphenoxyphenyl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane Synthesis

[0139] 1-(3-bromophenoxy)-2-ethoxybenzene (1.74 g, 5.94 mmol), 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(1,3,2-dioxaborolane) (2.26 g, 8.90 mmol, 1.5 eq), potassium acetate (2.33 g, 23.74 mmol) and Pd(dppf)Cl2.CH2Cl2 (48 mg, 0.06 mmol) were added to toluene (30 ml) and stirred at 120° C. reflux for 12 hours. After the reaction was completed, the obtained product was filtered through a celite pad, washed with toluene, the solvent was removed under reduced pressure, and purified by column chromatography to obtain the desired product (yield: 45%).

[0140] 1 H-NMR (500MHz, chloroform-D): δ7.48 (d, 1H), 7.43 (s, 1H), 7.28 (t, 1H), 7.09 (t, 1H), 6.94~7.03 (m, 4H), 4.06 (q, 2H), 1.32 (s, 12H), 1.28 (t, 3H)

[0141] Step 3: Synthesis of 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine

[0142] To 1,4-di 2-(3-(2-ethoxyphenoxyphenyl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (0.9 g, 2.65 mmol), 2,6-dichloropyrazine (0.43 g, 2.91 mmol, 1.1 eq), sodium carbonate (0.56 g, 5.29 mmol) and Pd(dppf)Cl2.CH2Cl2 (22 mg, 0.03 mmol) were added to 1,4-dioxane (20 ml) / water (1 ml), and stirred at 120°C under reflux for 12 hours. After the reaction was completed, the obtained product was filtered through a celite pad, washed with toluene, the solvent was removed under reduced pressure, and purified by column chromatography to obtain the desired product (yield: 75%).

[0143] 1 H-NMR (500MHz, chloroform-D) δ8.85(s,1H),8.49(s,1H),7.68(d,1H),7.61(s,1H),7.40(t,1H),7 .14(t,1H),7.05(d,J=6Hz,1H),7.02(d,J=6Hz,2H),6.95(t,1H),4.05(q,2H),1.26(t,3H)

[0144] Preparation Example 3: Synthesis of 2-chloro-6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazine

[0145]

[0146] Using 2-ethoxyphenol (1.5 g, 10.86 mmol) and 2,6-dibromopyridine (3.86 g, 16.28 mmol), the desired product was obtained in a similar manner to Preparation Example 2 (yield: 44.9%).

[0147] m / z(M+H)+:C 17 H 14 The calculated value of ClN3O2 is 327.77, and the measured value is 328.0. Preparation Example 4: Synthesis of 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine

[0148]

[0149] Step 1: Synthesis of 3-ethoxypyridine-1-oxide

[0150] 3-Ethoxypyridine (1.683 g, 13.67 mmol) was dissolved in DCM (32.5 ml), and then meta-chloroperbenzoic acid (3.07 g, 17.77 mmol) was added thereto at 10° C. and stirred at room temperature for 22 hours. Sodium thiosulfate was added and stirred at 15° C. for 3 hours. After the reaction was completed, the obtained product was extracted with DCM. The solvent was removed under reduced pressure and purified by column chromatography to obtain the desired product (yield: 87%).

[0151] 1 H-NMR (500MHz, chloroform-D) δ7.96(t,J=2.0Hz,1H),7.92-7.83(m,1H),7.15(dd,J=8.7,6 .3Hz,1H),6.86(dd,J=8.5,2.1Hz,1H),4.05(q,J=7.0Hz,2H),1.44(t,J=6.9Hz,3H)

[0152] Step 2: Synthesis of 2-(3-bromophenoxy)-3-ethoxypyridine

[0153] 3-Ethoxypyridine-1-oxide (825 mg, 5.93 mmol) and 3-bromophenol (1.02 g, 5.93 mmol) obtained in step 1 were dissolved in THF (19 ml), DIPEA (3.83 ml, 21.94 mmol) and PyBroP (3.59 g, 7.71 mmol) were added thereto, and stirred at room temperature for 17 hours. After the reaction was completed, the obtained product was concentrated under reduced pressure, diluted with DCM, and the organic layer was washed with 1N aqueous sodium hydroxide solution. The obtained product was dehydrated on magnesium sulfate, the organic solvent was removed under reduced pressure, and purified by a silica gel column to obtain the desired product (yield: 88%).

[0154] 1 H-NMR (400 MHz, chloroform-D): δ7.73 (dd, J = 5.0, 1.4 Hz, 1H), 7.28 (td, J = 3.4, 1.8 Hz, 2H), 7.24-7.19 (m, 2H), 7.12-7.02 (m, 2H), 7.02-6.91 (m, 1H), 6.82-6.66 (m, 1H), 4.13 (q, J = 7.0 Hz, 2H), 1.46 (td, J = 7.1, 4.6 Hz, 3H)

[0155] Step 3: Synthesis of 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine

[0156] Using 2-(3-bromophenoxy)-3-ethoxypyridine (1.54 g, 5.24 mmol) obtained in Step 2, the desired product was obtained in a similar manner to Steps 2 and 3 of Preparation 2 (yield: 24.4%).

[0157] 1 H-NMR (400MHz, chloroform-D): δ8.90(s,1H),8.49(s,1H),7.84(dd,J=8.7,1.4Hz,2H),7.71(dd,J=4.8,1.6Hz,1H),7.52(t,J=7. 8Hz,1H),7.33-7.26(m,1H),7.24-7.15(m,1H),6.98(dd,J=7.8,5.0Hz,1H),4.17(q,J=7.0Hz,2H),1.48(t,J=7.1Hz,3H)

[0158] Preparation Example 5: Synthesis of 3-phenylpropionamide

[0159]

[0160] 3-Phenylpropionyl chloride (4.5 ml, 30.3 mmol) dissolved in THF (46 ml) was added dropwise to aqueous ammonia (189 ml) at 0°C and then stirred for 1 hour. The organic solvent was removed under reduced pressure, diluted with water and extracted with ethyl acetate. The organic solvent was dehydrated on magnesium sulfate and removed under reduced pressure. Purification was performed by silica gel column to obtain the desired product (yield: 100%).

[0161] 1 H-NMR (500 MHz, chloroform-D): δ7.29-7.25 (m, 2H), 7.22-7.20 (m, 3H), 5.44 (s, 1H), 5.35 (s, 1H), 2.97 (t, J = 7.6 Hz, 2H), 2.53 (t, J = 7.6 Hz, 2H)

[0162] Preparation Example 6: Synthesis of methyl 2-(4-(2-amino-2-ketoethyl)phenyl)acetate

[0163]

[0164] Step 1: Synthesis of dimethyl 2,2'-(1,4-phenylene)diacetate

[0165] Acetyl chloride (2.9 ml, 40.8 mmol) was slowly added dropwise to methanol (20 ml) at 0 ° C. 1,4-phenylenediacetic acid (4.0 g, 20.6 mmol) was then dissolved, and the reaction mixture was stirred at reflux for 5 hours. After the reaction was confirmed to be complete by TLC, the obtained product was cooled to room temperature, and the organic solvent was removed under reduced pressure. The reaction product was diluted with 100 mL of ethyl acetate, washed with sodium bicarbonate aqueous solution and brine, dehydrated on magnesium sulfate, and the organic solvent was removed under reduced pressure to obtain the desired product.

[0166] 1 H-NMR (500MHz, chloroform-D):δ7.24(s,2H),3.68(s,3H),3.61(s,2H)

[0167] Step 2: Synthesis of 2-(4-(2-methoxy-2-ketoethyl)phenyl)acetic acid

[0168] The dimethyl 2,2'-(1,4-phenylene)diacetate (4.58 g, 20.6 mmol) obtained in step 1 was dissolved in THF (30 ml) and methanol (10 ml), 10 ml of 2N sodium hydroxide was slowly added dropwise thereto, and stirred at room temperature for 3 hours. The organic solvent was removed under reduced pressure, diluted with water, and acidified with 2N hydrochloric acid solution. After extraction with ethyl acetate, the organic solvent was dehydrated on magnesium sulfate and removed under reduced pressure. Recrystallization was performed to obtain the desired product (yield: 30%).

[0169] 1H-NMR (500 MHz, chloroform-D): δ7.25 (d, J=4.9 Hz, 4H), 3.68 (s, 3H), 3.66-3.62 (2H), 3.61 (s, 2H)

[0170] Step 3: Synthesis of methyl 2-(4-carbamoylphenoxy)-2-methylpropanoate

[0171] 2-(4-(2-methoxy-2-ketoethyl)phenyl)acetic acid (1.0 g, 4.8 mmol) obtained in step 2 was dissolved in 30 ml of dichloromethane, and thionyl chloride (0.7 ml, 9.6 mmol) was slowly added dropwise at room temperature. After stirring at room temperature for 4 hours, the organic solvent was removed under reduced pressure. The obtained product was dissolved in 5 ml of THF and then slowly added dropwise to 25% aqueous ammonia solution at 0°C. After stirring for 1 hour, the obtained solid was filtered to obtain the desired product (yield: 74%).

[0172] 1 H-NMR (500MHz, DMSO-D6): δ7.42(s,1H),7.15(dd,J=12.2,7.9Hz,4H),6.83(s,1H),3.60(s,2H),3.57(d,J=4.3Hz,3H),3.30(s,2H)

[0173] Preparation Example 7: Synthesis of methyl 2-(4-(3-amino-3-ketopropyl)phenyl)acetate

[0174]

[0175] Step 1: Synthesis of tert-butyl (E)-3-(4-(2-methoxy-2-ketoethyl)phenyl)acrylate

[0176] Methyl 2-(4-bromophenyl)acetate (16.4 g, 71.56 mmol), tert-butyl acrylate (18.0 g, 143.0 mmol) and triethylamine (50 ml, 0.35 mol) were dissolved in 200 ml of dimethylformamide. After removing dissolved oxygen by nitrogen bubbling, di(triphenylphosphine)palladium dichloride (2.5 g, 3.58 mmol) was added dropwise and stirred at 75 ° C for 12 hours. The organic solvent was removed under reduced pressure, diluted with ethyl acetate, washed with brine, dehydrated on magnesium sulfate, and then the organic solvent was removed under reduced pressure. Purification was performed by silica gel column (ethyl acetate: hexane = 1: 3) to obtain the desired product (yield: 79%).

[0177] 1H-NMR (500MHz, chloroform-D): δ7.56(d,J=15.9Hz,1H),7.46(d,J=8.7Hz,2H),7.28(d ,J=7.9Hz,2H),6.34(d,J=15.9Hz,1H),3.70(s,3H),3.64(s,2H),1.53(s,9H)

[0178] Step 2: Synthesis of tert-butyl 3-(4-(2-methoxy-2-ketoethyl)phenyl)propanoate

[0179] The (E)-tert-butyl 3-(4-(2-methoxy-2-ketoethyl)phenyl)acrylate (5.0 g, 18.0 mmol) obtained in step 1 was dissolved in 50 ml of methanol, and palladium carbon (0.5 g, 0.452 mmol) was added dropwise thereto. The reduction reaction was carried out by using a hydrogen balloon. After confirming the completion of the reaction, the obtained product was filtered through a celite pad, and the organic solvent was removed under reduced pressure to obtain the desired product (yield: 93%).

[0180] 1 H-NMR (500MHz, chloroform-D): δ7.17(dd,J=18.3,7.9Hz,4H),3.68(s,3H),3.59(s,2H),2.88(t,J=7.9Hz,2H),2.52(t,J=7.6Hz,2H),1.41(s,9H)

[0181] Step 3: Synthesis of 3-(4-(2-methoxy-2-ketoethyl)phenyl)propanoic acid

[0182] The tert-butyl 3-(4-(2-methoxy-2-ketoethyl)phenyl)propanoate (4.67 g, 16.8 mmol) obtained in step 2 was dissolved in 100 ml of 20% trifluoroacetic acid / dichloromethane solution and stirred at room temperature for 2 hours. After confirming the completion of the reaction, the organic solvent was removed under reduced pressure and recrystallized to obtain the desired product (yield: 100%).

[0183] 1 H-NMR (500MHz, chloroform-D): δ9.58(s,2H),7.18(dd,J=19.0,7.9Hz,4H),3.70(s,3H),3.61(s,2H),2.95(t,J=7.6Hz,2H),2.69(t,J=7.9Hz,2H)

[0184] Step 4: Synthesis of methyl 2-(4-(3-amino-3-ketopropyl)phenyl)acetate

[0185] Using 3-(4-(2-methoxy-2-ketoethyl)phenyl)propanoic acid (3.73 g, 16.8 mmol) obtained in Step 3, the desired product was obtained in a similar manner to Step 3 of Preparation Example 6 (yield: 65%).

[0186] 1 H-NMR (500MHz, chloroform-D): δ7.18(q,J=7.7Hz,4H),5.41(s,2H),3.66(d,J=15.9Hz,3H),3.59(s,2H),3.02-2.87(2H),2.51(t,J=7.6Hz,2H)

[0187] Preparation Example 8: Synthesis of methyl 2-(4-(3-amino-3-ketopropyl)phenyl-2-methylpropanoate

[0188]

[0189] Step 1: Synthesis of tert-butyl (E)-3-(4-(1-methoxy-2-methyl-1-ketopropan-2-yl)phenyl)acrylate

[0190] Using methyl 2-(4-bromophenyl)-2-methylpropanoate (1.0 g, 3.89 mmol) and tert-butyl acrylate (0.98 g, 7.8 mmol), the desired product was obtained in a similar manner to Step 1 of Preparation Example 7 (yield: 79%).

[0191] 1 H-NMR (500MHz, chloroform-D): δ7.56 (dd, J=15.9, 4.3Hz, 1H), 7.51-7.42 (2H), 7.41-7.31 (m, 2H), 6.3 4(dd,J=15.9,4.9Hz,1H),3.66(d,J=4.9Hz,3H),1.58(d,J=4.9Hz,6H),1.53(d,J=4.9Hz,9H)

[0192] Step 2: Synthesis of methyl 2-(4-(3-(tert-butoxy)-3-ketopropyl)phenyl)-2-methylpropanoate

[0193] Using (E)-tert-butyl 3-(4-(1-methoxy-2-methyl-1-ketopropan-2-yl)phenyl)acrylate (0.93 g, 3.06 mmol) obtained in Step 1, the desired product was obtained by reduction reaction in a similar manner to Step 2 of Preparation Example 7 (yield: 96%).

[0194] 1 H-NMR (500MHz, chloroform-D): δ7.23(s,2H),7.15(d,J=7.9Hz,2H),3.63(s,3H),2.87(t,J=7.9Hz,2H),2.52(t,J=7.9Hz,2H),1.55(s,6H),1.40(s,9H)

[0195] Step 3: Synthesis of 3-(4-(1-methoxy-2-methyl-1-ketopropan-2-yl)phenyl)propanoic acid

[0196] Using methyl 2-(4-(3-(tert-butoxy)-3-ketopropyl)phenyl)-2-methylpropanoate (0.90 g, 2.92 mmol) obtained in Step 2, the desired product was obtained in a similar manner to Step 3 of Preparation Example 7 (yield: 96%).

[0197] 1 H-NMR (500MHz, chloroform-D): δ7.26(d,J=7.3Hz,2H),7.16(d,J=7.9Hz,2H),3.66(s,3H),3.03-2.84(2H),2.82-2.55(2H),1.56(s,6H)

[0198] Step 4: Synthesis of methyl 2-(4-(3-amino-3-ketopropyl)phenyl)-2-methylpropanoate

[0199] Using 3-(4-(1-methoxy-2-methyl-1-ketopropan-2-yl)phenyl)propanoic acid (0.7 g, 2.8 mmol) obtained in Step 3, the desired product was obtained by amidation reaction in a similar manner to Step 3 of Preparation Example 6 (yield: 99%).

[0200] 1 H-NMR (500MHz, chloroform-D): δ7.25 (dd, J=6.4, 2.1Hz, 2H), 7.17 (d, J=7.9Hz, 2H), 5.36 ( s,2H),3.64(s,3H),3.00-2.90(2H),2.52(t,J=7.6Hz,2H),1.56(d,J=4.3Hz,6H)

[0201] Preparation Example 9: Synthesis of 2-(4-(2-ethoxy-1,1-difluoro-2-ketoethyl)phenyl)acetic acid

[0202]

[0203] Step 1: Synthesis of tert-butyl 2-(4-iodophenyl)acetate

[0204] To 2-(4-iodophenyl)acetic acid (13.0 g, 49.6 mmol) was added tert-butyl alcohol (130 ml) and stirred under nitrogen bubbling until it became transparent. Di-tert-butyl dicarbonate (10.83 g, 49.6 mmol) was added and stirred until dissolved, then 4-dimethylaminopyridine (6.06 g, 49.6 mmol) was added thereto and stirred at room temperature for 1 hour. The organic solvent was concentrated under reduced pressure and purified by a silica gel column (ethyl acetate: n-hexane = 1:9) to obtain the desired product (yield: 68.9%).

[0205] 1H-NMR (500 MHz, chloroform-D): δ7.63 (d, J = 7.95 Hz, 2H), 7.01 (d, J = 8.55 Hz, 2H), 3.45 (s, 2H), 1.42 (s, 9H)

[0206] Step 2: Synthesis of ethyl 2-(4-(2-(tert-butoxy)-2-ketoethyl)phenyl)-2,2-difluoroacetate To the activated copper powder (4.37 g, 68.6 mmol) dissolved in DMSO (80 ml) was added tert-butyl 2-(4-iodophenyl)acetate (8.4 g, 26.4 mmol) and 2-bromo-2,2-difluoroacetate (5.36 g, 26.4 mmol) obtained in step 1. After stirring at 60 ° C for 12 hours, the obtained product was poured into ice and aqueous ammonium chloride solution, and then extracted with diethyl ether. The organic layer was washed with aqueous ammonium chloride solution and brine, and then dehydrated on magnesium sulfate. The organic layer was concentrated under reduced pressure and purified by a silica gel column (ethyl acetate: n-hexane = 1: 9) to obtain the desired product (yield: 60%).

[0207] 1 H-NMR (400MHz, chloroform-D): δ7.56(d,J=8Hz,2H),7.36(d,J=8Hz,2H),4.31(q,J=8Hz,2H),1.44(s,9H),1.30(t,J=8Hz,3H)

[0208] Step 3: Synthesis of 2-(4-(2-ethoxy-1,1-difluoro-2-ketoethyl)phenyl)acetic acid

[0209] Ethyl 2-(4-(2-(tert-butoxy)-2-ketoethyl)phenyl)-2,2-difluoroacetate (5 g, 15.91 mmol) obtained in step 2 was dissolved in DCM (10 ml), and trifluoroacetic acid (15 ml) dissolved in DCM (50 ml) was added thereto, and stirred at room temperature for 1 hour. After adding toluene and removing the solvent under reduced pressure, the desired product was obtained without further purification (yield: 100%).

[0210] 1 H-NMR (500 MHz, chloroform-D): δ7.58 (d, J = 7.95 Hz, 2H), 7.37 (d, J = 7.95 Hz, 2H), 4.28 (q, J = 6.7 Hz, 2H), 3.69 (s, 2H), 1.30 (t, J = 7.03 Hz, 3H)

[0211] Preparation Example 10: Synthesis of tert-butyl 3-(4-(2-amino-2-ketoethyl)phenyl)-2,2-dimethylpropanoate

[0212]

[0213] Step 1: Synthesis of 2-(4-(3-tert-butoxy-2,2-dimethyl-3-ketopropyl)phenyl)acetic acid

[0214] Diisopropylamine (14.0ml, 98mmol) is added to anhydrous tetrahydrofuran (164ml), and 2.5M n-butyl lithium (39.3ml, 98mmol) is slowly added dropwise thereto at -78°C. The reaction solution is stirred for 20 minutes at the same temperature. After the temperature is raised to room temperature and stirred for 10 minutes, the reaction solution is again reduced to -78°C and stirred for 10 minutes. Tert-butyl isobutyrate (14.16g, 98mmol) dissolved in anhydrous tetrahydrofuran (163ml) is added dropwise to the reaction solution. The reaction solution is stirred for 1 hour at -78°C, and 2-(4-(bromomethyl)phenyl)acetic acid (7.5g, 32.7mmol) dissolved in anhydrous tetrahydrofuran (163ml) is slowly added dropwise. The reaction solution is heated to room temperature and stirred for 20 minutes. The reaction is terminated by adding 1N aqueous hydrochloric acid solution (100ml) to the reaction solution, and then extracted with diethyl ether. The organic layer was concentrated under reduced pressure and purified by silica gel column (methanol: dichloromethane = 1:9) to obtain the desired product (yield: 92%).

[0215] 1 H-NMR (500MHz, chloroform-D): δ7.20(d,J=7.9Hz,2H),7.14(d,J=7.9Hz,2H),3.64(s,2H),2.83(s,2H),1.63-1.40(m,9H),1.18-1.06(6H)

[0216] Step 2: Synthesis of tert-butyl 3-(4-(2-amino-2-ketoethyl)phenyl)-2,2-dimethylpropanoate

[0217] Using 2-(4-(3-tert-butoxy-2,2-dimethyl-3-ketopropyl)phenyl)acetic acid (6.82 g, 23.33 mmol) obtained in Step 1, the desired product was obtained in a similar manner to Step 3 of Preparation Example 6 (yield: 52.7%).

[0218] 1 H-NMR (400 MHz, chloroform-D): δ7.20-7.09 (m, 4H), 5.33 (d, J=36.1 Hz, 2H), 3.54 (s, 2H), 2.80 (s, 2H), 1.42 (s, 9H), 1.11 (s, 6H)

[0219] Preparation Example 11: Synthesis of (R)-1-(2-aminopyrimidin-4-yl)piperidine-3-carboxylic acid ethyl ester

[0220]

[0221] Step 1: R Synthesis of ethyl 1-(2-chloropyrimidin-4-yl)piperidine-3-carboxylate

[0222] 2,4-Dichloropyrimidine (0.5 g, 3.36 mmol) was dissolved in ethanol (6.71 ml), and (R)-ethyl piperidine-3-carboxylate (0.621 ml, 4.03 mmol) and TEA (0.187 ml, 1.343 mmol) were added thereto. The reaction mixture was stirred at 85 ° C for 3 hours. After removing the solvent under reduced pressure, the obtained product was dissolved in ethyl acetate and washed with water. Purification was performed by silica gel column to obtain the desired product (yield: 86%).

[0223] 1 H-NMR (500 MHz, chloroform-D): δ8.05 (d, J = 6.1 Hz, 1H), 6.47 (d, J = 6.4 Hz, 1H), 4.51-4.11 (m, 3H), 4.06 (s, 1H), 3.43 (dd, J = 13.4, 9.5 Hz, 1H), 3.36-3.21 (m, 1H), 2.67-2.46 (m, 1H), 2.22-2.03 (m, 1H), 1.96-1.79 (m, 2H), 1.69-1.59 (m, 1H), 1.33-1.23 (m, 3H)

[0224] Step 2: Synthesis of ethyl (R)-1-(2-((tert-butoxycarbonyl)amino)pyrimidin-4-yl)piperidine-3-carboxylate

[0225] The (R)-1-(2-chloropyrimidin-4-yl)piperidine-3-carboxylic acid ethyl ester (0.78 g, 2.89 mmol) obtained in step 1, tert-butyl carbamate (0.407 g, 3.47 mmol), cesium carbonate (2.36 g, 7.23 mmol), 4,5-di(diphenylphosphine)-9,9-dimethylxanthine (0.201 g, 0.347 mmol) and tris(dibenzylideneacetone)dipalladium(0) (0.265 g, 0.289 mmol) were dissolved in 50 ml of 1,4-dichloropyrimidin-4-ylpiperidine-3-carboxylic acid ethyl ester (0.78 g, 2.89 mmol), tert-butyl carbamate (0.407 g, 3.47 mmol), cesium carbonate (2.36 g, 7.23 mmol), 4,5-di(diphenylphosphine)-9,9-dimethylxanthine (0.201 g, 0.347 mmol) and tris(dibenzylideneacetone)dipalladium(0) (0.265 g, 0.289 mmol) were dissolved in 50 ml of 1,4-dichloropyrimidin-4-ylpiperidine-3-carboxylic acid ethyl ester (0.78 g, 2.89 mmol) The reaction mixture was stirred at 145 ° C for 6 hours and then cooled to room temperature. After filtering through a diatomaceous earth pad and removing the organic solvent under reduced pressure, the obtained product was dissolved in ethyl acetate and washed with salt water. The organic solvent was dehydrated on magnesium sulfate and removed under reduced pressure. Purification was carried out by a silica gel column to obtain the desired product (yield: 11.8%).

[0226] m / z(M+H)+: Calculated value for C17H26N4O4 is 350.42, found value is 351.2

[0227] Step 3: Synthesis of ethyl (R)-1-(2-aminopyrimidin-4-yl)piperidine-3-carboxylate

[0228] After dissolving (R)-1-(2-((tert-butoxycarbonyl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid ethyl ester (0.120 g, 0.342 mmol) obtained in step 2 in DCM (3 ml), trifluoroacetic acid (0.3 ml) dissolved in DCM was added thereto and stirred at room temperature for 2 hours. After removing the solvent under reduced pressure, the obtained product was dissolved in DCM and washed with water. Purification was performed by silica gel column to obtain the desired product (yield: 58.3%).

[0229] 1 H-NMR (500MHz, chloroform-D): δ7.68(d,J=6.7Hz,1H),6.49-6.21(1H),6.07(d,J=6.7Hz,1H),4.31(d,J=13.1Hz,1H),4.16(q,J=7.1Hz,2H),4.01(d,J= 13.1Hz,1H),3.43-3.30(1H),3.30-3.16(1H),2.63-2.47(m,1H),2.19- 2.03(m,1H),1.91-1.76(m,2H),1.65-1.46(m,1H),1.26(t,J=7.0Hz,3H)

[0230] Preparation Example 12: Synthesis of tert-butyl 3-(3-(6-aminopyridin-2-yl)phenyl)-2,2-dimethylpropanoate

[0231]

[0232] Step 1: Synthesis of tert-butyl 3-(3-bromophenyl)-2,2-dimethylpropanoate

[0233] Using 1-bromo-3-(bromomethyl)benzene (20.0 g, 80 mmol), the desired product was obtained in a similar manner to Step 1 of Preparation 10 (yield 77%).

[0234] 1 H-NMR (400MHz, chloroform-D): δ7.37-7.30 (m, 2H), 7.16-7.04 (m, 2H), 2.78 (s, 2H), 1.44 (s, 9H), 1.13 (s, 6H)

[0235] Step 2: 2,2-Dimethyl-3-(3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzene Synthesis of tert-butyl propionate

[0236] 3-(3-bromophenyl)-2,2-dimethylpropionic acid tert-butyl ester (19.3 g, 61.6 mmol) obtained in step 1, 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (18.78 g, 73.9 mmol), potassium acetate (18.14 g, 185 mmol) and Pd(dppf)Cl2.CH2Cl2 (2.52 g, 3.08 mmol) were dissolved in 616 ml of 1,4-dimethylpropanoate. After 30 ℃ of stirring, the dissolved oxygen was removed by nitrogen bubbling under stirring, and then the inflow of external air was blocked in an airtight container. The reaction mixture was stirred at 110 ℃ for 16 hours and then cooled to room temperature. After filtering through a celite pad and removing the organic solvent under reduced pressure, it was purified by a silica gel column (ethyl acetate: hexane) to obtain the desired product (yield: 69.8%).

[0237] 1 H-NMR (400MHz, chloroform-D): δ7.72-7.55 (m, 2H), 7.26-7.17 (m, 2H), 2.83 (s, 2H), 1.45 (s, 9H), 1.33 (s, 12H), 1.13 (s, 6H)

[0238] Step 3: Synthesis of tert-butyl 3-(3-(6-aminopyridin-2-yl)-phenyl)-2,2-dimethylpropanoate

[0239] After dissolving 6-chloropyridin-2-amine (5.53 g, 43 mmol), tert-butyl 2,2-dimethyl-3-(3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl-propionate (15.5 g, 43 mmol) obtained in step 2, 2M aqueous sodium carbonate solution (64.5 ml, 129 mmol) and dichlorobis(triphenylphosphine)palladium (3.02 g, 4.30 mmol) in 358 ml of dimethoxyethane, the dissolved oxygen was removed by bubbling with nitrogen under stirring, and then the inflow of external air was blocked in an airtight container. The reaction mixture was stirred at 100° C. for 16 hours and cooled to room temperature. After filtering through a celite pad and removing the organic solvent under reduced pressure, the obtained product was dissolved in ethyl acetate and washed with brine. The organic solvent was dehydrated over magnesium sulfate and removed under reduced pressure. Purification was performed by silica gel column (ethyl acetate:hexane) to obtain the desired product (yield: 41.6%).

[0240] m / z(M+H)+:C 20 H 26 The calculated value of N2O2 is 326.44, and the measured value is 327.2 Preparation Example 13: Synthesis of tert-butyl 2-(4-(3-amino-3-ketopropyl)phenoxy)-2-methylpropanoate

[0241]

[0242] Step 1: Synthesis of tert-butyl 2-(4-(3-methoxy-3-ketopropyl)phenoxy)-2-methylpropanoate

[0243] 3-(4-hydroxyphenyl)methyl propionate (2.17g, 12.04mmol), magnesium sulfate (0.29g, 2.41mmol) and potassium carbonate (6.66g, 48.2mmol) are dissolved in DMF (30.1ml), and 2-bromo-2-methylpropionic acid tert-butyl ester (9.40g, 42.1mmol) is further added thereto. The reaction mixture is stirred at 75 ℃ for 16 hours, and then cooled to room temperature. After filtering through a diatomaceous earth pad and removing the organic solvent under reduced pressure, the obtained product is dissolved in ethyl acetate and washed with salt water. The organic solvent is dehydrated on magnesium sulfate and removed under reduced pressure. Purification (ethyl acetate: hexane) is carried out by a silica gel column to obtain the desired product (yield: 62%).

[0244] Step 2: Synthesis of 3-(4-((1-(tert-butyloxy)-2-methyl-1-ketopropan-2-yl)oxy)phenyl)propanoic acid

[0245] After tert-butyl 2-(4-(3-methoxy-3-ketopropyl)phenoxy)-2-methylpropanoate (2.4 g, 7.44 mmol) was dissolved in THF (15 ml) and methanol (15 ml), 1N sodium hydroxide (15 ml) was further added thereto and stirred at room temperature for 6 hours. The reaction mixture was acidified with aqueous hydrochloric acid, extracted with ethyl acetate and washed with brine. The organic solvent was dehydrated over magnesium sulfate and removed under reduced pressure (yield: 100%).

[0246] Step 3: Synthesis of tert-butyl 2-(4-(3-amino-3-ketopropyl)phenoxy)-2-methylpropanoate

[0247] 3-(4-((1-(tert-butoxy)-2-methyl-1-ketoprop-2-yl)oxy)phenyl)propanoic acid (2.30 g, 7.46 mmol) was dissolved in DCM (37 ml), to which oxalyl chloride (1.31 ml, 14.92 mmol) and DMF (0.058 ml, 0.75 mmol) were further added at room temperature. The reaction mixture was stirred at room temperature for 30 minutes, the solvent was removed under reduced pressure, and then THF (19 ml) was added. The temperature was lowered to 0° C., and 25% ammonium hydroxide (8.71 ml, 224 mmol) was slowly added dropwise thereto. The organic solvent was removed under reduced pressure, and the reaction mixture was extracted by adding ethyl acetate and washed with brine. The organic solvent was dehydrated over magnesium sulfate and removed under reduced pressure to obtain the desired product (yield: 87%).

[0248] 1H-NMR (400 MHz, chloroform-D): δ7.11-7.01 (m, 2H), 6.77 (dt, J = 9.3, 2.5 Hz, 2H), 5.33 (s, 2H), 2.89 (t, J = 7.5 Hz, 2H), 2.53-2.44 (m, 2H), 1.53 (s, 6H), 1.43 (s, 9H)

[0249] Preparation Example 14: Synthesis of 2-(4-(3-amino-3-ketopropyl)phenyl)-2-methylpropanoic acid benzyl ester

[0250]

[0251] Using 2-(4-bromophenyl)-2-methylpropanoic acid (5.00 g, 20.57 mmol) and benzyl bromide (4.22 g, 24.68 mmol), a procedure similar to Step 1 of Preparation Example 13 and Steps 1, 3 and 4 of Preparation Example 7 was carried out sequentially to give the desired product (yield: 60%).

[0252] 1 H-NMR (400MHz, chloroform-D): δ7.66-7.59 (m, 1H), 7.54-7.40 (m, 2H), 7.40-7.25 (m, 5H), 7.19-7.10 (m, 2H), 6.47-6.40 (m, 1H), 5.61 (s, 2H), 5.09 (s, 2H), 1.59 (s, 6H)

[0253] Preparation Example 15: Synthesis of tert-butyl 3-(4-(1-amino-2-methyl-1-ketopropan-2-yl)phenyl)-2,2-dimethylpropanoate

[0254]

[0255] Step 1: tert-Butyl 3-(4-(1-methoxy-2-methyl-1-ketopropan-2-yl)phenyl)-2,2-dimethylpropanoate Synthesis

[0256] Using methyl 2-(4-(bromomethyl)phenyl)-2-methylpropanoate (5.40 g, 19.91 mmol) and tert-butyl isobutyrate (3.45 g, 23.90 mmol), the desired product was obtained in a similar manner to Step 1 of Preparation Example 10 (yield: 78%).

[0257] 1 H-NMR (400 MHz, chloroform-D): δ7.20 (d, J = 8.2 Hz, 2H), 7.09 (d, J = 8.2 Hz, 2H), 3.63 (s, 3H), 2.78 (s, 2H), 1.54 (s, 6H), 1.41 (s, 9H), 1.11 (s, 6H)

[0258] Step 2: Preparation of tert-butyl 3-(4-(1-amino-2-methyl-1-ketopropan-2-yl)phenyl)-2,2-dimethylpropanoate synthesis

[0259] Using tert-butyl 3-(4-(1-methoxy-2-methyl-1-ketopropan-2-yl)phenyl)-2,2-dimethylpropanoate (0.50 g, 1.50 mmol) obtained in Step 1, a method similar to Steps 2 and 3 of Preparation Example 13 was carried out sequentially to give the desired product (yield: 76%).

[0260] 1 H-NMR (400 MHz, chloroform-D): δ7.25 (d, J = 8.2 Hz, 2H), 7.11 (d, J = 8.2 Hz, 2H), 5.85 (s, 1H), 5.31 (s, 1H), 2.78 (s, 2H), 1.53 (s, 6H), 1.41 (s, 9H), 1.10 (s, 6H)

[0261] Preparation Example 16: Synthesis of tert-butyl 2-(4-(2-amino-2-ketoethyl)phenoxy)-2-methylpropanoate

[0262]

[0263] Using methyl 2-(4-hydroxyphenyl)acetate (2.00 g, 12.04 mmol) and tert-butyl 2-bromo-2-methylpropanoate (9.40 g, 42.1 mmol), the desired product was obtained in a similar manner to Preparation Example 13 (yield: 54%).

[0264] 1 H-NMR (400 MHz, chloroform-D): δ7.12 (dd, J = 11.4, 2.7 Hz, 2H), 6.83 (td, J = 5.7, 3.7 Hz, 2H), 5.43 (d, J = 26.5 Hz, 2H), 3.50 (s, 2H), 1.57-1.50 (m, 6H), 1.45-1.37 (m, 9H)

[0265] Preparation Example 17: Synthesis of ethyl 2-(4-(2-aminopyrimidin-4-yl)phenyl)acetate

[0266]

[0267] Using ethyl 2-(4-bromophenyl)acetate (27.6 g, 114 mmol), the desired product was obtained in a similar manner to Steps 2 and 3 of Preparation Example 12 and Steps 2 and 3 of Preparation Example 11 (yield: 17.2%).

[0268] m / z(M+H) + :C 14 H 15The calculated value of N3O2 is 257.29, and the measured value is 258.1

[0269] Preparation Example 18: Synthesis of methyl (1r,4r)-4-((2-aminopyrimidin-4-yl)oxy)cyclohexane-1-carboxylate

[0270]

[0271] Step 1: Synthesis of methyl (1r, 4r)-4-hydroxycyclohexane-1-carboxylate

[0272] After (1r, 4r)-4-hydroxycyclohexane-1-carboxylic acid (0.300 g, 2.081 mmol) was dissolved in methanol (10 ml), sulfuric acid (0.017 ml, 0.312 mmol) was added thereto, stirred at 60°C for 16 hours, the organic solvent was removed under reduced pressure, and purified by silica gel column to obtain the desired product (yield: 100%).

[0273] 1 H-NMR (400 MHz, chloroform-D): δ8.25 (d, J = 5.9 Hz, 1H), 6.64-6.50 (m, 1H), 5.16-5.05 (1H), 3.73-3.62 (m, 3H), 2.35 (tt, J = 11.4, 3.7 Hz, 1H), 2.18 (dt, J = 12.8, 3.5 Hz, 2H), 2.07 (dd, J = 14.2, 3.7 Hz, 2H), 1.74-1.56 (m, 2H), 1.49 (ddd, J = 23.0, 12.7, 3.5 Hz, 2H)

[0274] Step 2: Synthesis of methyl (1r,4r)-4-((2-chloropyrimidin-4-yl)oxy)cyclohexane-1-carboxylate

[0275] After 2,4-dichloropyrimidine (0.28 g, 1.91 mmol) was dissolved in DMF (10 ml), (1r, 4r)-4-hydroxycyclohexane-1-carboxylic acid methyl ester (0.33 g, 2.10 mmol) and cesium carbonate (2.56 g, 4.78 mmol) obtained in step 1 were added thereto. After stirring at 80° C. for 3 hours, the reaction mixture was diluted with diethyl ether and washed with water. The organic solvent was dehydrated over magnesium sulfate and purified by a silica gel column to obtain the desired product (yield: 39.8%).

[0276] 1H-NMR (400 MHz, chloroform-D): δ8.25 (d, J = 5.9 Hz, 1H), 6.64-6.50 (m, 1H), 5.16-5.05 (1H), 3.73-3.62 (m, 3H), 2.35 (tt, J = 11.4, 3.7 Hz, 1H), 2.18 (dt, J = 12.8, 3.5 Hz, 2H), 2.07 (dd, J = 14.2, 3.7 Hz, 2H), 1.74-1.56 (m, 2H), 1.49 (ddd, J = 23.0, 12.7, 3.5 Hz, 2H)

[0277] Step 3: Synthesis of methyl (1r,4r)-4-((2-aminopyrimidin-4-yl)oxy)cyclohexane-1-carboxylate

[0278] Using methyl (1r,4r)-4-((2-chloropyrimidin-4-yl)oxy)cyclohexane-1-carboxylate (0.21 g, 0.76 mmol) obtained in Step 2, the desired product was obtained in a similar manner to Step 2 of Preparation Example 11 (yield: 69%).

[0279] 1 H-NMR (400MHz, chloroform-D) δ7.98(d,J=5.9Hz,1H),6.01(d,J=5.5Hz,1H),5.02-4.89(m,1H),4.82(s,2H),3.68(dd,J=7 .3,2.7Hz,5H),2.44-2.26(m,1H),2.20-1.99(m,4H),1.71-1.57(m,2H),1.52(s,1H),1.41(dd,J=12.6,3.4Hz,1H)

[0280] Example 1: Synthesis of N-(6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)-3-phenylpropanamide

[0281]

[0282] 2-Chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine (0.1 g, 0.305 mmol) obtained in Preparation Example 1, 3-phenylpropanamide (0.055 g, 0.366 mmol) obtained in Preparation Example 5, cesium carbonate (0.249 g, 0.763 mmol), 4,5-di(diphenylphosphine)-9,9-dimethylxanthine (21 mg, 0.037 mmol) and tris(dibenzylideneacetone)dipalladium(0) (28 mg, 0.031 mmol) were dissolved in 15 ml of 1,4-dichloro ...5 After 30 ℃ of 40% ethanol, the mixture was stirred for 16 hours at 110 ℃ and then cooled to room temperature. After filtering through a diatomaceous earth pad and removing the organic solvent under reduced pressure, the obtained product was dissolved in ethyl acetate and washed with brine. The organic solvent was dehydrated on magnesium sulfate and removed under reduced pressure. Purification was performed by silica gel column (ethyl acetate: hexane = 1: 2) to obtain the desired product (yield: 67%).

[0283] m / z(M+H) + :C 26 H 24 The calculated value of N4O3 is 440.50, and the measured value is 441.1

[0284] Example 2: Synthesis of methyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)acetate

[0285]

[0286] Using 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine (0.32 g, 0.976 mmol) obtained in Preparation Example 1 and methyl 2-(4-(2-amino-2-ketoethyl)phenyl)acetate (0.243 g, 1.172 mmol) obtained in Preparation Example 6, the desired product was obtained in a similar manner to Example 1 (yield: 22.6%).

[0287] 1 H NMR (500MHz, chloroform-D): δ9.50(s,1H),8.86(s,1H),8.67(s,1H),8.61(s,1H),8.33(s,1H),7.67(d,J=1.8Hz,1H),7.27(4H),7.17(1 H),7.08(d,J=7.3Hz,1H),7.00-6.94(m,2H),3.99(q,J=6.7Hz,2H),3.76(s,2H),3.67(s,3H),3.62(s,2H),1.19(t,J=6.7Hz,3H)

[0288] Example 3: Synthesis of 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)acetic acid

[0289]

[0290] The methyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine-2-yl)amino)-2-ketoethyl)phenyl)acetate (110 mg, 0.221 mmol) obtained in Example 2 was dissolved in THF (6 ml) and methanol (2 ml). Sodium hydroxide (44 mg, 1.103 mmol) dissolved in water (2 ml) was added thereto, followed by stirring at room temperature for 4 hours. After the reaction was cooled to room temperature, the reaction mixture was titrated to pH 4.5 using a 1N aqueous hydrochloric acid solution, diluted with ethyl acetate and the water layer was removed. The obtained product was dehydrated over magnesium sulfate, and the organic solvent was removed under reduced pressure. Purification was performed by silica gel column (ethyl acetate: hexane = 1: 1) to obtain the desired product (yield: 33.6%).

[0291] m / z(M+H) + :C 27 H 24 The calculated value of N4O5 is 484.51, and the measured value is 485.1

[0292] Example 4: Synthesis of 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)acetic acid

[0293]

[0294] Step 1: 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)amino)-3-ketopropyl)phenyl) Synthesis of Methyl Acetate

[0295] Using 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine (0.20 g, 0.61 mmol) obtained in Preparation Example 1 and methyl 2-(4-(3-amino-3-ketopropyl)phenyl)acetate (0.14 g, 0.61 mmol) obtained in Preparation Example 7, the desired product was obtained in a similar manner to Example 1 (yield: 35%).

[0296] 1 H-NMR (400MHz, chloroform-D): δ9.51(s,1H),8.87(s,1H),8.70(s,1H),8.36(d,J=10Hz,2H),7.68(s,1H),7.25(m,5H),7.10(d,1H),6.94~7.02(m,2H),4.02(q,2H),3.66(s,3H),3.58(s,2H),3.06(t,2H),2.77(t,2H),1.21(t,3H)

[0297] Step 2: 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-3-one Synthesis of (propyl)phenyl)acetic acid

[0298] The ester compound (0.11 g, 2.39 mmol) obtained in Step 1 was hydrolyzed in a similar manner to Example 3 to give the desired product (yield: 28%).

[0299] 1 H-NMR (400MHz, DMSO-D6): δ10.87(s,1H),9.34(s,1H),9.00(s,2H),8.33(s,1H),7.89(s,1H ),7.17(m,7H),7.02(t,1H),4.03(t,2H),3.51(s,2H),2.92(t,2H),2.78(t,2H),1.10(t,3H)

[0300] Example 5: Synthesis of methyl 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)-2-methylpropanoate

[0301]

[0302] Using 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine (0.25 g, 0.76 mmol) obtained in Preparation Example 1 and methyl 2-(4-(3-amino-3-ketopropyl)phenyl-2-methylpropanoate (0.19 g, 0.76 mmol) obtained in Preparation Example 8, the desired product was obtained in a similar manner to Example 1 (yield: 51%).

[0303] 1 H NMR (400 MHz, chloroform-D): δ9.51 (s, 1H), 8.86 (s, 1H), 8.72 (s, 1H), 8.37 (d, J = 4 Hz, 1H), 7.99 (s, 1H), 7.70 (s, 1H), 7.25 (m, 3H), 7.20 (m, 2H), 7.12 (m, 1H), 7.03 (m, 2H), 4.03 (q, 2H), 3.06 (t, 2H), 2.78 (t, 2H), 1.55 (s, 6H), 1.22 (t, 3H)

[0304] Example 6: Synthesis of ethyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-difluoroacetate

[0305]

[0306] Step 1: Synthesis of 6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-amine

[0307] The title compound was obtained as a by-product during the preparation of 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)acetic acid in Example 3.

[0308] m / z(M+H) + :C 17 H 16 The calculated value of N4O2 is 308.3, and the measured value is 309.1

[0309] Step 2: 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-one Synthesis of Ethyl (Ethyl) Phenyl)-2,2-Difluoroacetate

[0310] After dissolving 2-(4-(2-ethoxy-1,1-difluoro-2-ketoethyl)phenyl)acetic acid (0.02g, 0.077mmol) obtained in Preparation Example 9 in DCM (0.4ml), oxalyl chloride (0.02g, 0.155mmol) and 1 drop of DMF were added. The reaction mixture was stirred at room temperature for 1 hour, and the solvent was removed under reduced pressure. After the concentrate was dissolved in THF (0.2ml), the temperature was lowered to 0°C, 6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine-2-amine (0.02g, 0.065mmol) obtained in step 1 was dissolved in THF (0.2ml), and TEA (0.022g, 0.216mmol) was added thereto. After stirring at room temperature for 16 hours, water was added, and the reaction mixture was extracted with ethyl acetate. After washing with water and brine, the organic layer was dehydrated over magnesium sulfate and concentrated under reduced pressure. Purification by column chromatography afforded the desired product (yield: 13%).

[0311] 1 H-NMR (500MHz, chloroform-D): δ9.49(s,1H),8.84(s,1H),8.74(s,1H),8.38(s,1 H),7.91(s,1H),7.67(s,1H),7.66(d,J=7.9Hz,2H),7.46(d,J=7.9Hz,2H) ,7.21(1H),7.11(1H),7.03-6.99(2H),4.30(q,J=7.95Hz,2H),4.03(q,J =6.15Hz,2H),3.86(s,2H),1.31(t,J=6.15Hz,3H),1.22(t,J=7.95Hz,3H)

[0312] Example 7: Synthesis of 3-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-dimethylpropanoic acid

[0313]

[0314] Using 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine (0.1 g, 0.305 mmol) obtained in Preparation Example 1 and tert-butyl 3-(4-(2-amino-2-ketoethyl)phenyl)-2,2-dimethylpropanoate (0.081 g, 0.277 mmol) obtained in Preparation Example 10, the desired product was obtained in a manner similar to Example 1 and Step 3 of Preparation Example 11 (yield: 12%).

[0315] 1 H-NMR (400MHz, methanol-D4): δ9.34(s,1H),8.89(s,1H),8.85-8.74(m,1H),8.23(d,J=2.7Hz,1H),7.91(q,J=1.4Hz,1H),7.33- 7.19(m,3H),7.19-7.06(m,4H),7.01(t,J=7.5Hz,1H),3.99(q,J=7.0Hz,2H),3.72(s,2H),2.82(s,2H),1.18-1.01(m,9H)

[0316] Example 8: Synthesis of (R)-1-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid

[0317]

[0318] Using 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine (0.1 g, 0.305 mmol) obtained in Preparation Example 1 and (R)-1-(2-aminopyrimidin-4-yl)piperidine-3-carboxylic acid ethyl ester (0.069 g, 0.277 mmol) obtained in Preparation Example 11, the desired product was obtained in a manner similar to Example 1 and Example 3 (yield: 49%).

[0319] 1H-NMR (400MHz, methanol-D4): δ9.45(s,1H),8.88(d,J=1.8Hz,1H),8.64(s,1H),8.21(d,J=2.7Hz,1H),7.96 (d,J=6.4Hz,1H),7.92(t,J=2.3Hz,1H),7.31-7.21(m,1H),7.21-7.16(1H),7.16-7.09(m,1H),7.06- 6.95(m,1H),6.42(d,J=6.4Hz,1H),4.50-4.06(1H),4.01(q,J=7.0Hz,2H),3.53-3.33(m,1H),3.23(s ,1H),2.62-2.40(1H),2.19-2.01(1H),1.81(d,J=12.3Hz,2H),1.68-1.44(1H),1.14(t,J=6.9Hz,3H)

[0320] Example 9: Synthesis of 3-(3-(6-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid

[0321]

[0322] Using 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine (0.1 g, 0.305 mmol) obtained in Preparation Example 1 and tert-butyl 3-(4-(2-amino-2-ketoethyl)phenyl)-2,2-dimethylpropanoate (0.091 g, 0.277 mmol) obtained in Preparation Example 10, the desired product was obtained in a manner similar to Step 3 of Example 1 and Preparation Example 11 (yield: 26.9%).

[0323] 1H-NMR (400 MHz, methanol-D4): δ9.36 (s, 1H), 8.89 (d, J = 1.8 Hz, 1H), 8.65-8.50 (1H), 8.25 (d, J = 2.7 Hz, 1H), 7.99-7.88 (m, 2H), 7.84 (d, J = 7.8 Hz, 1H), 7.65 (t, J = 7.8 Hz, 1H), 7.40 (d, J = 7.3 Hz, 1H ),7.34(dd,J=8.0,5.7Hz,2H),7.30-7.24(m,1H),7.20(dd,J=8.0,1.6Hz,2H),7.15(d,J=8. 2Hz,1H),7.11-6.95(m,1H),4.04-3.91(2H),2.95(s,2H),1.19(s,6H),1.13(t,J=7.1Hz,3H)

[0324] Example 10: Synthesis of N-(6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)-3-phenylpropanamide

[0325]

[0326] Using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.1 g, 0.306 mmol) obtained in Preparation Example 2 and 3-phenylpropanamide (0.055 g, 0.367 mmol) obtained in Preparation Example 5, the desired product was obtained in a similar manner to Example 1 (yield: 60%).

[0327] 1 H NMR (500MHz, chloroform-D): δ9.44(s,1H),8.70(s,1H),8.00(s,1H),7.57(1H),7.50(s,1H),7.36(1H),7.28-7.25(2H),7.21-7.19 (3H),7.10(1H),7.05-6.98(3H),6.90(1H),4.30(q,J=7.3Hz,2H),3.04(t,J=7.65Hz,2H),2.69(t,J=7.95Hz,2H),1.23(3H)

[0328] Example 11: Synthesis of 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)acetic acid

[0329]

[0330] Using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.250 g, 0.765 mmol) obtained in Preparation Example 2 and methyl 2-(4-(2-amino-2-ketoethyl)phenyl)acetate (0.190 g, 0.918 mmol) obtained in Preparation Example 6, the desired product was obtained sequentially in a manner similar to Example 1 and Example 3 (yield: 34.1%).

[0331] 1 H NMR (300MHz, methanol-D): δ9.35(s,1H),8.61(s,1H),8.52(s,1H),7.45(1H),7.40(d,J=1.25Hz,1H),7.26( 1H),7.13(m,4H),7.02(1H),6.94-6.89(3H),6.81(1H),3.95(2H),3.59(s,2H),3.39(s,2H),1.18(3H)

[0332] Example 12: Synthesis of 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)acetic acid

[0333]

[0334] Step 1: 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl) Synthesis of Methyl (phenyl)acetate

[0335] Using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.10 g, 0.31 mmol) obtained in Preparation Example 4 and methyl 2-(4-(3-amino-3-ketopropyl)phenyl)acetate (0.07 g, 0.31 mmol) obtained in Preparation Example 11, the desired product was obtained in a similar manner to Example 1 (yield: 75%).

[0336] 1 H-NMR (400MHz, chloroform-D): δ9.45(s,1H),8.71(s,1H),8.11(s,1H),7.51(d,J=12Hz,1H),7.51(s,1H),7.36(t,1H),7. 16(d,J=8Hz,2H),7.14(d,J=8Hz,2H),7.09(t,1H),6.90~6.98(m,3H),6.89(t,1H),4.06(t,2H),3.67(s,3H),3.59 9s,2H),3.01(t,2H),2.65(t,2H),1.24(t,3H)

[0337] Step 2: 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl) Synthesis of phenylacetic acid

[0338] The ester compound (0.11 g, 2.39 mmol) obtained in Step 1 was hydrolyzed in a similar manner to Example 3 to give the desired product (yield: 69%).

[0339] 1 H-NMR (400MHz, chloroform-D): δ9.49 (s, 1H), 8.91 (s, 1H), 8.67 (s, 1H), 7.47 (d, 1H), 7.43 (s, 1H), 7.35 (t, 1H), 7.11~7.26 (m, 5H), 6.97~7.05 (m, 3H), 6.91 (t, 1H), 4.06 (t, 2H), 3.61 (s, 2H), 3.00 (t, 2H), 2.68 (t, 2H), 1.26 (t, 3H)

[0340] Example 13: Synthesis of 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenoxy)-2-methylpropanoic acid

[0341]

[0342] Using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.080 g, 0.245 mmol) obtained in Preparation Example 2 and tert-butyl 2-(4-(3-amino-3-ketopropyl)phenoxy)-2-methylpropanoate (0.075 g, 0.245 mmol) obtained in Preparation Example 13, the desired product was obtained in a similar manner to Example 1 and Step 3 of Preparation Example 11 (yield: 64%).

[0343] 1 H-NMR (400MHz, chloroform-D): δ9.43(s,1H),8.65-8.52(m,2H),7.51-7.41(m,2H),7.36-7.27(m,1H),7.10-6.91(m,6H),6.9 1-6.76(m,3H),4.01(q,J=6.9Hz,2H),2.93(t,J=6.9Hz,2H),2.63(d,J=5.0Hz,2H),1.56(s,6H),1.23(t,J=7.1Hz,3H)

[0344] Example 14: Synthesis of 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl-2,2-difluoroacetic acid

[0345]

[0346] Step 1: Synthesis of 6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-amine

[0347] The title compound was obtained as a by-product during the preparation of 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)acetic acid in Example 11.

[0348] m / z(M+H) + :C 18 H 17 The calculated value of N3O2 is 307.3, and the measured value is 308.1

[0349] Step 2: 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl) Synthesis of Phenyl-2,2-Difluoroacetic Acid

[0350] Using 2-(4-(2-ethoxy-1,1-difluoro-2-ketoethyl)phenyl)acetic acid (0.046 g, 0.178 mmol) obtained in Preparation Example 9 and 6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-amine (0.061 g, 0.199 mmol) obtained in Step 1, the desired product was obtained sequentially in a manner similar to Example 6 and Example 3 (yield: 5.7%).

[0351] 1 H-NMR (500MHz, methanol-D4): δ9.19 (s, 1H), 8.66 (s, 1H), 7.65 (1H), 7.54-7.52 (3H), 7.35-7.33 (3H), 7.10 (1H), 7.04-6.98 (2H), 6.90-6.88 (2H), 3.94 (q, J=7.3Hz, 2H), 3.74 (s, 1H), 1.10 (t, J–6.7Hz, 3H)

[0352] Example 15: Synthesis of 3-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-dimethylpropanoic acid

[0353]

[0354] Using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.10 g, 0.306 mmol) obtained in Preparation Example 2 and tert-butyl 3-(4-(2-amino-2-ketoethyl)phenyl)-2,2-dimethylpropanoate (0.089 g, 0.306 mmol) obtained in Preparation Example 10, the desired product was obtained in a manner similar to Step 3 of Example 1 and Preparation Example 11 (yield: 74%).

[0355] 1 H NMR (400MHz, chloroform-D): δ9.43(s,1H),8.68(s,1H),8.19(s,1H),7.56-7.47(m,2H),7.34(t,J=8.0Hz,1H),7.18(td,J=7.8,5.6Hz,4H),7 .13-7.05(m,1H),7.05-6.93(m,3H),6.90(t,J=7.8Hz,1H),4.03(q,J=7.0Hz,2H),3.76-3.69(m,2H),2.88(s,2H),1.29-1.16(m,9H)

[0356] Example 16: Synthesis of 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)-2-methylpropanoic acid

[0357]

[0358] Using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.10 g, 0.306 mmol) obtained in Preparation Example 2 and 2-(4-(3-amino-3-ketopropyl)phenyl)-2-methylpropanoic acid benzyl ester (0.099 g, 0.306 mmol) obtained in Preparation Example 14, the desired product was obtained in a similar manner to Example 1 and Step 2 of Preparation Example 7 (yield: 31%).

[0359] 1 H NMR (400MHz, chloroform-D): δ9.44(s,1H),8.68(s,1H),8.34(s,1H),7.58-7.45(m,2H),7.39-7.27(m,3H),7.17(d,J=8.2Hz,2H),7.10(td,J=7.8,1.5H z,1H),7.06-6.94(m,3H),6.94-6.85(m,1H),4.03(q,J=7.0Hz,2H),3.1 0-2.95(m,2H),2.70(t,J=7.5Hz,2H),1.57(s,6H),1.24(t,J=6.6Hz,3H)

[0360] Example 17: Synthesis of (E)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-ketopropan-1-phenyl-1-yl)phenyl)-2-methylpropanoic acid

[0361]

[0362] The title compound was obtained as a by-product in the process of obtaining Example 16 (yield: 41%).

[0363] 1 H NMR (400MHz, chloroform-D): δ9.60 (s, 1H), 8.92 (d, J = 31.1Hz, 1H), 8.70 (d, J = 0.9Hz, 1H), 7.84-7.72 (m, 1H), 7.61-7.42 (m, 6H), 7.38 (td, J = 7.9, 2.4 Hz,1H),7.19-7.10(m,1H),7.10-6.97(m,3H),6.97-6.87(m,1H),6.59(d,J=15.6Hz,1H),4.08-3.99(m,2H),1.63(s,6H),1.33-1.19(m,3H)

[0364] Example 18: Synthesis of 3-(4-(1-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-methyl-1-ketopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid

[0365]

[0366] Using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.10 g, 0.306 mmol) obtained in Preparation Example 2 and tert-butyl 3-(4-(1-amino-2-methyl-1-ketopropan-2-yl)phenyl)-2,2-dimethylpropanoate (0.098 g, 0.306 mmol) obtained in Preparation Example 15, the desired product was obtained in a manner similar to Example 1 and Step 3 of Preparation Example 11 (yield: 77%).

[0367] 1 H NMR (400MHz, chloroform-D): δ9.46 (s, 1H), 8.69-8.60 (m, 1H), 7.57 (s, 1H), 7.53-7.44 (m, 2H), 7.36-7.26 (m, 3H), 7.19 (d, J = 8.7Hz, 2H), 7.15- 7.06(m,1H),6.98(ddd,J=8.0,5.0,1.6Hz,2H),6.94-6.85(m,2H),4.01(q,J=7.0Hz,2H),2.88(s,2H),1.66(s,6H),1.28-1.13(m,9H)

[0368] Example 19: Synthesis of 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenoxy-2-methylpropanoic acid

[0369]

[0370] Using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.08 g, 0.245 mmol) obtained in Preparation Example 2 and tert-butyl 2-(4-(2-amino-2-ketoethyl)phenoxy)-2-methylpropanoate (0.072 g, 0.245 mmol) obtained in Preparation Example 16, the desired product was obtained in a manner similar to Example 1 and Step 3 of Preparation Example 11 (yield: 62%).

[0371] 1 H-NMR (400MHz, chloroform-D): δ9.42(s,1H),8.67(s,1H),8.40(d,J=12.3Hz,1H),7.54-7.42(m,2H),7.32(td,J=7.9,2.0Hz,1H),7.20(q,J=4.0H z,2H),7.16-7.05(m,1H),7.04-6.84(m,6H),4.02(qd,J=7.0,1.5Hz,2H),3.69(d,J=2.7Hz,2H),1.59(d,J=15.1Hz,6H),1.30-1.16(m,3H)

[0372] Example 20: Synthesis of 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)phenyl)acetic acid

[0373]

[0374] Using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.140 g, 0.428 mmol) obtained in Preparation Example 2 and ethyl 2-(4-(2-aminopyrimidin-4-yl)phenyl)acetate (0.1 g, 0.389 mmol) obtained in Preparation Example 17, the desired product was obtained in a manner similar to Example 1 and Example 3 (yield: 0.69%).

[0375] m / z(M+H) + :C 30 H 25 The calculated value of N5O4 is 519.56, and the measured value is 520.1

[0376] Example 21: Synthesis of (1r,4r)-4-((2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)oxy)cyclohexane-1-carboxylic acid

[0377]

[0378] Using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.100 g, 0.306 mmol) obtained in Preparation Example 2 and (1r,4r)-4-((2-aminopyrimidin-4-yl)oxy)cyclohexane-1-carboxylic acid methyl ester (0.085 g, 0.337 mmol) obtained in Preparation Example 18, the desired product was obtained sequentially in a manner similar to Example 1 and Example 3 (yield: 22.8%).

[0379] 1 H-NMR (400MHz, DMSO-D6): δ10.09(s,1H),9.38(s,1H),8.75(s,1H),8.25(d,J=5.9Hz,1H),7.78(d,J=8. 2Hz,1H),7.70(t,J=2.1Hz,1H),7.41(t,J=8.0Hz,1H),7.21-7.10(m,2H),7.08-7.01(m,1H),7.00-6.91 (m,1H),6.85(dd,J=7.8,2.3Hz,1H),6.43-6.33(m,1H),4.95(dd,J=10.3,4.3Hz,1H),4.00(q,J=6.9Hz, 2H),2.18(s,1H),2.11(d,J=7.8Hz,2H),1.93(d,J=9.6Hz,2H),1.55-1.34(m,4H),1.12(t,J=7.1Hz,3H)

[0380] Example 22: Synthesis of N-(6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)-3-phenylpropanamide

[0381]

[0382] Using 2-chloro-6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazine (0.1 g, 0.305 mmol) obtained in Preparation Example 3 and 3-phenylpropanamide (0.059 g, 0.397 mmol) obtained in Preparation Example 5, the desired product was obtained in a similar manner to Example 1 (yield: 52.1%).

[0383] m / z(M+H) + :C 26 H 24 The calculated value of N4O3 is 440.50, and the measured value is 441.1

[0384] Example 23: Synthesis of 3-(4-(2-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-dimethylpropanoic acid

[0385]

[0386] Using 2-chloro-6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazine (0.070 g, 0.214 mmol) obtained in Preparation Example 3 and tert-butyl 3-(4-(2-amino-2-ketoethyl)phenyl)-2,2-dimethylpropanoate (0.056 g, 0.194 mmol) obtained in Preparation Example 10, the desired product was obtained in a manner similar to Example 1 and Step 3 of Preparation Example 11 (yield: 74.4%).

[0387] 1 H-NMR (500MHz, methanol-D4): δ9.32(s,1H),8.75(s,1H),8.05(d,J=7.6Hz,1H),7.99-7.85(1H),7.30(d,J=8.2Hz,2H),7.28-7.23(m,1H),7.23 -7.16(3H),7.13(d,J=6.7Hz,1H),7.10-6.96(m,2H),3.99(q,J=6.9Hz,2H),3.79(s,2H),2.87(s,2H),1.17(s,7H),1.09(t,J=6.9Hz,4H)

[0388] Example 24: Synthesis of (R)-1-(2-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid

[0389]

[0390] Using 2-chloro-6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazine (0.070 g, 0.214 mmol) obtained in Preparation Example 3 and (R)-1-(2-aminopyrimidin-4-yl)piperidine-3-carboxylic acid ethyl ester (0.048 g, 0.194 mmol), the desired product was obtained in a similar manner to Example 1 and Example 3 (yield: 20%).

[0391] 1H-NMR (400MHz, methanol-D4): δ9.40(s,1H),8.54(s,1H),8.00(d,J=7.8Hz,1H),7.93(d,J=6.4Hz,1H),7.85(t,J=7.8 Hz,1H),7.19(t,J=8.0Hz,1H),7.15(dd,J=7.8,1.4Hz,1H),7.07(d,J=6.9Hz,1H),6.98(t,J=7.1Hz,1H),6.93(d ,J=8.2Hz,1H),6.36(d,J=6.4Hz,1H),4.61-4.32(1H),4.29-4.04(1H),3.94(q,J=7.0Hz,2H),3.26-3.01(m,2H ),2.41(t,J=3.9Hz,1H),2.08(t,J=4.8Hz,1H),1.87-1.68(m,2H),1.52(d,J=12.8Hz,1H),1.04(t,J=6.9Hz,3H)

[0392] Example 25: Synthesis of 3-(3-(6-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid

[0393]

[0394] Using 2-chloro-6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazine (0.140 g, 0.427 mmol) obtained in Preparation Example 3 and tert-butyl 3-(3-(6-aminopyridin-2-yl)phenyl)-2,2-dimethylpropanoate (0.127 g, 0.388 mmol) obtained in Preparation Example 12, the desired product was obtained in a manner similar to Example 1 and Step 3 of Preparation Example 11 (yield: 16%).

[0395] 1H-NMR (400MHz, methanol-D4) δ9.40 (s, 1H), 8.57-8.44 (1H), 8.06 (d, J = 6.9Hz, 1H), 7.98-7.89 (m, 2H), 7. 89-7.82(m,1H),7.76(t,J=8.0Hz,1H),7.43(dd,J=10.5,7.8Hz,2H),7.35(t,J=7.5Hz,1H),7.30- 7.20(m,2H),7.20-7.14(m,1H),7.11(d,J=8.2Hz,1H),7.01(t,J=7.5Hz,1H),6.96(d,J=8.2Hz,1H ),4.54(s,1H),3.97(q,J=7.0Hz,2H),3.46(s,0H),2.95(s,2H),1.19(s,7H),1.06(t,J=6.9Hz,3H)

[0396] Example 26: Synthesis of 2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)-2-methylpropanoic acid

[0397]

[0398] Using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.08 g, 0.244 mmol) obtained in Preparation Example 4 and 2-(4-(3-amino-3-ketopropyl)phenyl)-2-methylpropionic acid benzyl ester (0.079 g, 0.244 mmol) obtained in Preparation Example 14, the desired product was obtained in a similar manner to Example 1 and Step 2 of Preparation Example 7 (yield: 16%).

[0399] 1 H-NMR (400MHz, chloroform-D): δ9.41(s,1H),8.68(s,1H),8.25(d,J=8.2Hz,1H),7.73(d,J=5.0Hz,1H),7.64(q,J=2.1Hz,2H),7.48-7.38(m,1H),7.30 -7.09(m,6H),6.97(dd,J=7.8,5.0Hz,1H),4.19-4.11(m,2H),3.01(t,J=7.5Hz,2H),2.71(t,J=7.5Hz,2H),1.52(s,6H),1.46(t,J=7.1Hz,3H)

[0400] Example 27: Synthesis of 3-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-dimethylpropanoic acid

[0401]

[0402] Using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.08 g, 0.244 mmol) obtained in Preparation Example 4 and tert-butyl 3-(4-(2-amino-2-ketoethyl)phenyl)-2,2-dimethylpropanoate (0.071 g, 0.244 mmol) obtained in Preparation Example 10, the desired product was obtained in a manner similar to Example 1 and Step 3 of Preparation Example 11 (yield: 62%).

[0403] 1 H-NMR (400 MHz, chloroform-D): δ9.42 (s, 1H), 8.70 (s, 1H), 8.37 (s, 1H), 7.76-7.69 (m, 1H), 7.68-7.61 (m, 2H), 7.43 (t, J = 8.2 Hz, 1H), 7.23-7.10 (m, 6H), 6.97 (dd, J = 7.8, 5.0 Hz, 1H), 4.18-4.07 (m, 2H), 3.72 (s, 2H), 2.85 (s, 2H), 1.49-1.41 (m, 3H), 1.19 (s, 6H)

[0404] Example 28: Synthesis of 2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenoxy)-2-methylpropanoic acid

[0405]

[0406] Using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.08 g, 0.244 mmol) obtained in Preparation Example 4 and tert-butyl 2-(4-(3-amino-3-ketopropyl)phenoxy)-2-methylpropanoate (0.075 g, 0.244 mmol) obtained in Preparation Example 13, the desired product was obtained in a manner similar to Example 1 and Step 3 of Preparation Example 11 (yield: 56%).

[0407] 1H-NMR (400MHz, DMSO-D6): δ10.74(s,1H),9.26(s,1H),8.93(s,1H),7.92(d,J=7. 8Hz,1H),7.81(t,J=1.8Hz,1H),7.60(dd,J=5.0,1.4Hz,1H),7.56-7.41(m,2H),7. 18(dd,J=7.5,2.1Hz,1H),7.13-7.00(m,3H),6.78-6.65(m,2H),4.11(q,J=7.0Hz ,2H),2.87-2.76(m,2H),2.69(t,J=7.5Hz,2H),1.42(s,6H),1.33(t,J=7.1Hz,3H)

[0408] Example 29: Synthesis of 3-(4-(1-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-methyl-1-ketopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid

[0409]

[0410] Using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.08 g, 0.244 mmol) obtained in Preparation Example 4 and tert-butyl 3-(4-(1-amino-2-methyl-1-ketopropan-2-yl)phenyl)-2,2-dimethylpropanoate (0.078 g, 0.244 mmol) obtained in Preparation Example 15, the desired product was obtained in a manner similar to Example 1 and Step 3 of Preparation Example 11 (yield: 59%).

[0411] 1 H NMR (400MHz, chloroform-D): δ9.43(s,1H),8.68(s,1H),7.72-7.59(m,3H),7.56(s,1H),7.41(t,J=8.2Hz,1H),7.29(d,J=8.2Hz,2 H),7.23-7.07(m,4H),7.00-6.88(m,1H),4.18-4.05(m,2H),2.84(s,2H),1.65(s,6H),1.44(t,J=6.9Hz,3H),1.16(s,6H)

[0412] Example 30: Synthesis of 2-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenoxy)-2-methylpropanoic acid

[0413]

[0414] Using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.08 g, 0.244 mmol) obtained in Preparation Example 4 and tert-butyl 2-(4-(2-amino-2-ketoethyl)phenoxy)-2-methylpropanoate (0.072 g, 0.244 mmol) obtained in Preparation Example 16, the desired product was obtained in a manner similar to Example 1 and Step 3 of Preparation Example 11 (yield: 35%).

[0415] 1 H-NMR (400MHz, DMSO-D6): δ10.94(s,1H),9.23(s,1H),8.94(s,1H),7.93(d ,J=8.2Hz,1H),7.83(t,J=1.8Hz,1H),7.61(dd,J=5.0,1.4Hz,1H),7.58-7. 43(m,2H),7.19(d,J=8.7Hz,3H),7.07(dd,J=8.0,4.8Hz,1H),6.74(d,J=8. 7Hz,2H),4.20-4.07(m,2H),3.66(s,2H),1.45(s,6H),1.33(t,J=7.1Hz,3H)

[0416] Example 31: Synthesis of (R)-1-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid

[0417]

[0418] Using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.08 g, 0.244 mmol) obtained in Preparation Example 4 and (R)-1-(2-aminopyrimidin-4-yl)piperidine-3-carboxylic acid ethyl ester (0.055 g, 0.222 mmol) obtained in Preparation Example 11, the desired product was obtained in a manner similar to Example 1 and Example 3 (yield: 20%).

[0419] 1H-NMR (400MHz, methanol-D4): δ9.36(s,1H),8.61(s,1H),7.96(d,J=6.4Hz,1H),7.86(d,J=7.8Hz,1H),7.77(t,J=2.1 Hz,1H),7.66(dd,J=4.8,1.6Hz,1H),7.51(d,J=7.8Hz,1H),7.46(dd,J=8.5,2.1Hz,1H),7.11(dd,J=8.0,4.8Hz ,2H),6.41(d,J=6.4Hz,1H),4.48-4.29(1H),4.29-4.17(1H),4.13(q,J=7.0Hz,2H),3.35(d,J=9.1Hz,1H),3.2 3-2.96(1H),2.52-2.39(1H),2.07(s,1H),1.80(d,J=10.5Hz,2H),1.57(d,J=3.7Hz,1H),1.37(t,J=7.1Hz,3H)

[0420] Example 32: Synthesis of 3-(3-(6-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid

[0421]

[0422] Using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.08 g, 0.244 mmol) obtained in Preparation Example 4 and tert-butyl 3-(3-(6-aminopyridin-2-yl)phenyl)-2,2-dimethylpropanoate (0.072 g, 0.222 mmol) obtained in Preparation Example 12, the desired product was obtained in a manner similar to Example 1 and Step 3 of Preparation Example 11 (yield: 26%).

[0423] 1 H-NMR (400MHz, methanol-D4): δ9.40(s,1H),8.62-8.47(1H),7.91(s,1H),7.86(t,J=8.5Hz,2H),7.80(d,J=2.3Hz,1H),7.76-7.59(m,2H),7.58-7.43( m,2H),7.43-7.27(m,3H),7.21(d,J=8.2Hz,1H),7.13(td,J=5.1,2.7Hz ,2H),4.22-4.10(m,2H),2.96(s,2H),1.36(t,J=6.9Hz,3H),1.20(s,7H)

[0424] Example 33: Synthesis of (1r,4r)-4-((2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)oxy)cyclohexane-1-carboxylic acid

[0425]

[0426] Using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.10 g, 0.305 mmol) obtained in Preparation Example 4 and (1r,4r)-4-((2-aminopyrimidin-4-yl)oxy)cyclohexane-1-carboxylic acid methyl ester (0.084 g, 0.336 mmol) obtained in Preparation Example 18, the desired product was obtained sequentially in a manner similar to Example 1 and Example 3 (yield: 42.2%).

[0427] 1 H-NMR (400MHz, DMSO-D6): δ10.09(s,1H),9.40(s,1H),8.82(s,1H),8.26(d,J=5.5Hz,1H),7.94( d,J=7.8Hz,1H),7.86(t,J=2.1Hz,1H),7.61(dd,J=5.0,1.4Hz,1H),7.55-7.43(m,2H),7.16(dd,J =7.5,2.1Hz,1H),7.07(dd,J=8.0,4.8Hz,1H),6.36(d,J=5.9Hz,1H),4.96(t,J=4.8Hz,1H),4.12 (q,J=7.0Hz,2H),2.24-2.05(m,3H),1.93(d,J=9.6Hz,2H),1.56-1.37(4H),1.33(t,J=7.1Hz,3H)

[0428] Experimental Example: Measurement of Inhibition of DGAT2 Enzyme Activity

[0429] The inhibitory effect on DGAT2 enzyme activity was studied by subjecting the compounds of formula (1) according to the present invention to the following experiment.

[0430] 1. Preparation of DGAT2 expression vector

[0431] To prepare pBacPAK9-DGAT2 as a DGAT2 expression vector, the human DGAT2 gene amplified by polymerase chain reaction (PCR) was cloned into the EcoR1 and Xho1 sites of the pBacPAK9 (clonctech) vector. The nucleotide sequences of the primers used in the PCR were forward primer 5'CTATAAATACGGATCCCGGGAATTCATGGACTACAAGGACGACGATGACAAGCTTAAGACCCTCATAGCCGCC and reverse primer 5'TAAGCGGCCGCCCTGCAGGCCTCGAGTCAGTTCACCTCCAGGAC. The composition of the reaction solution contained 50 ng cDNA clone (OriGene), 200 μM dATP, dCTP, dTTP, dGTP, 200 nM of each primer, 1 unit of Tag DNA polymerase (Toyobo), 1 x PCR buffer, and the final volume was adjusted to 20 μl. The reaction conditions were denaturation at 95°C for 5 minutes, followed by 30 cycles of 94°C for 20 seconds, 60°C for 20 seconds, and 72°C for 90 seconds, and then continued reaction at 72°C for 7 minutes.

[0432] 2. DGAT2 Expression and Membrane Protein Preparation

[0433] The recombinant human DGAT2 protein was expressed in Sf-21 cells as insect cells using the BacPack baculovirus expression system (Clontech). The brief manufacturing process is as follows. First, the pBacPAK9-DGAT2 expression vector and BacPAK6 viral DNA (Bsu36I digest) were transfected into sf21 cells using Bacfectin to prepare a baculovirus expressing recombinant DGAT2. The baculovirus thus prepared was infected with Sf-21 cells at 10 MOI (multiplicity of infection), and the infected insect cells were collected and membrane proteins were isolated after 72 hours. To isolate membrane proteins, the cell pellet was dissolved in a sucrose solution containing 250 mM sucrose, 10 mM Tris (pH 7.4) and 1 mM ethylenediaminetetraacetic acid (EDTA), then homogenized using a dounce homogenizer, the supernatant was obtained by centrifugation at 600 × g for 15 minutes, it was centrifuged at 100,000 × g for 1 hour to discard the supernatant, and the remaining sediment was resuspended in 20 mM HEPES buffer (pH 7.4). The prepared membrane protein overexpressing DGAT2 was divided into 100 μl and stored at -80 ° C until use. The protein concentration was quantified using a BCA protein assay kit (Thermo Scientific).

[0434] 3. Measurement of Inhibition of DGAT2 Enzyme Activity

[0435] In vitro DGAT2 analysis was performed using a phospholipid flash plate (PerkinElmer) based on the SPA (scintillation proximity assay) principle. First, a DGAT2 inhibitory compound diluted 5 times from 3nM to 10μM (final concentration, 1% DMSO) was mixed in a buffer solution containing 2μg DGAT2 membrane protein and 20mM HEPES, 20mM MgCl2, 1mg / mL BSA, 50μM 1,2sn-oleoylglycerol (Sigma), placed in a 96-well flash plate (FlashPlate) and reacted at 37°C for 20 minutes, then 1μM [14C] oleoyl-CoA (PerkinElmer, NEC651050UC) was added to make the final volume 100μL, and then reacted at 37°C for 15 minutes. After the enzyme reaction was completed, 100μL of isopropanol was added, the plate was sealed with a film, and the plate was slowly shaken in a shaker. The next day, the amplified scintillation signal (cpm) was measured in a Topcounter (Packard) to measure the degree of production of [14C]-labeled triacylglycerol (TG) as a reaction product. The measured value without compound treatment was used as a positive control, and the measured value of the compound treatment group was calculated as relative % to measure the inhibitory effect of the compound on TG production. IC 50 The value is the compound concentration that inhibits TG production by 50%, and was determined by processing the response values ​​according to the compound concentration with a nonlinear regression curve using PRISM (Graphpad Inc.).

[0436] As a result of measuring the inhibitory effect of the compound of formula (1) on the DGAT2 enzyme action, the specific IC 50 The values ​​are shown in Table 1 below.

[0437] [Table 1]

[0438] Example <![CDATA[IC 50 (μM)]]> Example <![CDATA[IC 50 (μM)]]> Example <![CDATA[IC 50 (μM)]]> 1 0.035 12 0.17 23 0.061 2 0.027 13 0.33 24 7.4 3 3.4 14 3.1 25 0.45 4 0.29 15 0.013 26 0.021 5 0.011 16 0.021 27 0.0074 6 0.12 17 0.24 28 0.21 7 0.036 18 0.022 29 0.0067 8 1.8 19 0.43 30 0.25 9 0.16 20 3.9 31 9.2 10 0.019 21 1.2 32 0.07 11 0.37 22 2.1 33 3.4

Claims

1. A compound of the following formula (1) or a pharmaceutically acceptable salt thereof: [Formula (1)] in A, D and E are each independently CH or N; R1 is C1-C7 alkyl; R2 is -GJL; wherein G is -C(=O)- or a direct bond; J is C1-C7 alkylene, C2-C7 alkenylene, C1-C7 alkylene-C6-C 10 Arylene, C2-C7 alkenylene-C6-C 10 Arylene, C1-C7 alkyleneoxy-C6-C 10 Arylene, C6-C 10 arylene, 5 to 12 membered heteroarylene-5 to 12 membered heterocycloalkylene, 5 to 12 membered heteroarylene-C6-C 10 Arylene or 5 to 12 membered heteroarylene-oxy-C3-C 10 Cycloalkylene; L is hydrogen, halogen, carboxyl, carboxyl-C1-C7 alkyl, carboxyl-C1-C7 alkoxy or C6-C 10 Aryl; wherein the alkyl, alkylene, carboxyalkyl, carboxyalkoxy or aryl is optionally substituted with 1 to 4 substituents selected from hydroxy, halogen, C1-C7 alkyl and C1-C7 alkoxy; and The heterocycloalkylene or heteroarylene group includes 1 to 4 heteroatoms selected from N, O and S.

2. The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein the compound is selected from: N-(6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)-3-phenylpropanamide; Methyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)acetate; 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)acetic acid; 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)acetic acid; Methyl 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)-2-methylpropanoate; Ethyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-difluoroacetate; 3-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-dimethylpropanoic acid; (R)-1-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid; 3-(3-(6-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid; N-(6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)-3-phenylpropanamide; 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)acetic acid; 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)acetic acid; 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenoxy)-2-methylpropanoic acid; 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl-2,2-difluoroacetic acid; 3-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-dimethylpropanoic acid; 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)-2-methylpropanoic acid; (E)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-ketopropan-1-phenyl-1-yl)phenyl)-2-methylpropanoic acid; 3-(4-(1-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-methyl-1-ketopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid; 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenoxy-2-methylpropanoic acid; 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)phenyl)acetic acid; (1r,4r)-4-((2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)oxy)cyclohexane-1-carboxylic acid; N-(6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)-3-phenylpropanamide; 3-(4-(2-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-dimethylpropanoic acid; (R)-1-(2-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid; 3-(3-(6-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid; 2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenyl)-2-methylpropanoic acid; 3-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenyl)-2,2-dimethylpropanoic acid; 2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-3-ketopropyl)phenoxy)-2-methylpropanoic acid; 3-(4-(1-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-methyl-1-ketopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid; 2-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-ketoethyl)phenoxy)-2-methylpropanoic acid; (R)-1-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid; 3-(3-(6-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid; and (1r,4r)-4-((2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)oxy)cyclohexane-1-carboxylic acid.

3. A pharmaceutical composition comprising a compound of formula (1) as defined in any one of claims 1 to 2 or a pharmaceutically acceptable salt thereof as an active ingredient, and a pharmaceutically acceptable carrier.

4. Use of a compound of formula (1) as defined in any one of claims 1 to 2 or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating a disease associated with DGAT2 selected from the group consisting of fatty liver, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), diabetes, obesity, hyperlipidemia, atherosclerosis and hypercholesterolemia.

Images