Composition for delivering a physiologically active ingredient to blood vessels

Abstract

The present invention relates to a composition for delivering a physiologically active ingredient to a blood vessel. The composition including porous silica particles according to the present invention can effectively deliver a bioactive substance to a target tissue or cell in the bloodstream by modifying the particle surface to inhibit aggregation and precipitation in the blood. In addition to the above advantages, the embolization composition including porous silica particles according to the present invention also has advantages such as biodegradability and sustained release of specific physical properties, thereby achieving excellent embolization effects and targeting to target tumor tissues or cells, and thus reducing side effects.

Description

[0001] This application is a divisional application of the patent application "Composition for Delivering Bioactive Ingredients to Blood Vessels" with an application date of July 25, 2018 and an application number of 2018800619732 (International Application Number: PCT / KR2018 / 008445). Technical Field

[0002] The present invention relates to a composition for delivering a bioactive ingredient (hereinafter referred to as a "bioactive substance") to blood vessels. Background Art

[0003] A drug delivery system is a medical technology that minimizes the side effects of conventional pharmaceuticals and maximizes efficacy and effects to effectively deliver a required amount of a drug, such as a protein, nucleic acid, or other small molecule. Recently, this technology that reduces the cost and time required for developing new drugs has been combined with nanotechnology to become one of the cutting-edge technologies for creating new added value in the medical field. In the late 1980s, technologically advanced countries, such as the United States and Japan, focused on the development of drug delivery systems and the development of new drugs by companies such as pharmaceutical companies.

[0004] To date, viral genes, recombinant proteins, liposomes, cationic polymers, and various-shaped nanoparticles and nanomaterials have been used to deliver drugs into animal cells. However, many cationic liposomes and cationic polymers have been found to be unsuitable for clinical applications due to strong cytotoxicity. Also, methods of chemically modifying the backbone of nucleic acids have been attempted to enable stable penetration of nucleic acids into cell membranes. However, this method is costly, takes a long time, and requires labor-intensive processes, and thus is not suitable for clinical applications. As a meaningful attempt, drug delivery systems (DDS) using various forms of nanoparticles including quantum dots, magnetic particles, or gold nanoparticles have been developed. However, these particles have cytotoxicity and a structure that makes it difficult to introduce biopolymers such as nucleic acids, and have low intracellular introduction efficiency.

[0005] For the functional study of bioactive substances (or bioactive materials) in cells or intracellular delivery, an effective delivery system is required. However, a generally applicable delivery system capable of delivering a variety of bioactive materials, a system capable of accommodating and delivering a large amount of drugs, and a system for releasing drugs in a sustained manner have not been developed. Summary of the Invention

[0006] Problems to be Solved by the Invention

[0007] An object of the present invention is to provide a composition for delivering a bioactive substance (hereinafter referred to as a "bioactive substance") to blood vessels, which includes porous silica particles having stability in blood.

[0008] Another object of the present invention is to provide a composition for embolization (commonly referred to as "embolization composition"), which comprises biodegradable and sustained-release porous silica particles.

[0009] Solutions for Solving the Problems

[0010] 1. A composition for delivering a bioactive substance in a blood vessel, which comprises porous silica particles, wherein the bioactive substance is loaded on the surface of the particles or inside the pores of the particles, and the ζ potential of the porous silica particles is above +3 mV or below -18 mV, and

[0011] the particles are chemically modified on the surface or inside the pores.

[0012] 2. The composition according to 1 above,

[0013] wherein at least a part of the silanol groups on the surface of the particles or inside the pores of the particles are substituted by at least one functional group selected from the group consisting of: aldehyde, ketone, carbamate, sulfate, sulfonate, amino, amine, aminoalkyl, silyl, carboxyl, sulfonic acid, thiol, ammonium, mercapto, phosphate ester, ester, imide, thioimide, ether, indene, sulfonyl, methylphosphonate, polyethylene glycol, substituted or unsubstituted C1 to C 30 alkyl, substituted or unsubstituted C3 to C 30 cycloalkyl, substituted or unsubstituted C6 to C 30 aryl and C1 to C 30 ester groups.

[0014] 3. The composition according to 1 above,

[0015] wherein at least a part of the silanol groups on the surface of the particles or inside the pores of the particles are substituted by at least one functional group selected from the group consisting of: amino, amine, PEG, propyl, octyl, carboxyl, thiol, sulfonic acid, methylphosphonate and aldehyde groups.

[0016] 4. The composition according to 1 above

[0017] wherein the diameter of the particles is 100 to 1000 nm.

[0018] 5. The composition according to 1 above

[0019] wherein the ζ potential of the particles is +3 mV to +100 mV or -100 mV to -18 mV.

[0020] 6. The composition according to 1 above

[0021] wherein the particles have a volume of 0.7 to 2.2 ml per gram.

[0022] 7. The composition according to claim 1,

[0023] wherein when the absorbance ratio in Formula 1 below reaches 1 / 2, t is 20 or more:

[0024] [Formula 1]

[0025] A t / A0

[0026] (wherein A0 is the absorbance of the porous silica particles measured by placing a 5 ml suspension containing 1 mg / ml of the porous silica particles in a cylindrical permeable membrane having pores with a diameter of 50 kDa,

[0027] wherein 15 ml of the same solvent as the suspension is present outside the permeable membrane and in contact with the permeable membrane, and the inside and outside of the permeable membrane are horizontally stirred at 37 °C and 60 rpm,

[0028] A t is the absorbance of the porous silica particles measured t hours after measuring A0).

[0029] 8. The composition according to item 1 above,

[0030] wherein the maximum release amount of the bioactive substance loaded on the particles is 99 wt% or more.

[0031] 9. The composition according to item 1 above,

[0032] wherein the bioactive substance is at least one selected from the group consisting of: nucleic acids, nucleotides, proteins, peptides, amino acids, sugars, lipids, compounds, antibodies, antigens, cytokines, growth factors, and elements constituting them.

[0033] 10. The composition according to item 1 above,

[0034] Wherein the bioactive substance is at least one selected from the group consisting of: doxorubicin, irinotecan, sorafenib, adriamycin, daunomycin, mitomycin, cisplatin, epirubicin, methotrexate, 5-fluorouracil, aclacinomycin, nitrogen mustard, cyclophosphamide, bleomycin, daunorubicin, vincristine, vinblastine, vindesine, tamoxifen, valrubisin, pirarubicin, mitoxantrone, gemcitabine, idarubicin, temozolomide, paclitaxel, dexamethasone, aldesleukin, avelumab, bevacizumab, carboplatin, regorafenib, docetaxel, doxil, gefitinib, imatinib mesylate, herceptin, imatinib, aldesleukin, keytruda, opdivo, mitomycin C, nivolumab, olaparib, pembrolizumab, rituximab, sunitinib, atezolizumab, lapatinib, and ipilimumab.

[0035] 11. The composition according to item 1 above,

[0036] wherein the composition is released into the target tissue through a catheter.

[0037] 12. An embolization composition, which comprises the composition according to any one of the above 1 to 11.

[0038] 13. The composition according to the above 12,

[0039] which further comprises at least one of a contrast agent and an embolization substance.

[0040] 14. The composition according to the above 12,

[0041] which further comprises at least one embolization substance selected from the group consisting of lipiodol, dextran, polyvinyl alcohol, n-butyl cyanoacrylate, gelatin sponge, gelatin, ethanol, dextran, silica, sodium polyacrylate-vinyl alcohol copolymer, glass particles, poly-L-guluronate, polyglycolic acid-polylactic acid, polydioxanone, polyglycolic acid-co-caprolactone, polypropylene, and porous silica particles having a diameter of more than 10 μm.

[0042] 15. The composition according to the above 12, wherein the composition is released into a blood vessel directly connected to a tumor via a catheter.

[0043] Effects of the Invention

[0044] The composition comprising porous silica particles according to the present invention can effectively deliver bioactive substances to target tissues or cells in the bloodstream by modifying the particle surface to inhibit aggregation and precipitation in the blood.

[0045] In addition to the above advantages, the embolization composition comprising porous silica particles according to the present invention also has advantages such as specific physical properties such as biodegradability and sustained release, thereby obtaining excellent embolization effects and targeting to target tumor tissues or cells, thereby reducing side effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 It is a micrograph of porous silica particles according to an embodiment of the present invention.

[0047] Figure 2 It is a micrograph of porous silica particles according to an embodiment of the present invention.

[0048] Figure 3 It is a micrograph of small hole particles in a process for manufacturing porous silica particles according to an embodiment of the present invention.

[0049] Figure 4 It is a micrograph of small hole particles according to an embodiment of the present invention.

[0050] Figure 5Microscopic image of the pore size of porous silica particles according to an embodiment of the present invention.

[0051] In Figure 5 a degradable delivery vehicle (DDV) is the particle in this embodiment, where the number in parentheses represents the diameter of the particle and the subscript number represents the pore size. For example, DDV200 10 refers to a particle with a particle size of 200 nm and a pore size of 10 nm in the embodiment.

[0052] Figure 6 Microscopic image capable of confirming the biodegradability of porous silica particles according to an embodiment of the present invention.

[0053] Figure 7 View showing a tube with a cylindrical permeable (or porous) membrane provided according to an embodiment of the present invention.

[0054] Figure 8 Graph showing the results of the decrease in absorbance of porous silica particles according to an embodiment of the present invention over time.

[0055] Figure 9 Graph and table showing the results of the decrease in absorbance of porous silica particles according to an embodiment of the present invention over time according to particle size.

[0056] Figure 10 Graph and table showing the results of the decrease in absorbance of porous silica particles according to an embodiment of the present invention over time according to pore size.

[0057] Figure 11 Graph showing the results of the decrease in absorbance of porous silica particles according to an embodiment of the present invention over time according to environmental pH.

[0058] Figure 12 Graph showing the results of the decrease in absorbance of porous silica particles according to an embodiment of the present invention.

[0059] Figure 13 Graph showing the amount of doxorubicin released from doxorubicin-loaded porous silica particles under two conditions.

[0060] Figure 14 Graph showing the amount of irinotecan released from irinotecan-loaded porous silica particles.

[0061] Figure 15 Graph showing the amount of sorafenib released from sorafenib-loaded porous silica particles.

[0062] Figure 16 A graph showing the amount of retinoic acid released from porous silica particles loaded with retinoic acid.

[0063] Figure 17 A graph showing the amount of p53 protein released from porous silica particles loaded with p53 protein.

[0064] Figure 18 A view showing the tube for identifying the release of the loaded bioactive substance.

[0065] Figure 19 A graph showing the amount of siRNA released from porous silica particles loaded with siRNA.

[0066] Figure 20 and 21 A graph showing the amount of pDNA released from porous silica particles loaded with pDNA.

[0067] Figure 22 A graph showing the amount of linear DNA released from porous silica particles loaded with linear DNA.

[0068] Figure 23 A graph showing the amount of BSA released from porous silica particles loaded with BSA.

[0069] Figure 24 A graph showing the amounts of IgG, antibody 1, and antibody 2 released from porous silica particles loaded with IgG (A), antibody 1 (B), and antibody 2 (C), respectively.

[0070] Figure 25 A graph showing the amount of RNase released from porous silica particles loaded with RNase.

[0071] Figure 26 An image showing that Cas9 protein is loaded on porous silica particles and delivered to cells.

[0072] Figure 27 An image and graph (A) showing that siRNA is loaded on porous silica particles and released in mice; the delivery and therapeutic effect in mice of a composition comprising porous silica particles loaded with doxorubicin, siRNA, RNase A, and a peptide (B); and the delivery of the composition of the present invention through a catheter (C).

[0073] Figure 28 A graph showing the FT-IR spectrum of porous silica particles modified with anionic functional groups.

[0074] Figure 29Images and figures showing the degree of precipitation of porous silica particles in a blood-simulating solution.

[0075] Figure 30 Views showing the degree of hemolysis of red blood cells by modified porous silica particles.

[0076] Figure 31 Views showing the degree of hemolysis of red blood cells by unmodified porous silica particles.

[0077] Figure 32 Views showing the doxorubicin loading capacity of porous silica particles.

[0078] Figure 33 Figures showing the results of the cytotoxicity test of porous silica particles.

[0079] Figure 34 Images showing the particle stability when mixing porous silica particles with lipiodol for emulsification.

[0080] Figure 35 Images showing the visual observation results of a rabbit liver excised after embolization using a composition for embolization including porous silica particles.

[0081] Figure 36 Figures showing (A) the targeting property of a composition for embolization including porous silica particles to a target tissue; (B) the targeting property to target cells; (C) a figure showing that the toxicity of the above composition to surrounding normal cells is negligible; and (D) the targeting property of the above composition to a target tumor.

[0082] Figure 37 Views and figures showing the low survival rate of rabbit liver cancer cells (A and B) and the measurement results of AST and ALT concentrations when embolization is performed using a composition for embolization including porous silica particles, indicating no hepatotoxicity. Detailed Description

[0083] As used herein, porous silica particles are fine nano-porous silica microstructures including pores with a size range from a few nanometers to a few micrometers, having a clear regularity in pore arrangement, and can be appropriately controlled in terms of material properties (pore size, specific surface area, surface properties, etc.) to adapt to the use environment. Porous silica particles are also referred to as mesoporous silica particles.

[0084] Hereinafter, the present invention will be described in detail.

[0085] The present invention provides a composition for delivering a drug in a blood vessel, which comprises porous silica particles for loading a physiologically active ("bioactive") substance on the surface of the particles or inside their pores, while having a ζ potential of more than +3 mV or less than -18 mV, wherein the particles are chemically modified on the surface of the particles or inside the pores.

[0086] In the composition of the present invention, the bioactive substance is a physiologically active substance / biofunctional regulator that is loaded on the porous silica particles and delivered to an individual to exhibit activity, and may include, for example, at least one selected from the group consisting of: low molecular weight drugs, gene drugs, protein drugs, extracts, nucleic acids, nucleotides, proteins, peptides, antibodies, antigens, RNAs, DNAs, PNAs, aptamers, chemical substances, enzymes, amino acids, sugars, lipids, compounds (natural and / or synthetic compounds) and their components. For example, it may be at least one selected from the group consisting of: doxorubicin, irinotecan, sorafenib, adriamycin, daunomycin, mitomycin, cisplatin, epirubicin, methotrexate, 5-fluorouracil, aclarubicin, nitrogen mustard, cyclophosphamide, bleomycin, daunorubicin, vincristine, vinblastine, vindesine, tamoxifen, valrubicin, pirarubicin, mitoxantrone, gemcitabine, idarubicin, temozolomide, paclitaxel, dexamethasone, aldesleukin, avastin, bevacizumab, carboplatin, regorafenib, docetaxel, dosil, gefitinib, imatinib mesylate, herceptin, imatinib, aldesleukin, pembrolizumab, nivolumab, olaparib, pembrolizumab, rituximab, sunitinib, atezolizumab, lapatinib and ipilimumab, but not limited thereto. These substances may include the specific examples described below.

[0087] In the composition of the present invention, the bioactive substance may be a therapeutic active agent capable of ensuring a direct or indirect, therapeutic, physiological and / or pharmacological effect on a human or animal organism.

[0088] The therapeutic active agent may be, for example, typical medicines, drugs, prodrugs or target groups, or drugs or prodrugs including target groups.

[0089] Therapeutic active agents can include, for example: cardiovascular drugs, especially antihypertensive drugs (e.g., calcium channel blockers or calcium antagonists) and antiarrhythmic drugs; congestive heart failure drugs; muscle contractors; vasodilators; ACE inhibitors; diuretics; deoxydehydrase inhibitors; cardiac glycosides; phosphodiesterase inhibitors; blockers; β-blockers; sodium channel blockers; potassium channel blockers; β-adrenergic agonists; platelet inhibitors; angiotensin II antagonists; anticoagulants; thrombolytics; bleeding therapeutics; anemia therapeutics; thrombin inhibitors; antiparasitic drugs; antibacterial drugs; anti-inflammatory drugs, especially non-steroidal anti-inflammatory agents (NSAIDs), more especially COX-2 inhibitors; steroidal anti-inflammatory drugs; prophylactic anti-inflammatory drugs; anti-glaucoma drugs; mast cell stabilizers; mydriatic drugs; drugs affecting the respiratory system; allergic rhinitis drugs; α-adrenergic antagonists; corticosteroids; chronic obstructive pulmonary disease drugs; xanthine oxidase inhibitors; anti-arthritis drugs; gout therapies; active drug and active drug antagonists; anti-tuberculosis drugs; anti-fungal drugs; anti-protozoal drugs; helminthics; antiviral drugs, especially respiratory antiviral drugs, anti-herpes, cytomegalovirus, human immunodeficiency virus and hepatitis infection antiviral drugs; leukemia and Kaposi's sarcoma therapeutics; pain control agents, especially opioid drugs including anesthetics and analgesics, opioid receptor agonists, opioid receptor partial agonists, opioid antagonists, opioid receptor mixed agonist-antagonists; neuroleptics; sympathomimetic drugs; adrenergic antagonists; drugs affecting neurotransmitter uptake and release; anticholinergic drugs; anti-hemorrhagic drugs; prophylactic or therapeutic agents for radiotherapy or chemotherapy; adipogenic drugs; lipolytic drugs; anti-obesity drugs such as lipase inhibitors; sympathomimetic stimulants; gastric ulcer and inflammation therapeutics such as proton pump inhibitors; prostaglandins; VEGF inhibitors; hypolipidemic drugs, especially statins; drugs affecting the central nervous system (CNS), such as neuroleptics, antiepileptic drugs and antiseizure (anticonvulsant) drugs, psychoactive agents, stimulants, anti-anxiety drugs and hypnotic drugs; antidepressant drugs; anti-Parkinson's drugs; hormones such as sex hormones and their fragments; growth hormone antagonists; gonadotropin-releasing hormone and its analogs; steroid hormones and their antagonists; selective estrogen regulators; growth factors; anti-diabetic drugs such as insulin, insulin fragments, insulin analogs, glucagon-like peptides and hypoglycemic drugs; H1, H2, H3 and H4 antihistamines;Peptides, proteins, polypeptides, nucleic acids, and oligonucleotide drugs; analogs, fragments, and variants of natural proteins, polypeptides, oligonucleotides, and nucleic acids; drugs for treating migraine; asthma drugs; cholinergic antagonists; glucocorticoids; androgens; anti-androgens; adrenal corticosteroid biosynthesis inhibitors; osteoporosis therapeutics such as bisphosphonate drugs; anti-thyroid drugs; UV blockers, UV protectors, and filters; cytokine antagonists; anti-tumor drugs; anti-Alzheimer's drugs; HMGCoA reductase inhibitors; fibrate drugs; cholesterol absorption inhibitors; HDL cholesterol enhancers; triglyceride reducers; anti-aging or anti-wrinkle drugs; precursor molecules for hormone development; proteins such as collagen and elastin, antibacterial drugs; anti-acne drugs; antioxidants; hair care and skin whitening agents; UV blockers, UV protectors, and filters; variants of human apolipoproteins; precursor molecules for hormone development; proteins and their peptides; amino acids; plant extracts such as grape seed extract; dehydroepiandrosterone (DHEA); isoflavones; nutrients including vitamins, phytosterols and iridoid glycosides, sesquiterpene lactones, terpenes, phenolic glycosides, triterpenes, hydroquinone derivatives, phenylalkanones; antioxidants such as retinol and other retinoids, retinoids including coenzyme Q10; omega-3-fatty acids; glucosamine; nucleic acids, oligonucleotides, antisense drugs; enzymes; coenzymes; cytokine analogs; cytokine agonists; cytokine antagonists; immunoglobulins; antibodies; antibody drugs; gene therapy drugs; lipoproteins; erythropoietin; vaccines; and low molecular weight therapeutics for treating or preventing human or animal diseases such as allergy / asthma, arthritis, cancer, diabetes, growth disorders, cardiovascular diseases, inflammation, immune disorders, hair loss, pain, eye diseases, epilepsy, gynecological disorders, CNS diseases, viral infections, bacterial infections, parasitic infections, G1 diseases, obesity, and blood diseases, but not limited thereto.;

[0090] The therapeutic active agent can be an additional active agent, including, for example, erythropoietin (EPO), thrombopoietin, cytokines such as interleukins (including IL-1 to IL-17), insulin, insulin-like growth factors (including IGF-1 and IGF-2), epidermal growth factor (EGF), transforming growth factors (including TGF-α and TGF-β), human growth hormone, transferrin, low-density lipoprotein, high-density lipoprotein, leptin, VEGF, PDGF, ciliary neurotrophic factor, prolactin, adrenocorticotropic hormone (ACTH), calcitonin, human chorionic gonadotropin, cortisol, estradiol, follicle-stimulating hormone (FSH), thyroid-stimulating hormone (TSH), luteinizing hormone (LH), progesterone, testosterone, toxins including ricin, etc.

[0091] The therapeutic active agent may be selected from the group of drugs used for treating tumor diseases or cell or tissue modification. Suitable therapeutic dosage forms may be anti-tumor agents, including, for example: alkylating agents, especially alkyl sulfonates, such as busulfan, improsulfan, piposulfane, benzodepa, carboquone, metredepa, aziridines such as uredepa, etc.; ethyleneimine and methylmelamine, such as altretamine, triethylene melamine, triethylene phosphoramide, triethylene thiophosphoramide, trimethylolmelamine, etc.; chlorambucil, chlornaphazine, cyclophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, nomobichin, phenesterine, prednimustine, trofosfamide, so-called nitrogen mustard such as uracil mustard, etc.; nitrosourea compounds such as carmustine, chlorozotocin, fotenmustine, lomustine, nimustine, ranimustine, etc.; dacarbazine, mannomustine, mitobranitol, mitolactol, etc.; pipobroman; sorafenib; doxorubicin and cisplatin and their derivatives, etc., as well as any combination and / or derivative of the above compounds.

[0092] The therapeutic active agent may be selected from the group including antiviral agents and antibacterial agents, such as aclacinomycin, actinomycin D, anthramycin, azaserin, bleomycin, cuctinomycin, carubicin, carzinophilin, chromomycin, ductinomycin, daunorbicin, 6-diazo-5-oxn-1-norleucin, doxorubicin, epirubicin, mitomycin, mycophenolsaure, mogalumycin, olivomycin, peplomycin, plicamycin, porfiromycin, puromycin, streptonigrin, streptozocin, tubercidine, ubenimex, zinostatin, zorubicin, aminoglycoside or polyene, macrolid-antibiotics, and any combination and / or derivative thereof.

[0093] The therapeutic active agent may be selected from: endostatin, angiostatin, interferon, platelet factor 4 (PF4), thrombospondin, transforming growth factor β, tissue inhibitors of metalloproteinase-1, -2 and -3 (timp-1, -2 and -3), TNP-470, marimastat, neovastat, BMS-275291, COL-3, AG3340, thalidomide, squalamine, combrestastatin, SU5416, SU6668, IFN-[α], EMD121974, CAI, IL-12, radio-sensitizer drugs such as IM-862, steroidal or non-steroidal anti-inflammatory drugs, or agents involved in angiogenesis, and any combination and / or derivative thereof.

[0094] The therapeutic active agent may be selected from the group including nucleic acids, wherein the term "nucleic acid" includes oligonucleotides in which at least two nucleotides are covalently linked to each other to obtain a gene therapy or antisense effect. The nucleic acid preferably has a phosphodiester bond and includes analogs having different backbones. The analogs may have backbones including, for example, phosphorothioate, dithiophosphate, O-methylphosphoramidite compounds, and peptide-nucleic-acid backbones and their compounds, etc. Other analogs are those having ionic backbones, non-ionic backbones, or non-ribose backbones, respectively. Nucleic acids containing one or more carbocyclic sugars may be suitable as the nucleic acids used in the present invention. In addition to selecting nucleic acids and nucleic acid analogs known in the art, any combination of naturally occurring nucleic acids and their analogs or mixtures of nucleic acids and their analogs may also be used.

[0095] The therapeutic active agent may include anti-migration, anti-proliferation or immunosuppressive, anti-inflammatory or re-endotheliating agents, such as everolimus, tacrolimus, sirolimus, mycofenolate-mofetil, rapamycin, paclitaxel, actinomycin D, angiopeptin, batimastate, estradiol, VEGF, statins, and their derivatives and analogs.

[0096] Therapeutic active agents may include opioid receptor agonists and antagonists, compounds showing agonist / antagonist combined activity, and compounds showing partial agonist activity, such as: morphine, depotmorphine, etropin, diacetylmorphine, dihydromorphine, hydromorphone, levorpanol, methadone, levomethadyl, meperidine, fentanyl, serpentanyl, alpentanyl, codeine, hydrocodone, oxycodone, thebaine, desormorphine, nicomorphine, dipropanoylmorphine, benzylmorphine, ethylmorphine, petidine, methadone, tramadol, dextropropoxyphene; naloxone and naltrexone; and buprenorphine, buprenorphine, butorpanol, pentazoxin and ethyl ketocyclazoxin.

[0097] The therapeutic active agent and its combinations can be selected from: heparin, synthetic heparin analogs (e.g., fondaparinux), hirudin, antithrombin III, recombinant human activated protein C (drotrecogin alpha); fibrinolytic agents such as alteplase, plasmin, streptokinase, factor VIIa, prourokinase, urokinase, anistreplase, streptokinase, etc.; platelet aggregation inhibitors such as acetylsalicylic acid (aspirin), ticlopidine, clopidogrel, abciximab, dextran, etc.; corticosteroids such as alclometasone, amcinonide, augmented betamethasone, beclomethasone, betamethasone, budesonide, cortisone, clobetasol, clocortolone, desonide, desoximetasone, dexamethasone, fluocinolone, fluocinonide, fluandrenolide, flunisolide, fluticasone, halcinonide, halobetasol, hydrocortisone, methylprednisolone, mometasone, prednicarbate, prednisone, prednisolone, triamcinolone, etc.;Non-steroidal anti-inflammatory drugs (NSAIDs) such as diclofenac, diflunisal, etodolac, fenoprofen, flurbiprofen, ibuprofen, indomethacin, ketoprofen, ketorolac, meclofenamate, mefenamic acid, meloxicam, nabumetone, naproxen, oxaprozin, piroxicam, salsalate, sulindac, tolmetin, celecoxib, rofecoxib, etc.; cytostatic agents such as alkaloids, such as vinblastine, vincristine, etc. and podophyllotoxin, etc.; cytotoxic antibiotics such as daunorubicin, doxorubicin, other anthracyclines and related substances, bleomycin, mitomycin, etc.; antimetabolites such as folic acid analogs, purine analogs or pyrimidine analogs, etc.; paclitaxel, docetaxel, sirolimus, etc.; platinum compounds such as carboplatin, cisplatin or oxaliplatin, etc.; amsacrin, irinotecan, imatinib, topotecan, interferon-α2a, interferon-α2b, hydroxycarbide, miltefosine, pentostatin, porfimer, aldesleukin, bexaroten, tretinoin; antiandrogens and antiestrogens; antiarrhythmic drugs such as quinidine-type antiarrhythmic drugs, specifically, type I antiarrhythmic drugs such as quinidine-type antiarrhythmic drugs (quinidine type antiarrhythmic), quinidine, disopyramid, azmaline, prajmalium bitartrate, detajimium bitartrate, etc.; for example, lidocaine-type antiarrhythmic drugs such as lidocaine, mexiletin, phenytoin, tocainid, etc.;For example, class Ic antiarrhythmic drugs such as propafenone and flecainide (acetate), etc.; class II antiarrhythmic drugs, β-blockers such as metoprolol, esmolol, propranolol, atenolol, oxprenolol, etc.; class III antiarrhythmic drugs such as amiodarone and sotalol; class IV antiarrhythmic drugs such as diltiazem, verapamil, gallopamil, etc.; other antiarrhythmic drugs such as adenosine, orciprenaline, ipratropium, bromide, etc.; preparations for promoting angiogenesis in the myocardium, for example, vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), non-viral DNA, viral DNA, endothelial growth factor, etc.; FGF-1, FGF-2, VEGF and TGF; antibiotics, monoclonal antibodies, anti-carrier proteins; stem cells, endothelial progenitor cells (EPCs); cardiac glycosides such as acetyl digoxin / methyldigoxin, digitoxin, digoxin, etc.; cardiotonic glycosides such as ouabain, proscillaridin, etc.; antihypertensive agents such as methyldopa, imidazoline receptor agonists such as CNS-active antiadrenergic substances, etc.; calcium channel blockers such as nifedipine, nitrendipine, etc.; ACE inhibitors; quinaprilate, cilazapril, moexipril, trandolapril, spirapril, imidapril; angiotensin II antagonists; candesartan cilexetil, valsartan, telmisartan, olmesartan medoxomil, eprosartan;Peripheral activating α-receptor blockers such as prazosin, urapidil, doxazosin, bunazosin, terazosin, indoramin, etc.; vasodilators such as dihydralazine, diisopropylamine dichloraetate, minoxidil, nitroprusside sodium, etc.; other antihypertensive agents such as indapamide, co-dergocrine mesylate, dihydroergotoxin methanesulfonate, cicletanin, bosetan, fludrocortisones, etc.; antihypertensive drugs such as phosphodiesterase inhibitors such as milrinon and enoximon, specifically, adrenergic and dopaminergic substances, for example, dobutamine, epinephrine, etilefrine, norfenefrine, norepinephrine, oxilofrine, dopamine, midodrine, pholedrine, methyl ameziniumm, etc.; partial adrenergic receptor agonists such as dihydroergotamine; inflammatory cytokines such as fibronectin, polylysine, ethylene vinyl acetate, TGFβ, PDGF, VEGF, bFGF, TNFα, NGF, GM-CSF, IGF-a, IL-1, IL-8, IL-6, growth hormone, etc.; in addition, adhesive substances such as cyanoacrylate, beryllium, silica, etc.;In addition, growth factors such as erythropoietin, hormones such as adrenocorticotropic hormone, gonadotropin, growth hormone, thyroid-stimulating hormone, desmopressin, terlipressin, pxytocin, cetrorelix, corticorelin, leuprorelin, triptorelin, gonadorelin, ganirelix, buserelin, naarelin, goserelin, etc., and regulatory peptides such as somatostatin, octreotid, etc.; bone and cartilage stimulating peptides, recombinant human BMP-2 (rhBMP-2), recombinant BMPs such as bisphosphates (e.g., risedronate, pamidronate, ibandronate, zoledronic acid, clodronic acid, etidronic acid, alendronic acid, tiludronic acid, etc.), bone morphogenetic proteins (BMPs), which are fluorides such as sodium monofluorophosphate, sodium fluoride, etc.; calcitonin, dihydrotachystyrol; epidermal growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), transforming growth factor-β (TGF-β), transforming growth factor-α (TGF-α), erythropoietin (EPO), insulin-like growth factor-I (IGF-I), insulin-like growth factor-II (IGF-II), interleukin-1 (IL-1), interleukin-2 (IL 2), interleukin-6 (IL-6), interleukin-8 (IL-8), tumor necrosis factor-α (TNF-α), tumor necrosis factor-β (TNF-β), interferon-γ (INF-γ), colony-stimulating factor (CSF); monocyte chemoattractant protein, fibroblast stimulating factor 1, histamine, fibrin or fibrinogen, endothelin-1, angiotensin II, collagen, bromocriptine, metysergide, methotrexate, carbon tetrachloride, thioacetamide and ethanol; in addition, silver (ions), titanium dioxide, specifically, for example, β-lactamase-sensitive penicillins such as benzylpenicillin (penicillin G), phenoxymethyl phenicillin (penicillin V), etc.;For example, β-lactamase-resistant penicillins such as amoxicillin, ampicillin, bacampicillin, etc.; acylaminopenicillins such as mezlocillin and piperacillin; carboxypenicillins such as cefazoline, cefuroxim, cefoxitin, cefotiam, cefaclor, cefadroxil, cefalexin, loracarbef, cefixime, cefuroximaxetil, ceftibuten, cefpodoximproxetil, etc.; aztreonam, ertapenem, meropenem; β-lactam inhibitors such as sulbactam and sulfamicillintosylate; tetracyclines such as doxycycline, minocycline, tetracycline, chlorotetracycline, oxytetracycline, etc.; aminoglycosides such as gentamicin, neomycin, streptomycin, tobramycin, amikacin, netilmicin, paromomycin, framyceetin, spectinomycin, etc.; macrolide antibiotics such as azithromycin, clarithromycin, erythromycin, roxithromycin, spiramycin, josamycin, etc.; lincosamides such as clindamycin and ciprofloxacin;Rotase inhibitors such as fluoroquinolones, for example, ciprofloxacin, ofloxacin, moxifloxacin, norfloxacin, gatifloxacin, enoxacin, fleroxacin, levofloxacin, etc.; quinolones such as pipemidic acid; sulfonamides, trimethoprim, sulfadiazine, sulffalene; glycopeptide antibiotics such as vancomycin and teicoplanin; polypeptide antibiotics such as polymyxin, for example, colistin and polymyxin-b; nitroimidazole derivatives, for example, metronidazole and tinidazole; aminoquinolones such as chloroquine, mefloquine, hydroxychloroquine sulfate, etc.; biguanides such as proguanil; quinine alkaloids such as pyrimethamine and diaminopyrimidine; amide alcohols such as chloramphenicol; rifabutin, dapsone, fusidic acid, fosfomycin, nifuratel, telithromycin, fusafungin, pentamidine diisethionate, rifampicin, taurolidine, atovaquone, linezolid;Viral statics such as aciclovir, ganciclovir, famciclovir, foscarnet, inosine-(dimefranol-4-acetamidobenzoate), valganciclovir, valaciclovir, cidofovir, brivudin, etc.; antiretroviral active ingredients (nucleoside analogue reverse transcriptase inhibitors and derivatives) such as lamivudine, zalcitabine, didanosine, zidovudin, tenofovir, stavudin, avacavir, etc.; non-nucleoside analogue reverse transcriptase inhibitors; amprenavir, indinavir, saquinavir, lopinavir, ritonavir, nelfinavir; and amantadine, ribavirin, zanamivir, oseltamivir or lamivudine, and any combination and mixture thereof.

[0098] The therapeutic active agent can be an antidepressant, antipsychotic or anxiolytic agent, including, for example: alprazolam, amoxapine, bentazepam, bromazepam, clolazepine, clobazam, clotiazepam, diazepam, lorazepam, flunitrazepam, flulazepam, lormetazepam, medazepam, nitrazepam, oxazepam, temazepam, maprotiline, myanserine, nortriptyline, risperidone, sertraline, trazodone, valoperidol, trimipramine maleate fluoxetine, ondansetron, midazolam, chlorpromazine, haloperidol, triazolam, clozapine, fluoropromazine, fluphenazine decanoate, fluanisone, perfenazine, pimozide, prochlorperazine, sulpiride, thioridazine, paroxetine, citalopram, bupropion, phenelzine, olanzapine, divalproex sodium and venlafaxine.

[0099] Therapeutic active agents may include opioid receptor agonists and antagonists, and compounds exhibiting agonist / antagonist combined activity, and compounds exhibiting partial agonist activity, such as: morphine, sustained-release morphine, etorphine, diacetylmorphine, dihydromorphine, hydromorphone, levorphanol, methadone, levomethadone, pethidine, fentanyl, sufentanil, alfentanil, codeine, hydrocodone, oxycodone, thebaine, desomorphine, nicomorphine, dipropionylmorphine, benzylmorphine, ethylmorphine, pethidine, methadone, tramadol, dextropropoxyphene; naloxone and naltrexone; and buprenorphine, nalbuphine, butorphanol, pentazocine and ethylchlorocyclazocine.

[0100] The therapeutic active agent may be a tricyclic compound, including, for example, azothiophene, amitriptyline, famotidine, promethazine, paroxetine, oxcarbazepine and mirtazapine.

[0101] The therapeutic active agent may be an antidiabetic drug, including, for example, acetohexamide, chlorpropamide, glibenclamide, gliclazide, glipizide, metformin, tolazamide, glimepiride and tolbutamide.

[0102] The therapeutic active agent can be an antiepileptic agent, including, for example, beclamide, carbamazepine, gabapentin, tiagabine, vigabatrin, topiramate, clonazepam, ethotoin, metodine, methsuximide, methyl phenobarbitone, oxycarbazepine, paramethadione, phenacemide, phenobarbitone, phenyltoin, phensuximide, primidone, sulthiamine, phenytoin sodium, nitrofurantoin monohydrate, gabapentin, lamotrigine, zonisamide, ethosuximide and valproic acid.

[0103] The therapeutic active agent can be a hypnotic / sedative and / or muscle relaxant, including, for example, zolpidem tartrate, amylobarbitone, barbitone, butobarbitone, pentobarbitone, brotizolam, carbromal, chlordiazepoxide, chlormethiazole, ethinamate, meprobamate, methaqualone, cyclobenzaprene, cyclobenzaprine, tizanidine, baclofen, butalbital, zopiclone, atracurium, tubocurarine and phenobarbital.

[0104] The therapeutic active agent can be an antifungal, an antiprotozoal or an antiparasitic agent, including, for example: amphotericin, butoconazole nitrate, clotrimazole, econazole nitrate, fluconazole, flucytosine, griseofulvin, itraconazole, ketoconazole, miconazole, natamycin, nystatin, sulconazole nitrate, terconazole, tioconazole and undecenoic acid; benznidazole, clioquinol, decoquinate, diiodohydroxyquinoline, diloxanide furoate, dinitolmide, furazolidone, metronidazole, nimorazole, nitrofurazone, ornidazole, terbinafine, clotrimazole, chloroquine, mefloquine, itraconazole, pyrimethamine, praziquantel, quinacrine, mebendazole and tinidazole.

[0105] The therapeutic active agent can be an antihypertensive or a cardiopathic agent, including, for example, candesartan, hydralazine, clonidine, triamterene, felodipine, gemfibrozil, fenofibrate, nifedipine, prazosin, mecamylamine, doxazosin, dobutamine and cilexetil.

[0106] The therapeutic active agent can be an anti-migraine drug, including, for example, dihydroergotamine mesylate, ergotamine tartrate, methysergide maleate, pizotifen maleate, and sumatriptan succinate.

[0107] The therapeutic active agent can be an antimuscarinic agent, including, for example, atropine, benzhexol, biferdene, ethopropazine, hyoscyamine, mepenzolate bromide, oxybutynin, oxyphencyclimine hydrochloride, and tropicamide.

[0108] The therapeutic active agent can be an anti-tumor agent (or immunosuppressive agent), including, for example, aminoglutethimide, amsacrine, azathioprine, busulfan, chlorambucil, cyclosporin, dacarbazine, estramustine, etoposide, lomustine, melphalan, mercaptopurine, methotrexate, mitomycin, mitotane, mitoxanthrone, procarbazine, tamoxifen citrate, testolactone, tacrolimus, and sirolimus.

[0109] The therapeutic active agent can be an anti-Parkinson agent, including, for example, bromocriptine mesylate, levodopa, tolcapone, ropinirole, bromocriptine, an antihyperglycemic agent, such as sulfonylurea biguanide, an α-glucosidase inhibitor, thiazolidinedione, cabergoline, carbidopa, and lisuride maleate.

[0110] The therapeutic active agent can be an antithyroid agent, including, for example, carbimazole and propylthiouracil.

[0111] The therapeutic active agent can be a cardiotonic agent, including, for example, amrinone, milrinone, digitoxin, enoximone, lanatoside C, and medigoxin.

[0112] The therapeutic active agent can be a hypolipidemic or hyperlipidemic agent, including, for example, fenofibrate, clofibrate, probucol, ezetimibe, and torcetrapib.

[0113] The therapeutic active agent can be an anti-inflammatory agent, including, for example, meloxicam, triamcinolone, cromolyn, nedocromil, hydroxychloroquine sulfate, montelukast, zileuton, zafirlukast, and meloxicamp.

[0114] The therapeutic active agent can be an antihistamine, including, for example, fexofenadine, chloral hydrate, hydroxyzine, promethazine, cetirizine, cimetidine, cyclizine, meclizine, dimenhydrinate, loratadine, nizatadine, and promethazine.

[0115] The therapeutic active agent can be an anti-ulcer agent, including, for example, omeprazole, lansoprazole, pantoprazole, and ranitidine.

[0116] The therapeutic active agent can be a diuretic, including, for example, hydrochlorothiazide, amiloride, acetazolamide, furosemide, and torsemide.

[0117] The therapeutic active agent can be a retinoid, including, for example: first-generation retinoids such as retinol, retinal, tretinoin (retinoic acid, retin-A), isotretinoin, and acitretin; second-generation retinoids such as etretinate and its metabolite, namely acitretin; third-generation retinoids such as tazarotene, bexarotene, and adapalene.

[0118] The therapeutic active agent can be a statin and its derivatives, including, for example, atorvastatin, fluvastatin, lovastatin, nystatin, rosuvastatin, pravastatin, orlistat, and simvastatin.

[0119] The therapeutic active agent can be a stimulant, including, for example, amfetamine, pentamine, tyramine, ephedrine, metaraminol, phenylephrine, dexfamfetamine, dexfenfluramine, fenfluramine, nicotine, caffeine, and marginol.

[0120] The therapeutic active agent can be a vasodilator, including, for example, carvedilol, terazosin, phentolamine, and menthol.

[0121] The therapeutic active agent can be an anti-Alzheimer's disease drug, including, for example, levetiracetam, levetiracetam, and donepezil.

[0122] The therapeutic active agent can be an ACE inhibitor, including, for example, benzapril, enalapril, ramipril, fosinopril sodium, lisinopril, minoxidil, isosorbide, ramipril, and quinapril.

[0123] The therapeutic active agent can be a β - adrenergic receptor antagonist, including, for example, atenolol, timolol, pindolol, pronanolol hydrochloride, bisoprolol, esmolol, metoprolol succinate, metoprolol, and metoprolol tartrate.

[0124] The therapeutic active agent can be an angiotensin II antagonist, which includes losartan.

[0125] The therapeutic active agent can be a platelet inhibitor, including, for example, abciximab, clopidogrel, tirofiban, and aspirin.

[0126] The therapeutic active agent can be an alcohol or a phenol, including, for example, tramadol, tramadol hydrochloride, allopurinol, calcitriol, cilostazol, sotalol, ursodiol, bromperidol, droperidol, flupenthixol decanoate, albuterol, albuterol sulfate, carisoprodol, clobetasol, ropinirol, labetalol, and methocarbamol.

[0127] The therapeutic active agent can be a ketone or an ester, including, for example, amiodarone, fluticasone, spironolactone, prednisone, trazodone, desoxymethason, methylprednisolone, benzonatate nabumetone, and buspirone.

[0128] The therapeutic active agent can be an anti - emetic, including, for example, metoclopramide.

[0129] The therapeutic active agent can be an ophthalmic therapeutic agent, including, for example, dorzolamide, brimonidine, olopatadine, cyclopentolate, pilocarpine, and ecothiopate.

[0130] The therapeutic active agent can be an anticoagulant or an antithrombotic agent, including, for example, warfarin, enoxaparin, and lepirudin.

[0131] The therapeutic active agent can be a gout therapeutic agent, including, for example, probenesin and sulfinpyrazone.

[0132] The therapeutic active agent can be a COPD or asthma therapeutic agent, including, for example, ipratropium bromide.

[0133] The therapeutic active agent can be an osteoporosis therapeutic agent, including, for example, raloxifene, pamidronate, and risedronic acid.

[0134] The therapeutic active agent can be a peptide for cosmetics, including, for example, acetyl hexapeptide-3, acetyl hexapeptide-8, acetyl octapeptide, and 1-carnosine.

[0135] The therapeutic active agent can include, for example: vaccines including toxoids (inactivated toxic compounds); proteins, protein subunits, and polypeptides; polynucleotides such as DNA and RNA; conjugates; vaccines containing saponins, virosomes, inorganic and organic adjuvants, such as zostavax.

[0136] The therapeutic active agent can be a nutraceutical or cosmeceutical active substance, including, for example: coenzyme Q10 (or ubiquinone), panthenol or resveratrol; carotenoids such as α, β or γ-carotene, lycopene, lutein, zeaxanthin and astaxanthin; phyto-nutrients such as lycopene, lutein, and thioxanthin; ω-3-fatty acids, including linoleic acid, conjugated linoleic acid, docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) and their glycerides; fat-soluble vitamins, including vitamin D (D2, D3 and their derivatives), vitamin E (α, β, γ, δ-tocopherol or α, β, γ, δ-tocotrienol), vitamin A (retinol, retinal, retinoic acid and their derivatives), vitamin K (K1, K2, K3 and their derivatives), capric / caprylic triglyceride, folic acid, iron, niacin, glyceryl mono-linoleate, ω-6 fatty acid, vitamin F, selenium, cyanocobalamin, aloe vera, β-glucan, bisabolol, camellia sinensis (green tea) extract, centella asiatica extract, cetyl olivate, chlorophyll, sweet orange oil, cocoyl proline, diisooctyl ether, disodium lauroiminodipropionate tocopheryl phosphate (vitamin E phosphate), glycerol, glyceryl monooleate, glycyrrhiza glabra extract, hamamelis virginiana extract, lactic acid, lecithin, lutein, macadamia ternifolia seed oil, chamomilla recutita extract, evening primrose oil, olea europaea leaf extract, rice bran oil, persea gratissima oil, milkweed extract, pomegranate sterols, resveratrol, rose oil, sandalwood oil, titanium dioxide, folic acid, glycerol, glyceryl linoleate (ω-6 (fatty acid vitamin F)), retinyl palmitate, vitis vinifera seed oil, halobetasol, adenosine, adenosine triphosphate, α-hydroxy acid, allantoin, hyaluronic acid and derivatives, isolutrol, tranexamic acid, glycolic acid, arginine, glucosamine ascorbate, ascorbyl palmitate, salicylic acid, carnosic acid, α-lipoic acid, γ-linolenic acid (GLA), panthenol, retinyl propionate, retinyl palmitate, kinetin, retinal, glycoprotein, idebenone, dimethylaminoethanol (DMAE), niacinamide, β-glucan, palmitoyl pentapeptide-4, palmitoyl oligopeptide / tetrapeptide-7, etoricoxib, ceramide, phenylalanine, glucuronolactone, L-carnitine, hydroxyapatite, palmitoyl tripeptide-3, phoscholine, zinc oxide, α-bisabolol, eugenol, silybin, soy isoflavones, catalpol, camphor laurel carbenoxolone, rosmarinic acid, rosmaridiphenol, salicylic acids, for example, salicin, salicyl alcohol and salicylic acid, taraxasterol, α-lactucerol, isolactucerol, taraxacoside, ceramide, arbutin, gingerol, shogaol, hypericin, elastin, collagen and its peptides.

[0137] In the composition of the present invention, the surface and / or the interior of the pores of the porous silica particles (mesoporous silica particles, MSP) can be modified.

[0138] Modification refers to replacing the -OH functional group of the silanol group (Si-OH) in the silica particles with other functional groups. More specifically, the modification can be used for reducing side effects such as hemolysis caused by the interaction between the silanol group and the quaternary ammonium group on the surface of red blood cells by intravascular injection of the composition according to the present invention. In addition, depending on the type of functional group to be modified and the degree of modification, the type of the above-mentioned bioactive substances suitable for loading may be different. Additionally, since the ζ potential may change and the intensity of the ζ potential may also cause differences in size, precipitation or aggregation between particles in the bloodstream can be prevented by charge repulsion between the particles, thus ensuring smooth flow in the bloodstream. Furthermore, the interaction between the porous silica particles and the environment releasing the bioactive substances is controlled so as to regulate the degradation rate of the particles to control the release rate of the bioactive substances. Additionally, the binding force between the bioactive substances and the nanoparticles can be adjusted to control the release of the bioactive substances by diffusion from the particles.

[0139] Chemical or biological modification can be selected for the above-mentioned modification, but it is not limited thereto. In fact, the modification can be carried out by methods well known in the art. However, considering the substitution of the functional group by covalent bonding with the silica particles, chemical modification is preferably adopted. In addition, the surface of the particles and the interior of the pores can be modified in the same way or in different ways.

[0140] The modification can be implemented by reacting the particles with a compound having a hydrophilic, hydrophobic, cationic or anionic substituent to be introduced, but it is not limited thereto. In fact, the modification can be implemented by reacting the particles with any compound having a substituent, which loads bioactive substances, transfers bioactive substances to target cells, loads materials for other purposes or binds other additional substituents, wherein the substituent may further include an antibody, a ligand, a cell-penetrating peptide or an aptamer, etc.

[0141] The compound can be, for example, an alkoxysilane having C1 to C10 alkoxy groups, but it is not limited thereto. The alkoxysilane has one or more alkoxy groups, for example, 1 to 3 alkoxy groups, and may include a substituent to be introduced into the site where the alkoxy group is not bonded or another substituent substituted by the above-mentioned substituent.

[0142] When an alkoxysilane reacts with porous silica particles, a covalent bond is formed between the silicon atom and the oxygen atom, enabling the alkoxysilane to bond to the surface of the porous silica particles and / or the interior of the pores. In addition, since the alkoxysilane has substituents to be introduced, the corresponding substituents can be introduced into the surface of the porous silica particles and / or the interior of the pores.

[0143] The reaction can be carried out by reacting porous silica particles dispersed in a solvent with an alkoxysilane. Water and / or an organic solvent can be used as the solvent, and the organic solvent can be, for example: ethers such as 1,4-dioxane (especially cyclic ethers); halogenated hydrocarbons such as chloroform, dichloromethane, carbon tetrachloride, 1,2-dichloroethane, dichloroethylene, trichloroethylene, tetrachloroethylene, dichloropropane, amyl chloride, 1,2-dibromoethane, etc.; ketones such as acetone, methyl isobutyl ketone, γ-butyrolactone, 1,3-dimethylimidazolidinone, methyl ethyl ketone, cyclohexanone, cyclopentanone, 4-hydroxy-4-methyl-2-pentanone, etc.; carbon-based aromatic compounds such as benzene, toluene, xylene, tetramethylbenzene, etc.; alkyl amides such as N,N-dimethylformamide, N,N-dibutylformamide, N,N-dimethylacetamide, N-methylpyrrolidone, etc.; alcohols such as methanol, ethanol, propanol, butanol, etc.; glycol ethers (cellosolves) such as ethylene glycol monoethyl ether, ethylene glycol monomethyl ether, ethylene glycol monobutyl ether, diethylene glycol monoethyl ether, diethylene glycol monomethyl ether, diethylene glycol monobutyl ether, propylene glycol monomethyl ether, propylene glycol monoethyl ether, dipropylene glycol diethyl ether, triethylene glycol monoethyl ether, etc.; and other dimethylacetamide (DMAc), N,N-diethylacetamide, dimethylformamide (DMF), diethylformamide (DEF), N,N-dimethylacetamide (DMAc), N-methylpyrrolidone (NMP), N-ethylpyrrolidone (NEP), 1,3-dimethyl-2-imidazolidinone, N,N-dimethylmethoxyacetamide, dimethyl sulfoxide, pyridine, dimethyl sulfone, hexamethylphosphoramide, tetramethylurea, N-methylcaprolactam, tetrahydrofuran, m-dioxane, p-dioxane, 1,2-dimethoxyethane, etc. Specifically, toluene can be used, but it is not limited thereto.

[0144] The reaction of the particles with the alkoxysilane can be carried out, for example, under heating, where the heating can be carried out in the range of 80 to 180 °C, for example, in the ranges of 80 to 160 °C, 80 to 150 °C, 100 to 160 °C, 100 to 150 °C, 110 to 150 °C, etc., but it is not limited thereto.

[0145] In addition, the reaction of the particles with the alkoxysilane can be carried out for 4 to 20 hours, for example, in the ranges of 4 to 18 hours, 4 to 16 hours, 6 to 18 hours, 6 to 16 hours, 8 to 18 hours, 8 to 6 hours, 8 to 14 hours, 10 to 14 hours, etc., but it is not limited thereto.

[0146] In the above modification, modification with a cationic substituent can be carried out to make the particles positively charged or to load a negatively charged bioactive substance, and it can be carried out by reacting the particles with, for example, an alkoxysilane having a basic group, which is a nitrogen-containing group such as an amino group, an aminoalkyl group, etc. Specifically, N-[3-(trimethoxysilyl)propyl]ethylenediamine, N1-(3-trimethoxysilylpropyl)diethylenetriamine, (3-aminopropyl)trimethoxysilane, N-[3-(trimethoxysilyl)propyl]aniline, trimethoxy[3-(methylamino)propyl]silane, 3-(2-aminoethylamino)propyl dimethoxymethylsilane, etc. can be used, but are not limited thereto.

[0147] In the above modification, modification with an anionic substituent can be carried out to make the particles negatively charged or to load a positively charged bioactive substance, and it can be carried out by reacting the particles with, for example, an alkoxysilane having an acidic group such as a carboxyl group, a sulfonic acid group, a thiol group, etc. Specifically, (3-mercaptopropyl)trimethoxysilane can be used, but is not limited thereto.

[0148] In the above modification, modification with a hydrophilic substituent has an advantage in terms of the ease of use and formulation of the composition according to the present invention. In fact, these advantages can be obtained by reacting the particles with, for example, an alkoxysilane having a carboxyl group, an amino group, a carbonyl group, a thiol group, a phosphate group, a thiol group, an ammonium group, an ester group, a thioimide group, a formimide group, a ketone group, an ether group, an indenyl group, a sulfonyl group, a polyethylene glycol group, etc. Specifically, N-[3-(trimethoxysilyl)propyl]ethylenediamine, N1-(3-trimethoxysilylpropyl)diethylenetriamine, (3-aminopropyl)trimethoxysilane, (3-mercaptopropyl)trimethoxysilane, trimethoxy[3-(methylamino)propyl]silane, 3-(2-aminoethylamino)propyl dimethoxymethylsilane, etc. can be used, but are not limited thereto.

[0149] In the above modification, modification with a hydrophobic substituent has the advantage of enhancing the binding force with a poorly water-soluble (hydrophobic) bioactive substance. In fact, it can be achieved by reacting the particles with, for example, a substituted or unsubstituted C1 to C 30 alkyl, a substituted or unsubstituted C3 to C 30 cycloalkyl, a substituted or unsubstituted C6 to C 30 aryl, a substituted or unsubstituted C2 to C 30 heteroaryl, a halogen, a C1 to C 30Modification is carried out by reacting with an alkoxysilane having an ester group, a halogen-containing group, or the like. Specifically, trimethoxy(octadecyl)silane, trimethoxy-n-octylsilane, trimethoxy(propyl)silane, isobutyl(trimethoxy)silane, trimethoxy(7-octen-1-yl)silane, trimethoxy(3,3,3-trifluoropropyl)silane, trimethoxy(2-phenylethyl)silane, vinyltrimethoxysilane, cyanomethyl, 3-[(trimethoxysilyl)propyl]trithiocarbonate, (3-bromopropyl)trimethoxysilane, etc. can be used, but are not limited thereto.

[0150] The modifications can be carried out in combination. For example, two or more surface modifications can be carried out on the outer surface or the inside of the pores. As a more specific example, positively charged particles can be changed to have different surface properties by bonding a compound having a carboxyl group to silica particles introduced with an amino group through an amide bond, but are not limited thereto.

[0151] During the modification, the reaction temperature, time, and the amount of the compound used for modification can be selected according to the degree of modification. In addition, the reaction conditions can be adjusted depending on the hydrophilicity, hydrophobicity, and charge level of the bioactive substance to regulate the hydrophilicity, hydrophobicity, and charge level of the silica particles, thereby controlling the release rate of the bioactive substance. For example, if the bioactive substance has a strong negative charge at neutral pH, the reaction temperature can be increased, the reaction time can be extended, or the amount of the compound to be treated can also be increased, so that the porous silica particles have a strong positive charge, but are not limited thereto.

[0152] In the composition of the present invention, the porous silica particles (mesoporous silica particles, MSP) are biodegradable particles. When the biodegradable particles are loaded with a bioactive substance and then administered in vivo, these particles are biodegradable in vivo while releasing the bioactive substance, whereby the particles are slowly degraded in vivo while enabling the loaded bioactive substance to have a sustained release property. For example, when the absorbance ratio in Formula 1 below reaches 1 / 2, t is 20 or more.

[0153] [Formula 1]

[0154] A t / A0

[0155] (wherein A0 is the absorbance of the porous silica particles measured by placing a 5 ml suspension containing 1 mg / ml of the porous silica particles in a cylindrical permeable membrane having a pore diameter of 50 kDa,

[0156] where 15 ml of the same solvent as the suspension is present outside the permeable membrane and in contact with the permeable membrane, the inside and outside of the permeable membrane are horizontally stirred at 37 °C and 60 rpm, and the pH of the suspension is 7.4, and

[0157] A t (Absorbance of the porous silica particles measured t hours after measuring A0).

[0158] Equation 1 represents the rate of degradation of the porous silica particles in a body-like environment, where the absorbances A0 and A t can be measured, for example, after placing the porous silica particles and the suspension in a cylindrical permeable membrane and further injecting the same suspension outside the permeable membrane.

[0159] The suspension can be a buffer solution and at least one selected from the group consisting of, for example, phosphate buffered saline (PBS) and simulated body fluid (SBF), and more specifically PBS.

[0160] The particles are biodegradable and can degrade slowly in the suspension, where a diameter of 50 kDa corresponds to approximately 5 nm. The biodegradable particles can pass through a 50 kDa permeable membrane. The cylindrical permeable membrane is horizontally stirred at 60 rpm to mix it uniformly, and the degraded particles can come out of the permeable membrane.

[0161] The absorbance in Equation 1 can be measured, for example, in an environment where the suspension outside the permeable membrane is replaced with a new suspension. The suspension can be a regularly replaced suspension, and the suspension is replaced at a constant period. The constant period can be periodic or irregular. For example, the replacement can be carried out within the following ranges: 1 hour to 1 week, specifically, at intervals of 1 hour, 2 hours, 3 hours, 6 hours, 12 hours, 24 hours, or at intervals of 2 days, 3 days, 4 days, 7 days, etc., but not limited thereto.

[0162] An absorbance ratio reaching 1 / 2 means that the absorbance after t hours becomes half of the initial absorbance, and thus means that approximately half of the porous silica particles have degraded.

[0163] When the absorbance ratio of Equation 1 reaches 1 / 2, t is 20 or more or 24 or more. For example, t can be 20 to 120, specifically, 20 to 96, 20 to 72, 30 to 70, 40 to 70, 50 to 65, etc. within the above ranges, but not limited thereto.

[0164] The particles are characterized in that when the absorbance ratio in Equation 1 reaches 1 / 5, t can be, for example, 70 to 140, specifically, 80 to 140, 80 to 120, 80 to 110, 70 to 140, 70 to 120, 70 to 110, etc. within the above ranges, but not limited thereto.

[0165] The particles are characterized in that when the absorbance ratio in Formula 1 reaches 1 / 20, t can be, for example, from 130 to 220, specifically, within the above range, 130 to 200, 140 to 200, 140 to 180, 150 to 180, etc., but not limited thereto.

[0166] The particles are characterized in that when the measured absorbance reaches 0.01 or less, t can be, for example, 250 or more, specifically, within the above range, 300 or more, 350 or more, 400 or more, 500 or more, 1000 or more, etc., with an upper limit of 2000, but not limited thereto.

[0167] The particles are characterized in that the absorbance ratio in Formula 1 and t have a high level of positive correlation. Specifically, the Pearson correlation coefficient can be 0.8 or more, for example, 0.9 or more, 0.95 or more, etc.

[0168] In Formula 1, t refers to the degradation rate of the porous silica particles in an in vivo - like environment and can be controlled, for example, by adjusting the surface area, particle size, pore size, substituents on and / or inside the pores of the porous silica particles, surface compactness, etc.

[0169] More specifically, t can be decreased by increasing the surface area of the particles or increased by reducing the surface area. The surface area can be adjusted by regulating the diameter of the particles and / or the diameter of the pores. In addition, the presence of substituents on and / or inside the pores of the particles can reduce the direct exposure of the porous silica particles to the environment (such as solvents), thereby increasing t. In addition, loading bioactive materials on the porous silica particles and increasing the affinity between the bioactive materials and the porous silica particles can reduce the direct exposure of the porous silica particles to the environment, thereby increasing t. In addition, the surface can be made denser during particle preparation, thereby increasing t. Various examples of adjusting t in Formula 1 have been described above, but not limited thereto.

[0170] In the composition of the present invention, the porous silica particles (mesoporous silica particles, MSP) are particles of silica (SiO2) substances and have a diameter of several nanometers to several micrometers.

[0171] The average diameter of the particles can be, for example, from 100 to 1000 nm, specifically, within the above range, 100 to 800 nm, 100 to 500 nm, 100 to 400 nm, 100 to 300 nm, 100 to 200 nm, etc., but not limited thereto.

[0172] In the composition of the present invention, the porous silica particles (mesoporous silica particles, MSP) are porous particles including nano - sized pores, and the above - mentioned bioactive substances can be loaded in the pores or on the particle surface.

[0173] The average pore diameter of the particles can be, for example, 1 to 100 nm, specifically, 5 to 100 nm, 7 to 100 nm, 7 to 50 nm, 10 to 50 nm, 10 to 30 nm, 7 to 30 nm, etc. within the above range, but not limited thereto. In addition, considering the amount and size of the bioactive substance to be loaded, the average pore diameter is preferably selected and adjusted.

[0174] In the composition of the present invention, the shape of the porous silica particles (mesoporous silica particles, MSP) is not particularly limited to a specific form. However, considering the smoothness of the flow in the blood stream, the smoothness of the interaction with blood cells in the blood stream, and the anti-hemolytic property of red blood cells, a spherical shape is preferred.

[0175] In the composition of the present invention, the BET surface area of the porous silica particles (mesoporous silica particles, MSP) can be, for example, 200 to 700 m 2 / g, specifically, 200 to 700 m 2 / g, 200 to 650 m 2 / g, 250 to 650 m 2 / g, 300 to 700 m 2 / g, 300 to 650 m 2 / g, 300 to 600 m 2 / g, 300 to 550 m 2 / g, 300 to 500 m 2 / g, 300 to 450 m 2 / g, etc., but not limited thereto.

[0176] In the composition of the present invention, the volume per gram (g) of the porous silica particles (mesoporous silica particles, MSP) can be, for example, 0.7 to 2.2 ml, specifically, 0.7 to 2.0 ml, 0.8 to 2.2 ml, 0.8 to 2.0 ml, 0.9 to 2.0 ml, 1.0 to 2.0 ml, etc. within the above range, but not limited thereto. If the volume per gram (g) is too small, the degradation rate is too high. In addition, it is difficult to manufacture particles that are too large or the particles may not have a complete shape.

[0177] In the composition of the present invention, the porous silica particles (mesoporous silica particles, MSP) have a surface charge, that is, they have a ζ potential other than 0 mV. As described above, the electronic repulsive force between particles modified in the same way can inhibit the phenomenon of particle aggregation or precipitation in the blood, thereby promoting the flow in the blood and delivering the effectively loaded bioactive substance to the target tissue or cell.

[0178] When positively charged, the value of the surface charge of the particles, i.e., the value of the ζ potential, can be, for example, +1 to +150 mV, +2 to 130 mV, or +3 to +100 mV, but is not limited thereto. In addition, when negatively charged, the value of the ζ potential can be, for example, -150 to -1 mV, -130 to -10 mV, or -100 to -18 mV, but is not limited thereto. The value of the ζ potential can be adjusted to meet its purpose considering different aspects such as the type and amount of the bioactive substance to be loaded, or the degree of controlled release. However, when the value of the ζ potential is greater than -18 mV and less than +3 mV, the repulsive force between the porous silica particles is reduced, causing the particles to aggregate, and it is difficult to load charged bioactive substances. In addition, if the value of the ζ potential is greater than +100 mV or less than -100 mV, the binding force with the charged bioactive substance is too high, making it difficult to release effectively.

[0179] In the composition of the present invention, the porous silica particles (mesoporous silica particles, MSP) can load the above-mentioned bioactive substances on the surface of the particles and / or inside the pores.

[0180] For example, the loading of the particles with the bioactive substance can be carried out by mixing the porous silica particles and the bioactive substance in a solvent. In this regard, water and / or an organic solvent can be used as the solvent. The organic solvents used herein can include, for example: ethers such as 1,4-dioxane (especially cyclic ethers); halogenated hydrocarbons such as chloroform, dichloromethane, carbon tetrachloride, 1,2-dichloroethane, dichloroethylene, trichloroethylene, tetrachloroethylene, dichloropropane, amyl chloride, 1,2-dibromoethane, etc.; ketones such as acetone, methyl isobutyl ketone, cyclohexanone, etc.; carbon-based aromatic compounds such as benzene, toluene, xylene, etc.; alkyl amides such as N,N-dimethylformamide, N,N-dibutylformamide, N,N-dimethylacetamide, N-methylpyrrolidone, etc.; alcohols such as methanol, ethanol, propanol, butanol, etc.

[0181] In addition, phosphate buffered saline (PBS), simulated body fluid (SBF), borate buffered saline, and tris buffered saline can be used as the solvent.

[0182] The ratio of the porous silica particles to the bioactive material is not particularly limited, and for example, the weight ratio can be 1:0.05 to 0.8, specifically, 1:0.05 to 0.7, 1:0.05 to 0.6, 1:0.1 to 0.8, 1:0.1 to 0.6, 1:0.2 to 0.8, 1:0.2 to 0.6, etc. within the above range.

[0183] In the composition of the present invention, the porous silica particles (mesoporous silica particles, MSP) can gradually release the loaded bioactive substances over a long period of time.

[0184] As the particles biodegrade, bioactive substances loaded on the particles can be released, and the particles can be slowly degraded to allow for the sustained release of the loaded bioactive substances. This can be controlled by, for example, adjusting the surface area, particle size, pore size, substituents on the particle surface and / or inside the pores, the compactness of the porous silica particles, etc., but is not limited thereto.

[0185] In addition, the bioactive substances loaded on the particles can be released and diffused while being separated from the porous silica particles, which is affected by the relationship between the porous silica particles, the bioactive substances, and the bioactive substance release environment. Therefore, adjusting these conditions can control the release of the bioactive substances. For example, the release of the bioactive material can be controlled by enhancing or weakening the binding force between the porous silica particles and the bioactive substances by means of surface modification.

[0186] More specifically, if the loaded bioactive substance has poor water solubility (hydrophobic), the particle surface and / or the inside of the pores can have hydrophobic substituents to increase the binding force between the particles and the bioactive substances, whereby the bioactive substances can be released in a sustained manner. This can be achieved, for example, by surface-modifying the particles with an alkoxysilane having hydrophobic substituents.

[0187] As used herein, "poorly soluble" means insoluble (virtually insoluble) or only slightly soluble (relative to water), which is a term defined in the 18th edition of "Pharmaceutical Science" (USP, Remington, Mack Publishing Company).

[0188] A bioactive material with poor water solubility can have, for example, a water solubility of less than 10 g / L, specifically less than 5 g / L, and more specifically less than 1 g / L at 1 atmosphere and 25 °C, but is not limited thereto.

[0189] When the loaded bioactive substance is water-soluble (hydrophilic), the particle surface and / or the inside of the pores can have hydrophilic substituents to increase the binding force between the porous silica particles and the bioactive substances, whereby the bioactive substances can be released in a sustained manner. This can be achieved, for example, by surface-modifying the porous silica particles with an alkoxysilane having hydrophilic substituents.

[0190] A water-soluble bioactive material has, for example, a water solubility of 10 g / L or more at 1 atmosphere and 25 °C, but is not limited thereto.

[0191] When the loaded bioactive material is charged, the surface of the particles and / or the interior of the pores can carry opposite charges, thus increasing the binding force between the porous silica particles and the bioactive substance, and thereby the bioactive substance can be released in a sustained manner. This can be achieved, for example, by surface-modifying the porous silica particles with an alkoxysilane having an acidic group or a basic group.

[0192] Specifically, if the bioactive substance is positively charged at neutral pH, the surface of the particles and / or the interior of the pores can be negatively charged at neutral pH, thus increasing the binding force between the porous silica particles and the bioactive substance, and thereby the bioactive substance can be released in a sustained manner. This can be achieved, for example, by surface-modifying the porous silica particles with an alkoxysilane having an acidic group such as a carboxyl group (-COOH), a sulfonic acid group (-SO3H), etc.

[0193] In addition, if the bioactive material is negatively charged at neutral pH, the surface of the particles and / or the interior of the pores can carry a positive charge, thus increasing the binding force between the porous silica particles and the bioactive substance, and thereby the bioactive substance can be released in a sustained manner. This can be achieved, for example, by surface-modifying the porous silica particles with an alkoxysilane having a basic group such as an amino group, a nitrogen-containing group, etc.

[0194] The loaded bioactive substance can be released, for example, for 7 days to 1 year or longer depending on the type of treatment required, the release environment, and the porous silica particles to be used, etc.

[0195] In the composition of the present invention, since the porous silica particles (mesoporous silica particles, MSP) are biodegradable and can be 100% degraded, the bioactive substance loaded thereon can be released 100%.

[0196] Due to the 100% biodegradability of the particles, the amount of the loaded bioactive substance can be appropriately set according to the corresponding purpose and used for drug delivery in blood vessels, thus having the following significant advantages: avoiding problems such as side effects caused by overuse of bioactive substances, preventing serious situations such as blocking blood vessels while the particles are not completely degraded, and overcoming the problem that embolism as described below cannot occur on the same path, which is an important problem of conventional embolism.

[0197] In the composition of the present invention, the porous silica particles (mesoporous silica particles, MSP) can be prepared, for example, by small-pore particle preparation and pore expansion methods. If necessary, the particles can be prepared by further calcination and surface modification processes, etc. If the particles are subjected to the calcination and surface modification processes simultaneously, the particles can be surface-modified after calcination.

[0198] The small pore particles can be, for example, particles having an average pore diameter of 1 to 5 nm, which can be obtained by adding a surfactant and a silica precursor to a solvent and then stirring and homogenizing the solution.

[0199] Water and / or an organic solvent can be used as the solvent, and the organic solvents used herein can include, for example: ethers such as 1,4-dioxane (especially cyclic ethers); halogenated hydrocarbons such as chloroform, dichloromethane, carbon tetrachloride, 1,2-dichloroethane, dichloroethylene, trichloroethylene, tetrachloroethylene, dichloropropane, amyl chloride, 1,2-dibromoethane, etc.; ketones such as acetone, methyl isobutyl ketone, γ-butyrolactone, 1,3-dimethylimidazolidinone, methyl ethyl ketone, cyclohexanone, cyclopentanone, 4-hydroxy-4-methyl-2-pentanone, etc.; carbon-based aromatic compounds such as benzene, toluene, xylene, tetramethylbenzene, etc.; alkyl amides such as N,N-dimethylformamide, N,N-dibutylformamide, N,N-dimethylacetamide, N-methylpyrrolidone, etc.; alcohols such as methanol, ethanol, propanol, butanol, etc.; glycol ethers (cellosolves) such as ethylene glycol monoethyl ether, ethylene glycol monomethyl ether, ethylene glycol monobutyl ether, diethylene glycol monoethyl ether, diethylene glycol monomethyl ether, diethylene glycol monobutyl ether, propylene glycol monomethyl ether, propylene glycol monoethyl ether, dipropylene glycol diethyl ether, triethylene glycol monoethyl ether, etc.; and other dimethylacetamide (DMAc), N,N-diethylacetamide, dimethylformamide (DMF), diethylformamide (DEF), N,N-dimethylacetamide (DMAc), N-methylpyrrolidone (NMP), N-ethylpyrrolidone (NEP), 1,3-dimethyl-2-imidazolidinone, N,N-dimethylmethoxyacetamide, dimethyl sulfoxide, pyridine, dimethyl sulfone, hexamethylphosphoramide, tetramethylurea, N-methylcaprolactam, tetrahydrofuran, m-dioxane, p-dioxane, 1,2-dimethoxyethane, etc. Specifically, an alcohol can be used, more specifically methanol, but is not limited thereto.

[0200] When a mixed solvent of water and an organic solvent is used as the solvent, the ratio of water and the organic solvent can be used, for example, at a volume ratio of 1:0.7 to 1.5, such as 1:0.8 to 1.3, but is not limited thereto.

[0201] The surfactant can be, for example, cetyltrimethylammonium bromide (CTAB), hexadecyltrimethylammonium bromide (TMABr), cetyltrimethylpyridinium chloride (TMPrCl), tetramethylammonium chloride (TMAC1), etc., and specifically, CTAB can be used.

[0202] For example, the surfactant can be added in an amount of 1 to 10 g per 1 liter of the solvent, specifically, 1 to 8 g, 2 to 8 g, 3 to 8 g, etc. within the above range, but is not limited thereto.

[0203] The silica precursor can be added after stirring when a surfactant is added to the solvent. The silica precursor can be, for example, tetramethyl orthosilicate (TMOS), but is not limited thereto.

[0204] The stirring can be carried out for, for example, 10 minutes to 30 minutes, but is not limited thereto.

[0205] The silica precursor can be added in an amount of 0.5 to 5 ml per 1 liter of the solvent, specifically, 0.5 to 4 ml, 0.5 to 3 ml, 0.5 to 2 ml, 1 to 2 ml, etc. within the above range, but is not limited thereto. On the contrary, if necessary, sodium hydroxide can be further used as a catalyst, and the catalyst can be added while stirring after adding the surfactant to the solvent and before adding the silica precursor to the solvent.

[0206] The catalyst, namely sodium hydroxide, can be added in an amount of 0.5 to 8 ml per 1 liter of the solvent based on 1M sodium hydroxide solution, specifically, 0.5 to 5 ml, 0.5 to 4 ml, 1 to 4 ml, 1 to 3 ml, 2 to 3 ml, etc. within the above range, but is not limited thereto.

[0207] After adding the silica precursor, the solution can be reacted under stirring. The stirring can be carried out for, for example, 2 to 15 hours, specifically, 3 to 15 hours, 4 to 15 hours, 4 to 13 hours, 5 to 12 hours, 6 to 12 hours, 6 to 10 hours, etc. within the above range, but is not limited thereto. If the stirring time (reaction time) is too short, nucleation may be insufficient.

[0208] After stirring, the solution can be aged. The aging can be carried out for, for example, 8 to 24 hours, specifically, 8 to 20 hours, 8 to 18 hours, 8 to 16 hours, 8 to 14 hours, 10 to 16 hours, 10 to 14 hours, etc. within the above range, but is not limited thereto.

[0209] Thereafter, the reaction product can be washed and dried to obtain porous silica particles, and if necessary, unreacted materials can be separated before washing, and the separation can be carried out, for example, by centrifuging to separate the supernatant.

[0210] The centrifugation can be carried out at, for example, 6,000 to 10,000 rpm for, for example, 3 to 60 minutes, specifically, 3 to 30 minutes, 5 to 30 minutes, etc. within the above range, but is not limited thereto.

[0211] Cleaning can be carried out with water and / or organic solvents. In particular, since different substances are soluble in different solvents, water and organic solvents can be used alternately one or more times. Optionally, water and / or organic solvents can be used alone for cleaning one or several times. Such several times can include, for example, more than two and less than ten times, specifically, more than three and less than ten times, more than four and less than eight times, more than four and less than six times, etc.

[0212] The organic solvents used in this article can include, for example: ethers, such as 1,4-dioxane (especially cyclic ethers); halogenated hydrocarbons, such as chloroform, dichloromethane, carbon tetrachloride, 1,2-dichloroethane, dichloroethylene, trichloroethylene, tetrachloroethylene, dichloropropane, amyl chloride, 1,2-dibromoethane, etc.; ketones, such as acetone, methyl isobutyl ketone, γ-butyrolactone, 1,3-dimethylimidazolidinone, methyl ethyl ketone, cyclohexanone, cyclopentanone, 4-hydroxy-4-methyl-2-pentanone, etc.; carbon-based aromatic compounds, such as benzene, toluene, xylene, tetramethylbenzene, etc.; alkyl amides, such as N,N-dimethylformamide, N,N-dibutylformamide, N,N-dimethylacetamide, N-methylpyrrolidone, etc.; alcohols, such as methanol, ethanol, propanol, butanol, etc.; glycol ethers (cellosolves), such as ethylene glycol monoethyl ether, ethylene glycol monomethyl ether, ethylene glycol monobutyl ether, diethylene glycol monoethyl ether, diethylene glycol monomethyl ether, diethylene glycol monobutyl ether, propylene glycol monomethyl ether, propylene glycol monoethyl ether, dipropylene glycol diethyl ether, triethylene glycol monoethyl ether, etc.; and other dimethylacetamide (DMAc), N,N-diethylacetamide, dimethylformamide (DMF), diethylformamide (DEF), N,N-dimethylacetamide (DMAc), N-methylpyrrolidone (NMP), N-ethylpyrrolidone (NEP), 1,3-dimethyl-2-imidazolidinone, N,N-dimethylmethoxyacetamide, dimethyl sulfoxide, pyridine, dimethyl sulfone, hexamethylphosphoramide, tetramethylurea, N-methylcaprolactam, tetrahydrofuran, m-dioxane, p-dioxane, 1,2-dimethoxyethane, etc. Specifically, alcohol can be used, and more specifically, ethanol can be used, but it is not limited thereto.

[0213] The cleaning can be carried out at, for example, 6,000 to 10,000 rpm for, for example, 3 to 60 minutes under centrifugation, specifically, 3 to 30 minutes, 5 to 30 minutes, etc. within the above range, but it is not limited thereto.

[0214] Cleaning can be carried out by filtering the particles with a filter without centrifugation. The filter can include pores with a diameter less than or equal to the diameter of the porous silica particles. If the reaction solution is filtered through such a filter, only the particles remain on the filter, and cleaning can be carried out by pouring water and / or organic solvents on the filter.

[0215] For cleaning, water and organic solvents can be used alternately one or more times. Optionally, cleaning can also be performed one or more times even when using only water or only organic solvents. The number of times can include, for example, more than two and less than ten times, specifically, more than three and less than ten times, more than four and less than eight times, more than four and less than six times, etc.

[0216] Drying can be carried out, for example, at 20 to 100 °C, but is not limited thereto. Optionally, drying can be carried out under a vacuum state.

[0217] Thereafter, a pore expander can be used, for example, to expand the pores of the obtained porous silica particles.

[0218] The pore expander used herein can include, for example, trimethylbenzene, triethylbenzene, tripropylbenzene, tributylbenzene, tripentylbenzene, trihexylbenzene, toluene, benzene, etc., and specifically, trimethylbenzene can be used, but is not limited thereto.

[0219] Optionally, the pore expander used herein can be, for example, N,N-dimethylhexadecylamine (DMHA), but is not limited thereto.

[0220] The above pore expansion can be carried out, for example, by mixing the porous silica particles with the pore expander in a solvent, heating the mixture and reacting them. The solvent used herein can be, for example, water and / or organic solvents. The organic solvents used herein can include, for example: ethers, such as 1,4-dioxane (especially cyclic ethers); halogenated hydrocarbons, such as chloroform, dichloromethane, carbon tetrachloride, 1,2-dichloroethane, dichloroethylene, trichloroethylene, tetrachloroethylene, dichloropropane, amyl chloride, 1,2-dibromoethane, etc.; ketones, such as acetone, methyl isobutyl ketone, cyclohexanone, etc.; carbon-based aromatic compounds, such as benzene, toluene, xylene, etc.; alkyl amides, such as N,N-dimethylformamide, N,N-dibutylformamide, N,N-dimethylacetamide, N-methylpyrrolidone, etc.; alcohols, such as methanol, ethanol, propanol, butanol, etc.; specifically, alcohol can be used, and more specifically, ethanol can be used, but is not limited thereto.

[0221] The porous silica particles can be added in a proportion of, for example, 10 to 200 g per 1 liter of solvent, specifically, 10 to 150 g, 10 to 100 g, 30 to 100 g, 40 to 100 g, 50 to 100 g, 50 to 80 g, 60 to 80 g, etc. within the above range, but is not limited thereto.

[0222] The porous silica particles can be uniformly dispersed in the solvent. For example, the porous silica particles can be added to the solvent and ultrasonically dispersed therein. In the case of using a mixed solvent, the second solvent can be added after dispersing the porous silica particles in the first solvent.

[0223] The pore swelling agent can be added in an amount based on 100 parts by volume, for example, 10 to 200 parts by volume (vol. parts), specifically, 100 to 150 parts by volume, 10 to 100 parts by volume, 10 to 80 parts by volume, 30 to 80 parts by volume, 30 to 70 parts by volume within the above range, but not limited thereto.

[0224] The reaction can be carried out at, for example, 120 to 180 °C, specifically, 120 to 170 °C, 120 to 160 °C, 120 to 150 °C, 130 to 180 °C, 130 to 170 °C, 130 to 160 °C, 130 to 150 °C, etc. within the above range, but not limited thereto.

[0225] The reaction can be carried out for, for example, 24 to 96 hours, specifically, 30 to 96 hours, 30 to 80 hours, 30 to 72 hours, 24 to 80 hours, 24 to 72 hours, 36 to 96 hours, 36 to 80 hours, 36 to 72 hours, 36 to 66 hours, 36 to 60 hours, 48 to 96 hours, 48 to 88 hours, 48 to 80 hours, 48 to 72 hours, etc. within the above range, but not limited thereto.

[0226] By adjusting the time and temperature within the above ranges respectively, the reaction can proceed sufficiently without being excessive. For example, when the reaction temperature is low, the reaction time can be increased. On the contrary, when the reaction temperature is high, the reaction time can be shortened. If the reaction is insufficient, the pore expansion is insufficient. On the other hand, if the reaction proceeds excessively, the particles will collapse due to the pore expansion.

[0227] The reaction can be carried out, for example, while gradually increasing the temperature. Specifically, it can be carried out while gradually increasing the temperature at a rate of 0.5 to 15 °C / min from room temperature, specifically, 1 to 15 °C / min, 3 to 15 °C / min, 3 to 12 °C / min, 3 to 10 °C / min, etc. within the above range, but not limited thereto.

[0228] After the reaction, the reaction solution can be slowly cooled, for example, by gradually decreasing the temperature. Specifically, the reaction solution can be cooled to room temperature by gradually decreasing the temperature at a rate of 0.5 to 20 °C / min, specifically, 1 to 20 °C / min, 3 to 20 °C / min, 3 to 12 °C / min, 3 to 10 °C / min, etc. within the above range, but not limited thereto.

[0229] After cooling, the reaction product is washed and dried to obtain porous silica particles with expanded pores.

[0230] If necessary, before washing, unreacted materials can be separated, for example, by centrifuging to separate the supernatant.

[0231] Centrifugation can be carried out at, for example, 6,000 to 10,000 rpm for 3 to 60 minutes, specifically, 3 to 30 minutes, 5 to 30 minutes, etc. within the above range, but not limited thereto.

[0232] Washing can be carried out with water and / or organic solvents. In particular, since different substances are soluble in different solvents, water and organic solvents can be used alternately once or more times. Optionally, water and / or organic solvents can be used alone for washing once or several times. Such several times can include, for example, more than two times and less than ten times, specifically, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, etc.

[0233] The organic solvents used herein can include, for example: ethers such as 1,4-dioxane (especially cyclic ethers); halogenated hydrocarbons such as chloroform, dichloromethane, carbon tetrachloride, 1,2-dichloroethane, dichloroethylene, trichloroethylene, tetrachloroethylene, dichloropropane, amyl chloride, 1,2-dibromoethane, etc.; ketones such as acetone, methyl isobutyl ketone, cyclohexanone, etc.; carbon-based aromatic compounds such as benzene, toluene, xylene, etc.; alkyl amides such as N,N-dimethylformamide, N,N-dibutylformamide, N,N-dimethylacetamide, N-methylpyrrolidone, etc.; alcohols such as methanol, ethanol, propanol, butanol, etc. Specifically, alcohols can be used, and more specifically, ethanol can be used, but not limited thereto.

[0234] Washing can be carried out at, for example, 6,000 to 10,000 rpm for, for example, 3 to 60 minutes under centrifugation, specifically, 3 to 30 minutes, 5 to 30 minutes, etc. within the above range, but not limited thereto.

[0235] Washing can be carried out by filtering the particles with a filter without centrifugation. The filter can have pores with a diameter less than or equal to the diameter of the porous silica particles. If the reaction solution is filtered through such a filter, only the particles remain on the filter, and washing can be carried out by pouring water and / or organic solvents on the filter.

[0236] For washing, water and organic solvents can be used alternately once or more times. Optionally, washing can also be carried out once or several times even with water or organic solvents alone. Several times can include, for example, more than two times and less than ten times, specifically, more than three times and less than ten times, more than four times and less than eight times, more than four times and less than six times, etc.

[0237] Drying can be carried out, for example, at 20 to 100 °C, but not limited thereto. Optionally, drying can be carried out under a vacuum state.

[0238] Thereafter, the pores of the obtained porous silica particles can be calcined, which is a process of heating the particles to make the surface and the interior of the pores have a denser structure and removing the organic materials filling the pores. For example, the calcination can be carried out at 400 to 700 °C for 3 to 8 hours, specifically, at 500 to 600 °C for 4 to 5 hours, but not limited thereto.

[0239] Then, the obtained porous silica particles can be modified on their surface and / or the interior of the pores as described above.

[0240] In the composition of the present invention, the porous silica particles (mesoporous silica particles, MSP) can also be obtained, for example, by preparing small pore particles, pore expansion, surface modification, and / or modification of the interior of the pores.

[0241] The preparation of small pore particles and pore expansion can be carried out according to the above procedures, and then a washing and drying process can be carried out.

[0242] If necessary, before washing, the supernatant can be separated, for example, by centrifugation to separate unreacted materials.

[0243] Centrifugation can be carried out, for example, at 6,000 to 10,000 rpm for, for example, 3 to 60 minutes, specifically, 3 to 30 minutes, 5 to 30 minutes, etc. within the above range, but not limited thereto.

[0244] The washing after preparing small pore particles can be carried out by any method under the conditions within the above range, but not limited thereto.

[0245] Compared with the above-described illustrative embodiments, the washing after pore expansion can be carried out under more relaxed conditions. For example, the washing can be carried out three times or less, but not limited thereto.

[0246] The surface and / or the interior of the pores of the particles can be modified by the above methods, wherein the modification can be carried out in the order of the particle surface and then the interior of the pores, and particle washing can be further carried out between the above two processes.

[0247] When washing is carried out under more relaxed conditions after preparing small pore particles and pore expansion, the pores are filled with a reaction solution such as a surfactant used in particle preparation and pore expansion, so that during surface modification, the interior of the pores is not modified, but only the particle surface can be modified. Then, washing the particles can remove the reaction solution in the pores.

[0248] The particle cleaning between the surface modification and the internal modification of the pores can be carried out with water and / or an organic solvent. In particular, since different substances are dissolved in different solvents respectively, water and the organic solvent can be used alternately one or more times. Optionally, water and / or the organic solvent can be used alone for cleaning one or several times. Such several times can include, for example, more than two times and less than ten times, specifically, more than three times and less than ten times, more than four times and less than eight times, more than four times and less than six times, etc.

[0249] The cleaning can be carried out at, for example, 6,000 to 10,000 rpm for, for example, 3 to 60 minutes under centrifugation, specifically, 3 to 30 minutes, 5 to 30 minutes, etc. within the above range, but not limited thereto.

[0250] The cleaning can be carried out by filtering the particles through a filter without centrifugation. The filter can include pores with a diameter less than or equal to the diameter of the porous silica particles. If the reaction solution is filtered through such a filter, only the particles remain on the filter, and the cleaning can be carried out by pouring water and / or an organic solvent on the filter.

[0251] For cleaning, water and the organic solvent can be used alternately one or more times. Optionally, even using water or the organic solvent alone can also carry out one or more times of cleaning. The several times can include, for example, more than two times and less than ten times, specifically, more than three times and less than ten times, more than four times and less than eight times, more than four times and less than six times, etc.

[0252] The drying can be carried out, for example, at 20 to 100 °C, but not limited thereto. Optionally, the drying can be carried out under a vacuum state.

[0253] For the purpose of achieving the efficiency of delivering the bioactive material loaded on the porous silica particles or for the purpose of using the above composition, the composition for delivering the bioactive material in blood vessels according to the present invention can further include any substance well known in the art. Such substances well known in the art and further added to the composition can include fluorescent labeling materials, anticoagulants, erythrocyte hemolysins, contrast agents, etc., but not limited thereto.

[0254] The anticoagulant can be at least one selected from the group consisting of: 1,2-distearoyl-sn-glycero-3-(phospho-lac-(1-glycerol)), 1,2-distearoyl-sn-glycero-3-phosphocholine, cetomacrozol 1000, cetostearyl alcohol, cetyl alcohol, cetylpyridinium chloride, cholesterol, dipalmitoyl phosphatidylglycerol, distearoyl phosphatidylcholine, alkylpolyglycoside, EGG phospholipid, fatty acid ester, lauryl lactate, oleyl lactate, N-(2-hydroxyethyl)piperazine-N'-ethanesulfonic acid, lactose monohydrate, lanolin, lauryl lactate

[0255] Lecithin, magnesium stearate, monothioglycerol, oleic acid, oleyl alcohol, palmitic acid, PEG / PPG-18 / 18 dimethicone, polyethylene glycol (PEG), PEG-20 sorbitan isostearate, PEG-40 castor oil, PEG-60 hydrogenated castor oil, amyl valerate, phospholipid, poloxamer, poloxamer 188, poloxamer 407, polyoxyethylene fatty acid ester, polyoxy 30 castor oil, polyoxy 31 castor oil, polyoxy 32 castor oil, polyoxy 33 castor oil, polyoxy 34 castor oil, polyoxy 35 castor oil, polyoxy 36 castor oil, polyoxy 36 castor oil, polyoxy 37 castor oil, polyoxy 38 castor oil, polyoxy 39 castor oil, polyoxy 40 castor oil, polypropylene glycol, polysorbate, polysorbate 20, polysorbate 40, polysorbate 80, povidone K12, povidone K17, povidone K30, povidone, propylene glycol, polypropylene glycol monolaurate, protamine sulfate, cholesteryl sulfate sodium, sodium oleate, sorbitol anhydride, sorbitan monostearate, sorbitan tristearate, sorbitan monolaurate, sorbitan monooleate, sorbitan monopalmitate, stearyl alcohol, stearic acid, thiostrepton, zinc stearate, cocamide DEA, cocamide MEA, decyl glucoside, decyl polyglucose, glycerol monostearate, IGEPAL CA-630, isoceteth-20, lauryl glucoside maltoside, monolaurate, antimycin, ethoxylate, nodidet P-40, nonoxynol, N-octyl β-D-thioglucopyranoside, octyl glucoside, oleyl alcohol, PEG-10 sunflower glyceride, pentaethylene glycol monododecyl ether, polyethoxylated tallow amine, polyglycerol polyricinoleate, TRITON X-100, dextran, polyvinylpyrrolidone, 1,2-dioleoyl-sn-glycero-3-phosphocholine, exosome, micelle, liposome, polyvinyl alcohol, silicone, copolymer, nucleic acid, peptide, and cell membrane, but not limited thereto.

[0256] The contrast agent may be at least one selected from the group consisting of metrizamide, iopamidol, iodixanol, iohexol, iopromide, iobitridol, iomeprol, iopentol, iopamiron, ioxylan, iotrolan, gadodiamide, gadoteridol, iotrol, ioversol, lipiodol, iodized oil, oil-based contrast agent, oil-phase contrast agent, barium contrast agent, or a combination thereof, but not limited thereto.

[0257] The composition for delivering a bioactive substance in a blood vessel according to the present invention specifically relates to the "intravascular administration" of the composition according to the present invention. The term "in a blood vessel" will be understood to mean delivery into the vasculature of a patient, which means "into a blood vessel" or "in a blood vessel". In certain embodiments, the administration is (intravenously) into a blood vessel considered to be a vein, while in another embodiment the administration may be into a blood vessel considered to be an artery. Veins may include the internal jugular vein, peripheral vein, coronary vein, hepatic vein, portal vein, great saphenous vein, pulmonary vein, superior vena cava, inferior vena cava, gastric vein, splenic vein, inferior mesenteric vein, superior mesenteric vein, cephalic vein, and / or femoral vein, but not limited thereto. Arteries may include the coronary artery, pulmonary artery, brachial artery, internal carotid artery, aortic arch, femoral artery, peripheral artery, and / or ciliary artery, but not limited thereto. It is contemplated that delivery may be via arterioles or capillaries, or to arterioles or capillaries.

[0258] The intravascular administration of the composition for delivering a bioactive substance in a blood vessel according to the present invention can be carried out by inserting a catheter into a blood vessel near the target tissue or cell, so as to effectively achieve the delivery of the bioactive substance loaded on the porous silica particles, which is the purpose of the composition. In this case, the bioactive substance loaded on the surface of the porous silica particles will be less washed away by the blood flow, or the release of the bioactive substance loaded on the surface or inside the pores of the porous silica particles by diffusion in the blood flow will be reduced. In addition, it has the advantage of improving the targeting in the delivery of the loaded bioactive substance.

[0259] The present invention provides a pharmaceutical composition for treating a specific disease, which comprises a composition for delivering a bioactive substance in a blood vessel.

[0260] As used herein, the term "treatment" refers to a method of obtaining a beneficial or desired clinical outcome. For the purposes of the present invention, a beneficial or desired clinical outcome can include, but is not limited to, alleviation of symptoms, reduction in the degree of disease, stabilization of the disease state (i.e., not getting worse), delay or slowing of disease progression, improvement (partial or complete) of the disease state, temporary remission and remission, whether or not detectable. In addition, the term "treatment" can also refer to an increased survival as compared to the expected survival without treatment. Treatment refers to both therapeutic treatment and prophylactic treatment or prophylactic measures. Such treatment can include treatment required for a condition that has already occurred as well as for a condition to be prevented.

[0261] As used herein, the term "prevention" refers to any action that inhibits or delays the development of a related disease. It will be apparent to those skilled in the art that in the case of administration before the onset of symptoms, the compositions mentioned herein can prevent the initial symptoms or the related disease.

[0262] Such specific diseases can include at least one selected from the group consisting of: hepatocellular carcinoma, metastatic liver cancer, colon cancer, metastatic colon cancer, lung cancer, metastatic lung cancer, gastric cancer, pancreatic cancer, metastatic pancreatic cancer, skin cancer, melanoma, metastatic melanoma, osteosarcoma, fibrosarcoma, lipoma, gallbladder cancer, intrahepatic cholangiocarcinoma, bladder cancer, uterine cancer, cervical cancer, ovarian cancer, breast cancer, head and neck cancer, thyroid cancer and kidney cancer, brain cancer, glioblastoma, mediastinal tumor, mesenteric lymph node metastasis, blood cancer, leukemia, non-Hodgkin lymphoma, Hodgkin lymphoma, multiple myeloma, lymphoma, malignant lymphoma, myelodysplastic syndrome, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, solitary myeloma, aplastic anemia, spinal muscular atrophy, genetic diseases, genetic skeletal diseases, genetic malformation syndromes, autosomal recessive genetic diseases, rare diseases, infectious diseases, ischemic diseases, nasal polyps, sinusitis, hypertrophic scar, keloid, immune diseases, autoimmune diseases, infectious immune diseases, viral infections, bacterial infections, rheumatoid arthritis, diabetes, diabetic complications, foot ulcers, neuropathy, metabolic syndrome, intestinal diseases, atopy, allergy, lupus, dementia, Parkinson's disease, wound diseases, laceration wounds, skin diseases, pressure ulcers, vascular diseases, arterial diseases, venous diseases, lymphatic diseases, cardiovascular diseases, ischemic heart disease, cerebrovascular diseases, hypertension, dyslipidemia, arteriosclerosis, peripheral vascular diseases and lower limb arterial occlusion, but not limited thereto.

[0263] A pharmaceutical composition for preventing or treating the above diseases, comprising porous silica particles loaded with a bioactive material according to the present invention, may further comprise a pharmaceutically acceptable carrier and may be formulated together with the carrier. As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not irritate the organism and does not inhibit the biological activity and properties of the administered compound. The pharmaceutically acceptable carrier in a composition formulated in a liquid solution is sterile and physiologically compatible, and may include saline, sterile water, Ringer's solution, buffered saline, albumin injection, dextran solution, maltodextrin solution, glycerol, ethanol, and combinations of one or more of these components. In addition, other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added if necessary. Additionally, diluents, dispersants, surfactants, binders, and lubricants may be added to formulate the composition into injectable preparations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets, etc.

[0264] The composition of the present invention is suitable for any type of formulation that contains porous silica particles loaded with a bioactive substance according to the present invention as an active ingredient, and can be prepared in the form of oral or parenteral formulations. Such pharmaceutical formulations of the present invention may include any one suitable for oral, rectal, nasal, topical (including buccal and sublingual), subcutaneous, vaginal, or parenteral (intramuscular, subcutaneous) administration, or may be suitable for administration by inhalation or insufflation.

[0265] The composition of the present invention may be administered in a pharmaceutically effective amount. The effective dose level can be determined by considering factors such as the type of disease, severity, drug activity, sensitivity to the drug, administration time, administration route and release rate, treatment duration, factors including the simultaneous use of drugs, and other factors well known in the medical field. The composition of the present invention may be administered as a single therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered in a single dose or multiple doses. Considering all of the above factors, it is important to administer the minimum amount that can achieve the maximum effect without side effects, which is easily determined by those skilled in the art.

[0266] The dosage of the composition of the present invention can vary widely depending on the patient's weight, age, gender, and / or health condition, diet, administration time, administration method, excretion rate, and disease severity. Specifically, the appropriate dosage can depend on the amount of drug accumulated in the body and / or the specific efficacy of the porous silica particles loaded with the bioactive substance to be used. Generally, the dosage can be evaluated based on the EC50 determined to be effective in in vivo animal models as well as in vitro. For example, the dosage can be in the range of 0.01 μg to 1 g per kilogram of body weight, and the composition can be administered once or several times per unit cycle within a unit cycle of daily, weekly, monthly, or annually. Otherwise, the composition can be continuously administered for a long time through an infusion pump. The number of repeated doses is determined considering the retention time of the drug in the body, the drug concentration in the body, etc. Even after treatment during the course of disease treatment, the composition can be administered to prevent recurrence.

[0267] The composition of the present invention can further include at least one active ingredient having the same or similar function as the treatment of the above-mentioned disease, or a compound that maintains / increases the solubility and / or absorbability of the active ingredient. In addition, chemotherapeutic agents, anti-inflammatory agents, antiviral agents, and / or immunomodulators, etc. can be optionally included.

[0268] Furthermore, the composition of the present invention can be formulated by any conventional method known in the art to provide rapid, sustained, or delayed release of the active ingredient after administration to a mammal. The formulation can be in the form of powders, granules, tablets, emulsions, syrups, aerosols, soft or hard gelatin capsules, sterile injection solutions, sterile powders.

[0269] The present invention provides a composition for embolization procedures, which includes a composition for delivering a bioactive substance in the above-mentioned blood vessels.

[0270] The physical properties of the porous silica particles used in the composition for embolization are not significantly different from those of the particles mentioned above, but can be used by adjusting the particle size to a suitable size according to the purpose of embolization.

[0271] More specifically, nanoparticles are used to enter the microvessels within the tumor tissue and accumulate in the blood vessels in and against the tumor tissue, thereby blocking the tumor tissue and preventing the supply of oxygen and nutrients to it. In addition, the use of microparticles may block the arteries connected to the tumor tissue, thus embolizing a wider range of tumor tissue.

[0272] When using nanoparticles, the average diameter of the particles can be, for example, 100 to 1000 nm, specifically, 100 to 800 nm, 100 to 500 nm, 100 to 400 nm, 100 to 300 nm, 100 to 200 nm, etc. within the above range, but not limited thereto.

[0273] When using micron-sized particles, the average diameter of the particles can be, for example, 0.1 to 500 μm, 0.1 to 300 μm, 100 to 300 μm, 300 to 500 μm, more than 0.1 to 100 μm, 0.1 to 1 μm, 0.2 to 0.8 μm, etc., but not limited thereto.

[0274] As described above, the porous silica particles are biodegradable particles and can be degraded by body fluids or microorganisms in vivo, thereby releasing the anticancer drug in a sustained-release manner within several hours to several hundred hours after injection. If the tumor is not completely necrotic / killed after chemoembolization, the particles do not permanently block the blood vessels and can be re-administered via the same route (blood vessels) during a second procedure.

[0275] Although the composition may further include at least one embolization material selected from the group consisting of: polyvinyl alcohol, contrast agent, iodide oil, oil contrast agent, oil-phase contrast agent, barium contrast agent, lipiodol, N-butyl cyanoacrylate, coil, gel foam, gelatin, ethanol, dextran, silica, fumed silica, polymer, copolymer, sodium polyacrylate vinyl alcohol copolymer, radioactive material, glass, poly-L-guluronic acid alginate, polyglycolic acid-polylactic acid, polydioxanone, polyglycolic acid-caprolactone, polypropylene having a diameter of more than 100 μm, and porous silica particles. More preferably, considering that embolization with an emulsion injection is well-known common sense in the art, a contrast agent or iodide oil that can form a stable emulsion when mixed with the porous silica particles of the composition according to the present invention is selected.

[0276] The administration of the composition can be carried out through a catheter having the above advantages, and when the composition is administered into the blood vessel directly connected to the tumor through the catheter, damage to normal tissues can be prevented while only targeting the target tumor tissue, thereby enhancing the targeting effect.

[0277] Diseases that can be embolized using the composition may include at least one selected from the group consisting of: hepatocellular carcinoma, metastatic liver cancer, colon cancer, metastatic colon cancer, lung cancer, metastatic lung cancer, gastric cancer, pancreatic cancer, metastatic pancreatic cancer, skin cancer, melanoma, metastatic melanoma, osteosarcoma, fibrosarcoma, lipoma, gallbladder cancer, intrahepatic cholangiocarcinoma, bladder cancer, uterine cancer, cervical cancer, ovarian cancer, breast cancer, head and neck cancer, thyroid cancer, and kidney cancer, brain cancer, glioblastoma, mediastinal tumor, mesenteric lymph node metastasis, blood cancer, leukemia, non-Hodgkin lymphoma, Hodgkin lymphoma, multiple myeloma, lymphoma, malignant lymphoma, myelodysplastic syndrome, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, solitary myeloma, aplastic anemia, spinal muscular atrophy, genetic diseases, genetic skeletal diseases, genetic malformation syndromes, autosomal recessive genetic diseases, rare diseases, infectious diseases, ischemic diseases, nasal polyps, sinusitis, hypertrophic scars, keloids, immune diseases, autoimmune diseases, infectious immune diseases, viral infections, bacterial infections, rheumatoid arthritis, diabetes, diabetic complications, foot ulcers, neuropathy, metabolic syndrome, intestinal diseases, atopy, allergies, lupus, dementia, Parkinson's disease, wound diseases, lacerations, skin diseases, pressure ulcers, vascular diseases, arterial diseases, venous diseases, lymphatic diseases, cardiovascular diseases, ischemic heart disease, cerebrovascular diseases, hypertension, dyslipidemia, arteriosclerosis, peripheral vascular diseases, and lower extremity arterial occlusion, but not limited thereto.

[0278] Hereinafter, the present invention will be described in detail with reference to the following examples.

[0279] In the following examples, the porous silica particles of the present invention may be referred to as DegradaBALL (Korean Trademark Registration No. 40-1292208).

[0280] Example 1 - Preparation of Porous Silica Particles

[0281] (1) Preparation of Particle 1

[0282] 1) Preparation of Small-Pore Particles

[0283] Place 960 ml of distilled water (DW) and 810 ml of MeOH in a 2 L round-bottom flask. Add 7.88 g of CTAB to the flask, and then quickly add 4.52 ml of 1 M NaOH while stirring. After introducing the homogeneous mixture under stirring for 10 minutes, add 2.6 ml of TMOS thereto. After stirring for 6 hours to mix uniformly, the mixture is aged for 24 hours.

[0284] Then, the reaction solution was centrifuged at 25 °C and 8000 rpm for 10 minutes to remove the supernatant. During the centrifugation at 25 °C and 8000 rpm for 10 minutes, the product was washed five times alternately with ethanol and distilled water.

[0285] Thereafter, the obtained product was dried in an oven at 70 °C to obtain 1.5 g of powdered mesoporous silica particles (average pore diameter: 2 nm, particle size: 200 nm).

[0286] 2) Pore expansion

[0287] 1.5 g of the powdered mesoporous silica particles were added to 10 ml of ethanol for ultrasonic dispersion, and 10 ml of water and 10 ml of trimethylbenzene (TMB) were added for ultrasonic dispersion.

[0288] Thereafter, the dispersion was placed in an autoclave and reacted at 160 °C for 48 hours.

[0289] In the autoclave, the reaction started at 25 °C, then the temperature was raised at a rate of 10 °C / min, and then slowly cooled at a rate of 1 to 10 °C / min.

[0290] The cooled reaction solution was centrifuged at 25 °C and 8000 rpm for 10 minutes to remove the supernatant. During the centrifugation at 25 °C and 8000 rpm for 10 minutes, the product was washed five times alternately with ethanol and distilled water.

[0291] Thereafter, the obtained product was dried in an oven at 70 °C to obtain powdered mesoporous silica particles (average pore diameter of 10 to 15 nm and particle size of 200 nm).

[0292] 3) Calcination

[0293] The mesoporous silica particles prepared in the above part 2) were placed in a glass vial, heated at 550 °C for 5 hours, and slowly cooled to room temperature after the reaction was completed to prepare the particles.

[0294] (2) Preparation of Particle 2

[0295] Mesoporous silica particles were prepared in the same manner as in Example 1-(1), except that the reaction conditions during pore expansion were changed to 140 °C and 72 hours.

[0296] (3) Preparation of Particle 3 (10 L scale)

[0297] Mesoporous silica particles were prepared in the same manner as in Example 1-(1), except that a 5-fold larger container was used and each substance was used in a 5-fold volume.

[0298] (4) Preparation of Particle 4 (Particle Size: 300 nm)

[0299] Prepare porous silica particles in the same manner as in Example 1-(1), except that 920 ml of distilled water and 850 ml of methanol are used to prepare small pore particles.

[0300] (5) Preparation of Particle 5 (Particle Size: 500 nm)

[0301] Prepare porous silica particles in the same manner as in Example 1-(1), except that 800 ml of distilled water, 1010 ml of methanol and 10.6 g of CTAB are used to prepare small pore particles.

[0302] (6) Preparation of Particle 6 (Particle Size: 1000 nm)

[0303] Prepare porous silica particles in the same manner as in Example 1-(1), except that 620 ml of distilled water, 1380 ml of methanol and 7.88 g of CTAB are used to prepare small pore particles.

[0304] (7) Preparation of Particle 7 (Pore Size: 4 nm)

[0305] Prepare porous silica particles in the same manner as in Example 1-(1), except that 2.5 ml of TMB is used during pore expansion.

[0306] (8) Preparation of Particle 8 (Pore Size: 7 nm)

[0307] Prepare porous silica particles in the same manner as in Example 1-(1), except that 4.5 ml of TMB is used during pore expansion.

[0308] (9) Preparation of Particle 9 (Pore Size: 17 nm)

[0309] Prepare porous silica particles in the same manner as in Example 1-(1), except that 11 ml of TMB is used during pore expansion.

[0310] (10) Preparation of Particle 10 (Pore Size: 23 nm)

[0311] Prepare porous silica particles in the same manner as in Example 1-(1), except that 12.5 ml of TMB is used during pore expansion.

[0312] (11) Preparation of Particle 11 (Double Modification)

[0313] 1) Preparation of Small Pore Particles

[0314] Prepare small pore particles in the same manner as in Example 1-(1)-1).

[0315] 2) Pore expansion

[0316] The small pore particles were reacted with TMB in the same manner as in Example 1-(1)-2), then cooled and centrifuged to remove the supernatant. After centrifugation under the same conditions as in Example 1-(1)-2, the product was washed 3 times alternately with ethanol and distilled water, and then dried under the same conditions as in Example 1-(1)-2), thereby preparing porous silica particle powder (pore diameter: 10 to 15 nm, particle size: 200 nm).

[0317] 3) Surface modification

[0318] After dispersing 0.8 to 1 g of the porous silica particles with expanded pores in 50 ml of toluene, 5 ml of (3-aminopropyl)triethoxysilane was added thereto, and then refluxed and heated at 120 °C for 12 hours. After washing and drying as described above, 1 ml of triethylene glycol (PEG3, 2-[2-(2-methoxyethoxy)ethoxy]acetic acid) and 100 mg of EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide) and 200 mg of N-hydroxysuccinimide (NHS) were dispersed in 30 ml of PBS, and then reacted with stirring at room temperature for 12 hours. After that, the product was washed and dried as described above.

[0319] Since the reaction solution from the previous step remained inside the pores, the inside of the pores was not modified.

[0320] 4) Cleaning the inside of the pores

[0321] 800 mg of the surface-modified particle powder was dissolved in 40 ml of 2 M HCl / ethanol, and refluxed with vigorous stirring for 12 hours.

[0322] Thereafter, the cooled reaction solution was centrifuged at 8000 rpm for 10 minutes to remove the supernatant. During centrifugation at 25 °C and 8000 rpm for 10 minutes, the product was washed 5 times alternately with ethanol and distilled water.

[0323] After drying in an oven at 70 °C, powdery porous silica particles were obtained.

[0324] 5) Modification of the inside of the pores

[0325] (i) Propyl was introduced into the pores in the same manner as in Example 2-(2)-1) below.

[0326] (ii) Octyl was introduced into the pores in the same manner as in Example 2-(2)-2) below.

[0327] Example 2 - Surface Modification of Porous Silica Particles

[0328] (1) Positive charge

[0329] 1) Particles with an amino group and a particle size of 300 nm

[0330] React the porous silica particles in Example 1-(4) with (3-aminopropyl)triethoxysilane (APTES) to make them positively charged.

[0331] Specifically, 100 mg of porous silica particles were dispersed in 10 ml of toluene in a 100 ml round-bottom flask by means of a bath sonicator. Then, 1 ml of APTES was added and stirred at 130 °C and 400 rpm for 12 hours.

[0332] After the reaction, the product was slowly cooled to room temperature and then centrifuged at 8000 rpm for 10 minutes to remove the supernatant. During centrifugation at 25 °C and 8000 rpm for 10 minutes, the product was washed five times alternately with ethanol and distilled water.

[0333] Then, the washed product was dried in an oven at 70 °C to obtain powdery porous silica particles with amino groups on the particle surface and inside the pores.

[0334] 2) Particles with an amino group and a particle size of 200 nm

[0335] (i) Modify the porous silica particles in Example 1-(1) in the same manner as in Example 2-(1)-1), except that the particles were reacted with (3-aminopropyl)triethoxysilane (APTES) to make them positively charged, and 0.4 ml of APTES was added and the reaction time was 3 hours.

[0336] (ii) Modify the porous silica particles in Example 1-(9) in the same manner as in Example 2-(1)-1), except that the particles were reacted with (3-aminopropyl)triethoxysilane (APTES) to make them positively charged.

[0337] (iii) Modify the porous silica particles in Example 1-(10) in the same manner as in Example 2-(1)-1), except that the particles were reacted with (3-aminopropyl)triethoxysilane (APTES) to make them positively charged.

[0338] 3) Differences in surface modification between particles with an amino group

[0339] (i) Modify the porous silica particles that have undergone the procedures of Example 1-(1)-1) to Example 1-(1)-3) in the same manner as in Example 2-(1)-1), except that the particles were reacted with (3-aminopropyl)triethoxysilane (APTES) to make them positively charged.

[0340] (ii) The porous silica particles in Example 1-(9) were modified in the same manner as in Example 2-(1)-1), except that the particles were reacted with (3-aminopropyl)triethoxysilane (APTES) to make them positively charged, and the reaction time was 24 hours.

[0341] 4) Aldehyde group

[0342] The porous silica particles in Example 2-(1)-3)-(ii) were reacted with glutaraldehyde (GA) to make them positively charged.

[0343] More specifically, 100 mg of porous silica particles were dispersed in 10 ml of distilled water in a 100 ml round-bottom flask by a bath sonicator. Thereafter, 10 ml of GA was added and allowed to react while stirring at 400 rpm and room temperature for 24 hours.

[0344] After the reaction, the supernatant was removed by centrifugation at 8000 rpm for 10 minutes. During centrifugation at 25 °C and 8000 rpm for 10 minutes, the product was washed five times with distilled water.

[0345] (2) Introduction of hydrophobic groups

[0346] 1) Propyl

[0347] The porous silica particles in Example 1-(1) were modified in the same manner as in Example 2-(1), except that the particles were reacted with trimethoxy(propyl)silane to introduce propyl groups on the particle surface and inside the pores, 0.35 ml of trimethoxy(propyl)silane was added instead of APTES, and the reaction was carried out for 12 hours.

[0348] 2) Octyl

[0349] The porous silica particles in Example 1-(1) were modified in the same manner as in Example 2-(1), except that the particles were reacted with trimethoxy-n-octylsilane to introduce octyl groups on the particle surface and inside the pores, 0.5 ml of trimethoxy-n-octylsilane was added instead of APTES, and the reaction was carried out for 12 hours.

[0350] (3) Negative charge

[0351] 1) Carboxyl group

[0352] The porous silica particles in Example 1-(1) were modified in the same manner as in Example 2-(1)-1), except that the particles were reacted with succinic anhydride to make them negatively charged, dimethyl sulfoxide (DMSO) was used instead of toluene, 80 mg of succinic anhydride was added instead of APTES, the reaction was then carried out while stirring at room temperature for 24 hours, and DMSO was used instead of distilled water for washing.

[0353] 2) Thiol group

[0354] Modification was carried out in the same manner as in Example 2-(1)-1), except that 1.1 ml of MPTES was used instead of APTES.

[0355] 3) Sulfonic acid group

[0356] 100 mg of the porous silica particles in Example 2-(3)-2) were dispersed in 1 ml of 1M aqueous sulfuric acid solution and 20 ml of 30% hydrogen peroxide solution, and stirred at room temperature to cause an oxidation reaction, thereby oxidizing the thiol group to a sulfonic acid group. Thereafter, the product was washed and dried in the same manner as in Example 2-(1)-1.

[0357] 4) Methylphosphonate group

[0358] (i) The porous silica particles that had undergone the procedures of Example 1-(1)-1) to Example 1-(1)-3) were reacted with (3-trihydroxysilyl)propyl methylphosphonate (THMP) to make them charged.

[0359] More specifically, 100 mg of the porous silica particles were dispersed in 10 ml of distilled water in a 100-ml round-bottom flask by a bath sonicator. Then, 3 ml of THMP and 1.5 ml of 1M aqueous HCl solution were added thereto, and the mixture was stirred at 130 °C and 400 rpm for 24 hours.

[0360] After the reaction, the product was slowly cooled to room temperature, and the supernatant was removed by centrifugation at 8000 rpm for 10 minutes. During centrifugation at 25 °C and 8000 rpm for 10 minutes, the product was washed five times with distilled water.

[0361] (ii) The porous silica particles in Example 1-(9) were modified in the same manner as in the above part (i), except that the particles were reacted with 3-(trihydroxysilyl)propyl methylphosphonate (THMP) to make them negatively charged.

[0362] (iii) The porous silica particles in Examples 1-(10) were modified in the same manner as in the above part (i), except that the particles were reacted with 3-(trihydroxysilyl)propyl methylphosphonate (THMP) to make them negatively charged.

[0363] (4) Introduction of hydrophilic group - PEG

[0364] 100 mg of the porous silica particles in Example 1-(1) were dispersed in 20 ml of N,N'-disuccinimidyl carbonate (DSC) solution at a concentration of 50 μg / ml, and stirred at room temperature to bind DSC to the surface of the porous silica particles. Then, the particles were washed 3 times with 10 ml of distilled water, and then 10 mg of PEG (HO-PEG-NH2) with a molecular weight of 4 kDa and terminal amino groups was dispersed in 10 ml of the above solution and stirred at room temperature, whereby PEG was linked to the surface of the porous silica particles. Thereafter, the product was washed and dried in the same manner as in Example 2-(1)-1).

[0365] Example 3 - Loading of Bioactive Substances

[0366] (1) Doxorubicin

[0367] Doxorubicin was loaded onto the negatively charged porous silica particles in Example 2-(3)-4).

[0368] Specifically, 5 mg of the porous silica particle powder and 2 mg of doxorubicin were mixed in distilled water, and then the mixture was allowed to sediment at room temperature for 1 hour.

[0369] (2) Irinotecan

[0370] 5 mg of the negatively charged porous silica particle powder in Example 2-(3)-4) was dispersed in 1 ml of 1×PBS, 2 mg of irinotecan was added thereto, and then the mixture was dispersed for 15 minutes and then allowed to sediment at room temperature for 1 hour.

[0371] (3) Sorafenib

[0372] Sorafenib was loaded onto the porous silica particles in Example 1-(11)-5)-(i).

[0373] Specifically, 5 mg of the porous silica particle powder and 2 mg of sorafenib were mixed at a mixing ratio of 5:5 (by volume) in 1 ml of deionized water / ethanol, and then incubated at room temperature for 1 hour. Thereafter, the product was washed 3 times with 1 ml of deionized water.

[0374] (4) Retinoic acid

[0375] 1 ml of retinoic acid solution (ethanol at 50 mM) was added to 100 μg of the porous silica particle powder in Example 2-(1)-2)-(i), and then allowed to settle at room temperature for 4 hours, and then washed 3 times with 1 ml of ethanol.

[0376] (5) p53 peptide

[0377] The particles in Example 1-(11)-5)-(ii) were used as the porous silica particles.

[0378] The p53 peptide used herein mimics a part of the p53 protein sequence involved in the apoptotic mechanism. The mimicked sequence involves the sequence of the hydrophobic secondary helical structure part where the p53 protein binds to the hMDM2 protein. Therefore, the p53 peptide can act as an antagonist of the hMDM2 protein.

[0379] The amino acid sequence of the p53 peptide (Cal.m.w. 2596.78, MALDI-TOF measured value 2597.92) is shown in Formula 1 below (N-terminus → C-terminus).

[0380] [Formula 1]

[0381] Z-Gly-Gly-Qln-Ser-Qln-Qln-Thr-Phe-Y-Asn-Leu-Trp-Arg-Leu-Leu-X-Qln-Asn-NH2

[0382] (where X is a non-natural amino acid with an introduced azide functional group, and the azide functional group is 2-amino-5-azido-pentanoic acid; Y is a non-natural amino acid with an introduced alkyne functional group, where 4-pentynoic acid is introduced on the side chain of D-Lys;

[0383] X and Y are linked together through azide-alkyne cycloaddition or click reaction to form a triazole functional group;

[0384] Z is 5(6)-carboxyfluorescein (FAM)).

[0385] After dissolving 1.3 mg (500 nmole) of the p53 peptide in 100 μl of DMSO, the solution was mixed with 5 ml of an aqueous solution containing 5 mg of porous silica particle powder dissolved therein in a 15-ml conical tube, and then incubated at room temperature for 12 hours.

[0386] The porous silica particles loaded with the p53 peptide were purified by centrifugation (9289 rcf, 8500 rpm, 20 minutes, 15-ml conical tube) and washed three times with water repeatedly.

[0387] (6) siRNA

[0388] According to the requirements, purchase 21-base pair double-stranded siRNA targeting green fluorescent protein (GFP) synthesized by Bionic, Inc. (SEQ ID NO: sense; 5'-GGCUACGUCCAGGAGCGCACC-3' (SEQ ID NO: 1), antisense; 5'UGCGCUCCUGGACGUAGCCUU-3' (SEQ ID NO: 2)).

[0389] Under 1×PBS conditions, mix 10 μg of the porous silica particles in Example 2-(1)-2)-(ii) with 50 pmol of siRNA, and then load for 30 minutes at room temperature.

[0390] (7) Plasmid DNA

[0391] Generate 6.7-kilobase pair plasmid DNA (SEQ ID NO: 5) that is prepared to express GFP as the pcDNA3.3 backbone from bacteria, and use it after purification.

[0392] Under 1×PBS conditions, mix 10 μg of the porous silica particles in Example 2-(1)-2)-(ii) with 0.25 μg of plasmid DNA, and load for 30 minutes at room temperature.

[0393] (8) Linear DNA

[0394] Prepare the forward primer - CMV promoter - eGFP cDNA - reverse primer in sequence, and then perform PCR amplification to obtain 1.9-kilobase pair linear DNA (SEQ ID NO: 6) for use.

[0395] Under 1×PBS conditions, mix 12.5 μg of the porous silica particles in Example 2-(1)-2)-(iii) with 0.25 μg of linear DNA, and load for 30 minutes at room temperature.

[0396] (9) Protein

[0397] 1) BSA

[0398] Mix 100 μg of the porous silica particle powder in Example 2-(1)-2)-(ii) with 10 μg of BSA (Sigma-Aldrich, A6003) in 200 μl of 1×PBS, and then incubate for 1 hour at room temperature.

[0399] 2) IgG

[0400] Mix 100 μg of the porous silica particle powder in Example 2-(1)-2)-(ii) with 10 μg of anti-twist IgG (Santacruz, sc-81417) in 200 μl of 1×PBS, and then incubate at room temperature for 1 hour.

[0401] 3) RNase A

[0402] Mix 100 μg of the porous silica particle powder in Example 1-(9) with 10 μg of RNase A (Sigma-Aldrich, R6513) in 200 μl of 1×PBS, and then incubate at room temperature for 1 hour.

[0403] 4) Cas9

[0404] Mix 40 μg of the porous silica particle powder in Example 2-(1)-2)-(i), 4 μg of Cas9 protein (SEQ ID NO: 3), and 2.25 μg of guide RNA (SEQ ID NO: 4) in 10 μl of 1×PBS, and then incubate at room temperature for 1 hour.

[0405] (5) Anti-PD-1 antibody

[0406] Mix 100 μg of the porous silica particle powder in Example 2-(3)-4)-(ii) with 50 μg of anti-PD-1 (BioXCell, BP0146) in 100 μl of distilled water, and then incubate at room temperature for 5 minutes.

[0407] (6) Anti-PD-L1 antibody

[0408] Mix 100 μg of the porous silica particle powder in Example 2-(3)-4)-(ii) and 50 μg of anti-PD-L1 (BioXCell, BP0101) in 100 μl of distilled water, and then incubate at room temperature for 5 minutes.

[0409] Experimental Example 1 - Identification of Formation and Pore Expansion of Porous Silica Particles

[0410] Observe the small hole particles and the prepared porous silica particles in Examples 1-(1) to (3) under a microscope to determine whether the small hole particles are uniformly formed and / or whether the pores are sufficiently expanded to uniformly form the porous silica particles ( Figures 1 to 4 ).

[0411] Figure 1 is a microscopic image of the porous silica particles in Example 1-(1), and Figure 2It is the microscopic image of the porous silica particles in Example 1-(2), showing that spherical porous silica particles with sufficiently expanded pores are uniformly formed.

[0412] Figure 3 It is the microscopic image of the small-pore particles in Example 1-(1), and Figure 4 is the comparison of the microscopic images of the small-pore particles in Example 1-(1) and Example 1-(3), showing that spherical small-pore particles are uniformly formed.

[0413] Experimental Example 2 - Calculation of BET Surface Area and Pore Volume

[0414] The surface area and pore volume of the small-pore particles in Example 1-(1) and the porous silica particles in Example 1-(1), (7), (8) and (10) are calculated respectively. The surface area is calculated by the Brunauer-Emmett-Teller (BET) method, while the pore size distribution is calculated by the Barrett-Joyner-Halenda (BJH) method.

[0415] The microscopic image of the particles is as Figure 5 shown, and the calculation results are shown in Table 1 below.

[0416] [Table 1]

[0417]

[0418]

[0419] Experimental Example 3 - Verification of Biodegradability of Porous Silica Particles

[0420] To confirm the biodegradability of the porous silica particles in Example 1-(1), the degree of biodegradation at 37 °C and SBF (pH 7.4) was observed under a microscope at 0 h, 120 h and 360 h, and the results are as Figure 6 shown.

[0421] Referring to the results, it can be seen that the porous silica particles are biodegraded and almost completely degraded after 360 h.

[0422] Experimental Example 4 - Determination of Absorbance Ratio of Porous Silica Particles

[0423] The change of the absorbance ratio according to Equation 1 with time was measured.

[0424] [Equation 1]

[0425] A t / A0

[0426] (Where A0 is the absorbance of the porous silica particles measured by placing 5 ml of a suspension containing 1 mg / ml of porous silica particles in a cylindrical osmotic membrane with pores having a diameter of 50 kDa,

[0427] 15 ml of a solvent substantially the same as the suspension was placed outside the osmotic membrane while in contact with the osmotic membrane, and then the inside and outside of the osmotic membrane were horizontally stirred at 60 rpm and 37 °C.

[0428] A t is the absorbance of the porous silica particles measured t hours after measuring A0).

[0429] Specifically, 5 mg of porous silica particle powder was dissolved in 5 ml of SBF (pH 7.4). Thereafter, 5 ml of the porous silica particle solution was placed Figure 7 in the osmotic membrane shown having pores with a diameter of 50 kDa. Then, 15 ml of SBF was added to the outer membrane, and the SBF in the outer membrane was replaced every 12 hours. Degradation of the porous silica particles was carried out while horizontally stirring at 37 °C and 60 rpm. Then, the absorbance was measured by UV-visible spectroscopy and analyzed at λ = 640 nm.

[0430] (1) Measurement of absorbance ratio

[0431] The absorbance of the porous silica particles in Example 1-(1) was measured according to the above method, and the results are as Figure 8 shown.

[0432] Referring to the results, it can be seen that when the absorbance ratio reaches 1 / 2, t is about 58 hours and the degradation proceeds very slowly.

[0433] (2) Particle size measurement

[0434] The absorbance of the porous silica particles in Examples 1-(1), (5), and (6) was measured respectively according to Equation 1 above, and the results are as Figure 9 shown (SBF was used as the suspension and solvent).

[0435] Referring to the results, it can be seen that t decreases with an increase in particle size.

[0436] (3) Measurement at the average pore diameter

[0437] The absorbance of the porous silica particles in Examples 1-(1) to (9) was measured respectively according to Equation 1 above, and the absorbance of the small pore silica particles in Example 1-(1) was used as a control. The results are as Figure 10 shown (SBF was used as the suspension and solvent).

[0438] Referring to the results, it can be seen that the porous silica particles in the examples have a significantly larger t than the control.

[0439] (4) Measurement at (4) pH

[0440] The absorbance of the porous silica particles in Examples 1-(4) was measured at each pH. The absorbance was measured in SBF and Tris at pH 2, 5, and 7.4, respectively, and the results are as Figure 11 shown.

[0441] Referring to the results, there are differences in t for pH, but in all cases, when the absorbance ratio reaches 1 / 2, t is 20 or more.

[0442] (5) Measurement when charged

[0443] The absorbance of the porous silica particles in Example 2-(1)-1) was measured, and the results are as Figure 12 shown (Tris (pH 7.4) was used as the suspension and solvent).

[0444] Referring to the results, when the particles are positively charged, when the absorbance ratio reaches 1 / 2, t is 20 or more.

[0445] Experimental Example 5 - Release of Bioactive Substances

[0446] (1) Doxorubicin

[0447] 1) Dynamic conditions

[0448] This simulates an environment with a very high blood flow velocity or an environment where high external shocks occur frequently.

[0449] 5 mg of porous silica particles loaded with doxorubicin (1Mg) were dispersed in SBF (pH 7.4) (total volume: 1 ml), and then the solution was placed in a 1.5 ml tube and maintained under dynamic conditions of horizontal stirring at 37 °C and 20 rpm. At each time point, the porous silica solution loaded with doxorubicin was precipitated using a centrifuge, and the absorbance of the supernatant (λ ab = 480 nm) was measured to determine the release amount of doxorubicin. The results are as Figure 13 (A) shown.

[0450] Referring to the results, it can be found that doxorubicin is loaded on the particle surface with a relatively weak binding force and is released relatively quickly due to the high solubility of doxorubicin in SBF. The release rate reaches 50% after about 1.5 hours, and the bioactive substance is continuously released for up to 12 hours or longer.

[0451] 2) Static conditions

[0452] This simulates an environment with slow blood flow velocity, such as in tumor tissue, muscle tissue, or around a tumor.

[0453] Disperse 10 mg of porous silica particles loaded with doxorubicin (2 mg) in SBF (pH 7.4) inside a permeable membrane (total volume: 0.5 ml). Then place the permeable membrane into a 1.5 ml SBF tube (pH 7.4) and maintain it under static conditions at 37 °C. At each time point, use a centrifuge to sediment the porous silica solution loaded with doxorubicin, and measure the absorbance of the supernatant (λ ab = 480 nm) to determine the release amount of doxorubicin. The results are as Figure 13 (B) shown.

[0454] Referring to the results, it can be seen that although doxorubicin is loaded on the particle surface with a relatively weak binding force and is released relatively quickly due to the high solubility of doxorubicin in SBF, it takes about 6 days to reach a 50% release rate, and the bioactive substance is continuously released for up to 20 days or longer.

[0455] (2) Irinotecan

[0456] Disperse 1 Mg of porous silica particles loaded with irinotecan (0.2 mg) in 1 ml of human plasma. Keep the solution under dynamic conditions of horizontal stirring at 37 °C and 200 rpm. At each time point, use a centrifuge to sediment the porous silica solution loaded with irinotecan, and measure the absorbance of the supernatant (λ ab = 255 or 278 nm) to determine the release amount of irinotecan. The results are as Figure 14 shown.

[0457] Referring to the results, it can be seen that about 50% of irinotecan is released after 5.5 hours, and the bioactive substance is continuously released for up to 120 hours or longer.

[0458] (3) Sorafenib

[0459] Disperse 1 Mg of porous silica particles loaded with sorafenib (0.1 Mg) in 10 ml of 1×PBS. Maintain the solution under dynamic conditions of horizontal stirring at 37 °C and 200 rpm. At each time point, use a centrifuge to sediment the porous silica solution loaded with sorafenib, and measure the absorbance of the supernatant (λ ab = 270 nm) to determine the release amount of sorafenib. The results are as Figure 15 shown.

[0460] Referring to the results, it can be seen that the poorly soluble bioactive substance sorafenib is released very slowly by interacting with porous silica particles with hydrophobic substituents.

[0461] (4) Retinoic acid

[0462] 0.1 mg of retinoic acid-loaded particles were placed in a PBS (pH 7.4) solution containing 5% ethanol and maintained at 37 °C while being horizontally stirred. Every 24 hours, the solution containing the particles was centrifuged to measure the absorbance of the supernatant at a wavelength of 350 nm, thereby determining the release amount of retinoic acid. The results are as Figure 16 shown.

[0463] Referring to the results, it can be seen that negatively charged retinoic acid is released very slowly due to the interaction with positively charged porous silica particles, and almost 100% is released in about 10 days.

[0464] (5) p53 peptide

[0465] 5 mg of p53 peptide-loaded particles were placed in 5 ml of 1×PBS containing 10% FBS or 5 ml of 1×PBS and maintained in a dynamic environment while rotating at 37 °C and 20 rpm. At each time point, centrifugation was performed at 8500 rpm, and the fluorescence intensity of 5(6)-carboxyfluorescein (FAM), which is a fluorescent label bound to the p53 peptide in the supernatant (absorbance: 480 nm, emission: 520 nm), was measured. The results are as Figure 17 shown.

[0466] Referring to the results, it can be seen that porous silica particles load the p53 peptide through the binding force of internal hydrophobicity (hydrophobic interaction). Therefore, the p53 peptide is not released in the PBS solution. However, when there are proteins such as FBS (fetal bovine serum) in the solution, the p53 peptide will bind to the hydrophobic fragment of the FBS protein and can be dissolved in the solution. Therefore, it can be seen that the p53 peptide is released to the outside of the porous silica particles. On the contrary, when the p53 peptide loaded inside the particles is released to the outside of the particles, the FBS protein can be introduced into the particles.

[0467] (6) siRNA

[0468] 1) Condition 1

[0469] 10 μl of porous silica particles loaded with Cy5-siRNA were resuspended in SBF (pH 7.4, 37 °C) (total volume: 0.5 ml) and placed in a 1.5 ml tube. The release of siRNA was carried out while horizontally stirring at 37 °C and 60 rpm. At each time point, the porous silica solution loaded with siRNA was sedimented using a centrifuge, and the fluorescence intensity of the supernatant was measured.

[0470] At a wavelength of 670 nm (λ exThe fluorescence intensity of Cy5-siRNA was measured at λ = 647 nm to determine the release extent of siRNA, and the results are as shown in Figure 19 (A).

[0471] Referring to the results, it can be seen that it takes about 6 hours to release 50% of siRNA.

[0472] 2) Condition 2

[0473] 20 μg of the porous silica particles loaded with the siRNA (1 μg) in 1) were dispersed in SBF (pH 7.4) inside the osmotic membrane (total volume: 0.5 ml), and the osmotic membrane was placed in a tube of 1.5 ml of SBF (pH 7.4) and maintained under static conditions at 37°C. At each time point, the porous silica solution loaded with siRNA was sedimented using a centrifuge, and the absorbance of the supernatant was measured (λ ab = 480 nm) to determine the release amount of siRNA. The results are shown in Figure 19 (B).

[0474] Referring to the results, it can be seen that after about 48 hours, the release rate of siRNA reaches 50%, and the bioactive substance is continuously released for up to 100 hours or longer.

[0475] (7) Plasmid DNA

[0476] 20 μg of the porous silica particles loaded with pDNA (1 μg) were dispersed in SBF (pH 7.4) inside the osmotic membrane (total volume 0.5 ml), and the osmotic membrane was placed in a tube of 1.5 ml of SBF (pH 7.4), while shaking at 37°C and 60 rpm. At each time point, the porous silica solution loaded with pDNA was precipitated using a centrifuge, and the absorbance of the supernatant was measured (λ ab = 480 nm) to determine the release amount of pDNA. The results are as shown in Figure 20 and 21 .

[0477] Referring to the results, it can be seen that after about 24 hours, the release amount of pDNA reaches 50%, and the bioactive substance is continuously released for up to 100 hours or longer.

[0478] (8) Linear DNA

[0479] The porous silica particles loaded with linear DNA (3 μg of linear DNA, 100 μg of porous silica particles) were resuspended in PBS (pH 7.4, 37°C), and the osmotic membrane had a pore size of 20 kDa (same as Figure 18The tubes in it are the same tubes). After placing the suspension in the membrane, the permeation tube was immersed in 1.5 ml of PBS. The plasmid DNA was released while stirring horizontally at 37 °C and 60 rpm.

[0480] The released solvent was recovered at 0.5 h, 1 h, 2 h, 3 h, 4 h, 6 h, 12 h, and 24 h before 24 h, and then 0.5 ml of the released solvent was collected at 24 h for Hoechst binding assay, and then an equal amount of PBS was added.

[0481] At a wavelength of 460 nm (λ ex = 360 nm), the fluorescence intensity of Hoechst 33342 was measured to determine the degree of plasmid DNA release, and the results are as Figure 22 shown.

[0482] Referring to the results, it can be seen that the release time of 50% of the linear DNA is about 24 hours.

[0483] (9) Protein

[0484] 1) BSA

[0485] 100 μg of porous silica particles loaded with fluorescein-fluorescently labeled BSA were resuspended in 200 μl of SBF (pH 7.4) or PBS (pH 7.4). The release of BSA was carried out while stirring horizontally at 37 °C and 60 rpm.

[0486] At 6 h, 12 h, 24 h, 48 h, 96 h, 144 h, and 240 h, 200 μl of the released solvent was recovered for fluorescence measurement, and an equal amount of SBF or PBS was added thereto.

[0487] At a wavelength of 517 nm (λ ex = 492 nm), the fluorescence intensity of fluorescein-fluorescently labeled BSA was measured to determine the degree of BSA release, and the results are as Figure 23 shown.

[0488] Referring to the results, it can be seen that BSA was released in a continuous manner in both SBF and PBS, and it can be seen that in each time period, the release amount in PBS was slightly higher than that in SBF, and almost 100% was released at 250 hours or longer.

[0489] 2) IgG

[0490] 100 μg of porous silica particles loaded with fluorescein-fluorescently labeled IgG were resuspended in 200 μl of SBF (pH 7.4) or PBS (pH 7.4). IgG was released while stirring horizontally at 37 °C and 60 rpm.

[0491] At 6 h, 12 h, 24 h, 48 h, 96 h, 144 h, and 240 h, 200 μl of the release solvent was recovered for fluorescence measurement, and an equal volume of SBF or PBS was added thereto.

[0492] The fluorescence intensity of fluorescein-fluorescently labeled IgG was measured at a wavelength of 517 nm (λ ex = 492 nm) to determine the degree of BSA release, and the results are shown as Figure 24 (A).

[0493] Referring to the results, it can be seen that IgG was slowly released in both SBF and PBS, and almost 100% was released at 250 hours or longer.

[0494] 3) Other antibodies

[0495] Twenty micrograms of porous silica particles loaded with antibody 1 (anti-PD-1) or antibody 2 (anti-PD-L1) (10 μg) were dispersed in SBF (pH 7.4) (total volume: 1 ml). The solution was placed in a 1.5 ml tube and maintained under dynamic conditions of horizontal stirring at 37 °C and 20 rpm. At each time point, the antibody-loaded porous silica solution was sedimented using a centrifuge, and the absorbance of the supernatant (λ ab = 480 nm) was measured to determine the amount of antibody released. The results are shown as Figure 24 (B) and (C).

[0496] Referring to the results, it can be seen that for antibody 1, the release rate reached approximately 50% after about 45 hours, and for antibody 2, it reached approximately 50% after about 20 hours. It can be seen that at the beginning, the release rate in PBS was higher than that in SBF, but as time passed (with 100 hours as the turning point), the release rate in SBF increased, and the antibody continued to be released for up to 250 hours or longer.

[0497] 4) RNase A

[0498] One hundred micrograms of porous silica particles loaded with fluorescein-fluorescently labeled RNase A were resuspended in 200 μl of SBF (pH 7.4) or PBS (pH 7.4). The release of RNase A was carried out while horizontally stirring at 37 °C and 60 rpm.

[0499] At 6 h, 12 h, 24 h, 48 h, 96 h, 144 h, and 240 h, 200 μl of the release solvent was recovered for fluorescence measurement, and an equal volume of SBF or PBS was added thereto.

[0500] The fluorescence intensity of fluorescein-fluorescently labeled RNase A was measured at a wavelength of 517 nm (λ exThe fluorescence intensity of fluorescein-fluorescently labeled RNase A was measured at 492 nm (λex / λem = 492 nm) to determine the degree of BSA release, and the results are as Figure 25 shown.

[0501] Referring to the results, it can be seen that although RNase A was slowly released from SBF and PBS, the release amount in PBS was slightly higher than that in SBF in each time period, and almost 100% was released at 250 hours or longer.

[0502] 5) Cas9

[0503] 40 μg of porous silica particles loaded with Cas9 protein / gRNA complex were suspended in PBS (pH 7.4), and then the porous silica particles were placed in serum-free medium and treated on a slide with 50,000 NIH3T3 cells called mouse fibroblasts, and then incubated at 37 °C and 5% CO2.

[0504] At the 1 h, 3 h, 6 h, and 24 h time points, the medium was removed, the product was washed with 1×PBS solution, and incubated with 4% paraformaldehyde for 15 minutes to fix the cells.

[0505] After washing with PBS, the cells were incubated in blocking buffer (1×PBS, 5% normal goat serum, 0.3% triton X-100) for 1 hour.

[0506] After washing with PBS, the His-tag antibody (Santa Cruz, sc-8036) was incubated for 16 hours.

[0507] After washing again with PBS, the Alexa Fluor 488-conjugated anti-mouse secondary antibody (Abcam, ab150113) was incubated for 2 hours.

[0508] After washing with PBS, the slides were treated with DAPI to stain the cell nuclei. The distribution of proteins in the cells was identified using a fluorescence microscope, and the results are as Figure 26 shown.

[0509] In Figure 26 , DAPI is a reagent for nuclear staining, which appears blue in fluorescence microscope images and indicates the position of the cell nuclei. In addition, Alexa Fluor 488 is a fluorescent dye labeled with Cas9 protein, which appears green in fluorescence microscope images and indicates the position of Cas9 protein in the cells. When silica particles loaded with Alexa Fluor 488-labeled Cas9 protein are applied to cells and DAPI staining is performed, the fluorescence microscope images can show the presence or absence of Cas9 protein in the cells through the silica particles and the position of the cell nuclei.

[0510] Referring to the results, it can be seen that the Cas9 protein introduced into the cells was mainly observed in the cytoplasmic part 3 hours after introduction, and in the nucleus 24 hours after introduction. Since the silica particles used hardly enter the nucleus at all, it is understandable that the Cas9 protein is released from the silica particles 24 hours after introduction into the cells and enters the nucleus, which is an intracellular organelle known for Cas9 protein accumulation.

[0511] Experimental Example 6 - Delivery of Bioactive Substances and Treatment of Diseases

[0512] (1) Direct delivery in cancer

[0513] To verify the possible role of the vector in siRNA delivery studies at the animal level, the study inhibited tumors by releasing bioactive substances in mice.

[0514] Male Balb / c nude mice (5 weeks old) were purchased from Orient Bio, Inc. 3 million HeLa cells (cervical cancer cells) were dispersed in sterile 1×PBS to amplify the xenograft tumors subcutaneously injected into the mice. When solid tumors of 70 mm 3 size were observed, PBS, FITC-porous silica particles (the porous silica particles in Example 2-(1)-2)-(ii)), and FITC-porous silica particles loaded with Cy5-siRNA (the porous silica particles in Example 2(1)-2)-(ii)) were injected into the tumors of the mice, respectively. Then, the fluorescence intensity and its distribution were measured immediately before administration, immediately after administration, and 48 hours after administration by a FOBI fluorescence in vivo imaging system (Neoscience, Korea).

[0515] FITC labeling was carried out as follows: 50 mg of silica particles were dispersed in 1 ml of dimethyl sulfoxide (DMSO); 25 μg (10 μl) of FITC-NHS (N-hydroxysuccinimide) solution (2.5 mg / mL) was added thereto; the mixture was allowed to react at room temperature for 18 hours while shielding from light with aluminum foil; the reaction product was purified by centrifugation (8500 rpm, 10 minutes); the supernatant was discarded while the precipitated particles were collected; the particles were evenly dispersed in ethanol, and the above process was repeated three to four times with ethanol and distilled water for purification until the FITC color could not be seen in the supernatant. The results are as Figure 27 (A) shown.

[0516] In Figure 27(A), the control refers to the administration of PBS alone, cy5-siRNA refers to the administration of cy5-siRNA alone, FITC-DDV refers to the administration of FITC-labeled porous silica particles alone, and the complex refers to the administration of porous silica particles loaded with cy5-siRNA and labeled with FITC. As can be seen from the figure, the siRNA loaded on the particles and delivered into the body has a longer duration of activity and stays at the injection site for a longer time, so strong fluorescence is still shown even after 48 hours.

[0517] (2) Delivery by intravenous injection

[0518] 1) Experimental method

[0519] (i) Doxorubicin

[0520] HepG2 cells were used as a human hepatoma cell line to prepare Xeno in Balb / C nude mice. When the size of Xeno was suitable for the experiment (50 to 100 mm 3 ), the particles in Example 2-(3)-4)-(i) were loaded with doxorubicin, dispersed in 100 μl of an aqueous PBS solution, and injected through the tail vein of the mouse. The injection dose of doxorubicin was 4 mg / kg (mouse body weight). Based on the average body weight of 20 g of 5- to 8-week-old Balb / C nude mice, 80 μg of doxorubicin and 160 μg of the particles were used.

[0521] (ii) VEGF inhibitory siRNA

[0522] MDA-MB-231 cells were used as a human breast cancer cell line to prepare Xeno in Balb / C nude mice. When the size of Xeno was suitable for the experiment (50 to 100 mm 3 ), the particles in Example 2-(1)-2)-(ii) were loaded with VEGF inhibitory siRNA (SEQ ID NO: 7 sense; 5'-GGAGUACCCUGAUGAGAUCdTdT-3', SEQ ID NO: 8 antisense; 5′-GAUCUCAUCAGGGUACUCCdTdT-3′), dispersed in 100 μl of an aqueous PBS solution, and injected through the tail vein of the mouse. The injection dose of VEGF inhibitory siRNA was 1 mg / kg (mouse body weight). Based on the average body weight of 20 g of 5- to 8-week-old Balb / C nude mice, 20 μg of siRNA and 400 μg of the particles were used.

[0523] (iii) RNase A

[0524] Xenos were prepared in Balb / C nude mice using HeLa cells as a human cervical cancer cell line. When the size of the Xeno became suitable for the experiment (50 to 100 mm 3 ), the particles in Example 1-(9) were loaded with RNase A, dispersed in 100 μl of an aqueous PBS solution, and injected via the tail vein of the mouse. The injection dose of RNase A was 2 mg / kg (mouse body weight). Based on the average body weight of 20 g for 5- to 8-week-old Balb / C nude mice, 40 μg of RNase A and 400 μg of the particles were used.

[0525] (iv) p53

[0526] Xenos were prepared in Balb / C nude mice using HeLa cells as a human cervical cancer cell line. When the size of the Xeno was suitable for the experiment (50 to 100 mm 3 ), the particles in Example 1-(11)-5)-(ii) were loaded with p53 peptide, dispersed in 100 μl of an aqueous PBS solution, and injected via the tail vein of the mouse. The injection dose of p53 peptide was 2.5 mg / kg (mouse body weight). Based on the average body weight of 20 g for 5- to 8-week-old Balb / C nude mice, 50 μg of p53 peptide and 200 μg of the particles were used.

[0527] 2) Experimental results

[0528] Reference Figure 27 (B), in all cases where doxorubicin, VEGF inhibitory siRNA, RNase A, or p53 was loaded onto the porous silica particles of the present invention and then the particles were injected, tumor growth inhibition and VEGF expression inhibition were excellent compared to the separate injection of doxorubicin, VEGF inhibitory siRNA, RNase A, or p53, respectively. These results show the functional effects based on the intrinsic properties such as excellent intravascular delivery and biodegradability of the particles according to the present invention.

[0529] (3) Delivery to the blood vessels around the tumor via a catheter

[0530] To effectively deliver a bioactive substance to a tumor, after inserting a catheter into an artery close to the blood vessels associated with the tumor, the porous silica particles of the present invention loaded with an anticancer agent were delivered through the blood vessels ( Figure 27 (C)). Referring to Figure 27 (C), it can be seen that, as shown by the black drop in Figure 27 (C), the composition including the porous silica particles of the present invention mixed with a contrast agent accurately performs targeted delivery without clogging the catheter and blood vessels and / or without precipitation or aggregation.

[0531] Experimental Example 7 - Determination of ζ Potential in Porous Silica Particles

[0532] (1) Experimental method

[0533] Disperse 100 μg of porous silica particles in 1 ml of PBS (pH 7.4), transfer to a disposable folding capillary (DTS1070), and then install on a ζ-potential measuring device to measure the ζ-potential.

[0534] (2) Experimental results

[0535] Refer to Figure 28 , the P=O vibration peak, P-CH3 rocking peak, and P-CH3 wagging peak appear in the FT-IR spectrum, indicating that anionic functional groups are introduced onto the particle surface and make it negatively charged.

[0536] Referring to Table 2 below, it can be seen that the porous silica particles can have various ζ-potentials, depending on the functional groups to be modified, and it can also be seen that the types of loaded bioactive substances are diverse. Specifically, it can be seen that the porous silica particles of the present invention exhibit a ζ-potential above +3 mV or below -18 mV, and the bioactive substances are more effectively loaded onto the hydrophobic functional groups through dual modification (e.g., PEG).

[0537] [Table 2]

[0538]

[0539] Experimental Example 8 - Stability Analysis of Porous Silica Particles in Blood

[0540] (1) Experimental method

[0541] Disperse 10 mg of the particles in Example 1-(1) and 10 mg of the particles in Example 2-(3)-4)-(i) in PBS aqueous solution and 1 ml of 25% plasma solution respectively, then place at room temperature for 1 hour, and then remove the supernatant. The above solutions are compared, and the amount of particles that are not dispersed but settle in the solution is compared. In addition, by comparing the absorbance of the removed supernatant, the amount of particles stably dispersed in PBS aqueous solution and 25% plasma solution respectively is compared.

[0542] After dispersing 4 ml of human blood in 15 ml of PBS solution, the solution was centrifuged at 10,000 rpm for 5 minutes using a centrifuge, and 15 ml of the supernatant was discarded. This process was repeated five times to remove proteins other than red blood cells remaining in the blood. The separated red blood cells were dispersed in 40 ml of PBS solution. The particles in Example 1-(1) and Example 2-(3)-(4)-(i) were prepared successively at decreasing concentrations starting from a maximum value of 20 mg, and then dispersed in 0.8 ml of PBS solution. 0.2 ml of the above separately prepared red blood cell solution dispersed in PBS solution was added to the above solution, and then the mixture was shielded from light at room temperature and placed in a rotary stirrer at 80 rpm for 4 hours. After 4 hours, the particles were completely sedimented by centrifugation at 4 °C and 10,000 rpm for 3 minutes using a centrifuge, and the absorbance of the supernatant was measured at 577 nm to compare the hemolysis degree of red blood cells. 100% hemolysis was defined as the solution in which 0.8 ml of distilled water was used instead of the solution with dispersed particles, and 0% hemolysis was defined as the solution in which 0.8 ml of PBS solution was used instead of the solution with dispersed particles.

[0543] (2) Experimental results

[0544] Reference Figure 29 , it can be seen that under the conditions of PBS aqueous solution and 25% plasma solution, the precipitation or aggregation degree of the porous silica particles according to the present invention is significantly lower. More specifically, the control group showed precipitation rates of 80% and 70% in PBS aqueous solution and 25% plasma solution, respectively. On the other hand, the particles of the present invention showed precipitation rates of only 4% and 5%, respectively. The reason is that surface charges (ζ potential (mV)) are generated by surface treatment of the porous silica particles of the present invention, and repulsive forces are generated between the particles, thus maintaining a stable solution.

[0545] Reference Figure 30 , it can be seen that even when red blood cells are treated with a high concentration of the particles of the present invention, hemolysis does not occur. On the other hand, referring to Figure 31 , in the case of porous silica particles (Silanol-MSN) without surface modification with other functional groups, it can be seen that the hemolysis of red blood cells increases depending on the concentration of the particles. The reason is that most of the silica particles of the present invention are modified by replacing the silanol group with other functional groups including sulfonate, aldehyde, polyethylene glycol, methyl phosphonate, and amine functional groups. Therefore, it is considered that: the interaction with the quaternary ammonium group on the surface of red blood cells is not strong; due to the porous structure including many pores, the surface area in contact with red blood cells is small, thus reducing the interaction; and the diameter of the particles is more than 100 nm, so it is considered that the hemolysis of red blood cells is significantly lower than that of conventional silica particles.

[0546] Experimental Example 9 - Bioactive Substance Loading Capacity of Porous Silica Particles

[0547] (1) Experimental method

[0548] 1) Doxorubicin

[0549] After loading doxorubicin onto the negatively charged porous silica particles in Example 2-(3)-4)-(i), the absorbance of the supernatant was measured to determine the loading amount of doxorubicin, and the particle loading rate ("loading capacity") was calculated.

[0550] Specifically, 5 mg of porous silica particle powder and 2 mg of doxorubicin were mixed in 1 ml of distilled water and then allowed to settle at room temperature for 1 hour. Subsequently, the solution was centrifuged at 8000 rpm for 10 minutes to sediment the particles, and the absorbance of the supernatant (λ ab = 480 nm) was measured to determine the amount of low molecular weight compounds remaining in the supernatant without loading. In addition, the amount of loaded low molecular weight compounds (amount of loaded low molecular weight compounds = amount of initially added low molecular weight compounds - amount of low molecular weight compounds remaining in the supernatant) was calculated in order to determine the loading capacity (loading capacity = bioactive substance / porous silica particles, w / w%).

[0551] 2) Irinotecan

[0552] After loading irinotecan onto the negatively charged porous silica particles in Example 2-(3)-4)-(i), the absorbance of the supernatant was measured, the loading amount of irinotecan was calculated, and its loading capacity was determined. Except for measuring the absorbance at λ ab = 255 nm, the procedure for calculating the loading capacity was carried out in the same manner as in Experimental Example 9-(1)-1).

[0553] 3) Sorafenib

[0554] 5 mg of the porous silica particles in Example 1-(11)-5)-(i) and 2 mg of sorafenib were mixed at a mixing ratio of 5:5 (by volume) in 1 ml of deionized water / ethanol and then loaded at room temperature for 1 hour. Except for measuring the absorbance at λ ab = 270 nm, the procedure for calculating the loading capacity was carried out in the same manner as in Experimental Example 9-(1)-1).

[0555] 4) Retinoic acid

[0556] 1 ml of retinoic acid solution (50 mM in ethanol) was added to 100 μg of the porous silica particles in Example 2-(1)-2)-(i), and then loaded at room temperature for 4 hours. Except for measuring the absorbance at λ abIn addition to measuring the absorbance at 350 nm, the procedure for calculating the loading capacity was carried out in the same manner as in Experimental Example 9-(1)-1).

[0557] 5) p53 peptide

[0558] Disperse 5 mg of the porous silica particles in Example 1-(11)-5)-(ii) in 100 μl of a fluorescent (FAM)-labeled p53 peptide solution (13 mg / ml, DMSO), place it in a 15-ml conical tube, and then incubate it at room temperature for 12 hours. Thereafter, centrifuge the porous silica particles containing the p53 peptide (9289 rcf, 8500 rpm, 20 minutes, 15-ml conical tube), and then measure the fluorescence of the supernatant to calculate the amount of the peptide loaded on the particles.

[0559] 6) siRNA

[0560] After loading the positively charged particles in Example 2-(1)-3)-(ii) with siRNA, measure the amount of siRNA remaining in the supernatant to calculate its loading amount, thereby determining its loading capacity. Specifically, disperse 20 μg of the porous silica particles in 10 μl of an aqueous PBS solution, then add 1 μg of siRNA thereto, and let the mixture settle at room temperature for 30 minutes. Then, centrifuge the solution at 8000 rpm for 10 minutes, and use polyacrylamide gel electrophoresis (PAGE) to measure the amount of siRNA remaining in the supernatant and calculate the amount of siRNA loaded on the particles.

[0561] 7) mRNA

[0562] After loading the positively charged particles in Example 2-(1)-3)-(ii) with mRNA having the sequence of formula (2) below, measure the amount of mRNA remaining in the supernatant to calculate its loading amount, thereby determining its loading capacity. Specifically, disperse 20 μg of the porous silica particles in 10 μl of an aqueous PBS solution, add 1 μg of mRNA thereto, and let the mixture settle at room temperature for 30 minutes. Thereafter, centrifuge the solution at 8000 rpm for 10 minutes, and then use agarose gel to measure the amount of mRNA remaining in the supernatant and calculate the amount of mRNA loaded on the particles.

[0563] [Formula 2]

[0564] TTTGTTCATAAACGCGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCAGATCTGCGCAGCTGGG(A)≥100

[0565] 8) pDNA

[0566] After loading the positively charged particles in Example 2-(1)-3)-(iii) with pDNA, the amount of residual pDNA in the supernatant was measured to calculate the amount of loaded pDNA, thereby determining its loading capacity. Specifically, 20 μg of porous silica particles were dispersed in 10 μl of an aqueous PBS solution, 1 μg of pDNA was added thereto, and the mixture was allowed to settle at room temperature for 30 minutes. Thereafter, the solution was centrifuged at 8000 rpm for 10 minutes, and then the amount of pDNA remaining in the supernatant was measured using agarose gel, and the amount of pDNA loaded on the particles was calculated.

[0567] 9) Linear DNA

[0568] After loading the positively charged particles in Example 2-(1)-3)-(iii) with linear DNA, the amount of residual DNA in the supernatant was measured to calculate the amount of loaded linear DNA, thereby determining its loading capacity. Specifically, 20 μg of porous silica particles were dispersed in 10 μl of an aqueous PBS solution, 1 μg of linear DNA was added thereto, and the mixture was allowed to settle at room temperature for 30 minutes. Thereafter, the solution was centrifuged at 8000 rpm for 10 minutes, and then the amount of linear DNA remaining in the supernatant was measured using agarose gel, and the amount of linear DNA loaded on the particles was calculated.

[0569] 10) Protein

[0570] (i) BSA

[0571] After loading the positively charged porous silica particles with BSA, the amount of BSA remaining in the supernatant was measured to calculate the loading amount of BSA, thereby determining its loading capacity.

[0572] Specifically, 100 μg of the porous silica particle powder in Example 2-(1)-2)-(ii) and 10 μg of BSA (Sigma-Aldrich, A6003) were mixed in 200 μl of 1×PBS, and then incubated at room temperature for 1 hour. After that, the solution was centrifuged at 8000 rpm for 10 minutes to precipitate the particles, and then 10 μl of the supernatant was collected and thoroughly mixed with 200 μl of 5-fold diluted Bradford reagent, and its absorbance was measured at λ ab = 595 nm to determine the amount of unloaded residual BSA in the supernatant. At this time, the BSA solution was mixed with the Bradford reagent while diluting the solution to reduce its concentration, and then the absorbance of the solution was measured and compared with the standard curve of BSA to accurately calculate the loading capacity of BSA.

[0573] (ii) IgG

[0574] The same procedure as in Experimental Example 9-(1)-10)-(i) was carried out, except that 100 μg of the porous silica particle powder in Example 2-(1)-2)-(ii) was mixed with 10 μg of anti-twist IgG (Santacruz, sc-81417) in 200 μl of 1×PBS, then incubated at room temperature for 1 hour, and then loaded.

[0575] (iii) RNase A

[0576] The same procedure as in Experimental Example 9-(1)-10)-(i) was carried out, except that 100 μg of the porous silica particle powder in Example 1-(9) was mixed with 10 μg of RNase A (Sigma-Aldrich, R6513) in 200 μl of 1×PBS, then incubated at room temperature for 1 hour and loaded.

[0577] (iv) Cas9

[0578] The same procedure as in Experimental Example 9-(1)-10)-(i) was carried out, except that 40 μg of the porous silica particle powder in Example 2-(1)-2)-(i), 4 μg of Cas9 protein (SEQ ID NO: 3) and 2.25 μg of guide RNA (SEQ ID NO: 4) were mixed in 10 μl of 1×PBS, then incubated at room temperature for 1 hour and loaded.

[0579] (v) Anti-PD-1 antibody

[0580] The same procedure as in Experimental Example 9-(1)-10)-(i) was carried out, except that 100 μg of the porous silica particle powder in Example 2-(3)-4)-(ii) was mixed with 50 μg of anti-PD-1 (BioXCell, BP0146) in 100 μl of distilled water, then incubated at room temperature for 5 minutes and loaded with it.

[0581] (vi) Anti-PD-L1 antibody

[0582] The same steps as in Experimental Example 9-(1)-10)-(i) were carried out, except that 100 μg of the porous silica particle powder in Example 2-(3)-4)-(ii) was mixed with 50 μg of anti-PD-L1 (BioXCell, BP0101) in 100 μl of distilled water, then incubated at room temperature for 5 minutes and loaded with it.

[0583] (2) Experimental results

[0584] Reference Figure 32 , as a result of precipitating the porous silica particles loaded with doxorubicin by centrifugation, it can be seen that doxorubicin was mainly loaded on the particles, and thus the color of the solution was significantly clearer compared to the control group.

[0585] Referring to Table 3 below, the loading capacity (w / w%) of the porous silica particles according to the above experimental procedure for different bioactive substances (bioactive substance / porous silica particles) can be shown.

[0586] [Table 3]

[0587]

[0588]

[0589] Experimental Example 10 - Cytotoxicity Test of Porous Silica Particles

[0590] 10,000 HepG2 cells were placed in each well of a 96-well plate, and then after 24 hours, the particles in Example 2-(3)-4) were dispersed in each well in sequence from a lower concentration to a highest concentration of 1 Mg, and then left standing for 24 hours. The survival rate of HepG2 cells was measured using a cell counting kit (CCK), and the results are as Figure 33 shown.

[0591] From Figure 33 , it can be seen that the composition including the porous silica particles of the present invention does not affect the survival rate of the HepG2 cell line regardless of the concentration, and no cytotoxicity was observed.

[0592] Experimental Example 11 - Stability and Targetability of Embolization Composition Containing Porous Silica Particles

[0593] (1) Verification of stability when mixed with embolization materials

[0594] An emulsion was prepared by mixing 1.6 ml of lipiodol, which is widely used as an embolization material, with 0.4 ml of porous silica particles loaded with doxorubicin. It was dropped in the form of droplets onto a transparent plastic plate and photographed with a fluorescence microscope. As Figure 34 Shown are the photographed fluorescence images.

[0595] Refer to Figure 34 , it can be seen that, compared with the lipiodol emulsion alone (A), the emulsion form (B) mixed with porous silica particles maintains a uniform size of the emulsion for a longer time. Therefore, it should be understood that the porous silica particles of the present invention are suitable for mixing and using with embolization materials such as lipiodol, and can reduce aggregation and / or precipitation, thereby obtaining excellent embolization effects and therapeutic effects.

[0596] (2) Verification of targetability based on damage to normal liver tissue

[0597] 1) Experimental method

[0598] After the rabbit experiment was completed, the liver was collected and photographed to visually examine the infarction of the liver tissue, so as to determine whether there was damage to the normal liver tissue.

[0599] 2) Experimental results

[0600] Refer to Table 4 below and Figure 35 , when porous silica particles loaded with doxorubicin are mixed with lipiodol and used for liver cancer embolization in the form of an emulsion, the surrounding normal liver tissue other than liver cancer cells does not show hepatotoxicity such as inflammation. Therefore, the embolization effect can be shown based on the high targetability of the embolization composition including the porous silica particles and lipiodol of the present invention, and the therapeutic effect of the loaded bioactive substance corresponding to a specific disease can also be shown.

[0601] [Table 4]

[0602]

[0603] (3) Verification of targetability according to the release amount of bioactive substances in liver cancer tissues or cells

[0604] 1) Experimental method

[0605] (i) TACE

[0606] Insert a microcatheter through the artery in the rabbit's ear, implant a VX2 tumor in the liver. When the microcatheter reaches the hepatic artery, prepare an emulsion by mixing 0.4 ml of the particles in Example 2-(3)-4)-(i) loaded with doxorubicin with 1.6 ml of lipiodol, and inject 0.2 ml of the emulsion through the microcatheter inserted into the hepatic artery.

[0607] (ii) Fluorescence signal analysis device

[0608] For the porous silica particles with fluorescence on the particle surface, finely grind the tumors, livers, spleens and kidneys of the rabbits collected after TACE, and mix each 1 g of the tissues with 2 ml of 1.5% hydrochloric acid-ethanol solution, then use a homogenizer to fully mix the tissues and the solution. Then, place the mixture in the dark at 4 °C for 24 hours to elute the particles in the tissues. Centrifuge the solution at 4 °C and 5000 rpm for 10 minutes, and then measure the fluorescence of the supernatant to determine the amount of particles remaining in each tissue.

[0609] (iii) Flow cytometry

[0610] For the porous silica particles with fluorescence on the particle surface, finely grind the tumors, livers, spleens and kidneys of the rabbits collected after TACE, and mix each 200 mg of the tissues with 10 ml of 0.25% trypsin. Let the mixture stand at room temperature for 30 minutes to detach the cells from the tissues. After 30 minutes, collect the supernatant, and then compare the amount of particles contained in the cells extracted by flow cytometry.

[0611] (iv) Pharmacokinetics

[0612] At 0, 1, 5, 10, 30, 60 minutes after the TACE procedure, collect the blood of the rabbits and separate the plasma from the blood. Then, analyze the amount of doxorubicin present in the plasma by HPLC.

[0613] (v) Amount of doxorubicin remaining in the tissue

[0614] Finely grind the collected tumors and normal liver tissues, and mix each 1 g of the tissues with 2 ml of 1.5% hydrochloric acid-ethanol solution, then use a homogenizer to fully mix the tissues and the solution. Then, place the mixture in the dark at 4 °C for 24 hours to elute the particles in the tissues. Centrifuge the solution at 4 °C and 5000 rpm for 10 minutes, and then measure the fluorescence of doxorubicin in the supernatant at 480 nm to determine the amount of doxorubicin remaining in both the tumors and normal liver tissues.

[0615] 2) Experimental results

[0616] Reference Figure 36(A) and (B), when embolization (DegradaBALL-TACE) is performed using an embolization composition comprising the porous silica particles of the present invention and lipiodol, most of the injected particles are observed in the liver cancer tissue (A) or liver cancer cells (B). Therefore, the excellent targeted delivery effect of the embolization composition according to the present invention can be confirmed.

[0617] Refer to Figure 36 (C), when embolization is performed using an embolization composition (DegradaBALL-TACE without lipiodol) comprising the porous silica particles loaded with doxorubicin according to the present invention, the amount of doxorubicin released from the peritumoral cells is significantly lower than the amount of doxorubicin released from the peritumoral cells when lipiodol embolization alone is used. In addition, in the case of embolization using the embolization composition and lipiodol of the present invention (DegradaBALL-TACE), it can be seen that the amount of doxorubicin released is very negligible. On the other hand, refer to Figure 36 (D), when embolization is performed using an embolization composition (DegradaBALL-TACE without lipiodol) comprising the porous silica particles loaded with doxorubicin according to the present invention, the residual amount of doxorubicin in the liver cancer tissue relative to the normal liver tissue is significantly higher than that of lipiodol embolization alone (cTACE). In addition, in the case of embolization using the embolization composition and lipiodol (DegradaBALL-TACE) of the present invention, it can be seen that the amount of doxorubicin released is even higher than the above case. This result shows the high targeting of the embolization composition comprising the porous silica particles according to the present invention, and indicates that the combination of this composition with lipiodol can exhibit a greater synergistic effect and obtain excellent embolization results.

[0618] Experimental Example 12 - Verification of Therapeutic Effect of Embolization Composition Containing Porous Silica Particles on Liver Cancer

[0619] (1) Experimental method

[0620] 1) Survival rate

[0621] According to the histopathology of the collected tumors, tumor thin sections are prepared and TUNEL analysis is performed to distinguish dead cells and live cells, so that live cells and dead cells in the tumors can be visually distinguished. After visually confirming and determining live cancer cells and dead cancer cells, the size of the live tumors is compared with the total tumor size to determine the survival rate.

[0622] 2) AST and ALT

[0623] At 0, 1, 4, and 7 days after the TACE procedure, 1 ml of rabbit blood is collected respectively, and then plasma is separated from the blood by colorimetric analysis to analyze the concentrations of AST and ALT, which are proteins that identify liver-specific toxicity in plasma.

[0624] (2) Experimental results

[0625] Reference Figure 37 (A) and (B), a part of the liver cancer tissue of the rabbit was stained brown (A). In addition, when embolization was performed using an embolization composition including porous silica particles loaded with doxorubicin and lipiodol according to the present invention, it was found that the survival rate of liver cancer cells in the stained liver cancer tissue was significantly reduced, depending on the concentration of the loaded doxorubicin (B). This indicates that embolization using the composition of the present invention shows excellent drug delivery and therapeutic effects.

[0626] Reference Figure 37 (C) and (D), as a result of measuring the concentrations of AST (aspartate aminotransferase; (C)) and ALT (alanine aminotransferase; (D)) during embolization using the composition of the present invention, these concentrations were maintained at low levels, indicating that no hepatotoxicity occurred during embolization.

Claims

1. An injectable preparation for delivering a bioactive substance into a blood vessel, comprising a plurality of porous silica particles, Among them, wherein the bioactive substance is loaded on the surface of the plurality of particles or inside the pores of the particles, and the ζ potential of the plurality of porous silica particles at pH 7.4 is above +3 mV or below -18 mV, and there is a repulsive force between the plurality of particles, and chemically modifying the plurality of particles on the surface of the plurality of particles or inside the pores, wherein the plurality of particles are biodegradable, wherein when the absorbance ratio in Formula 1 reaches 1 / 2, t is 20 or more: [Formula 1] A t / A0 wherein A0 is the absorbance of the porous silica particles measured by placing a 5 ml suspension containing 1 mg / ml of the porous silica particles in a cylindrical osmotic membrane having a pore diameter of 50 kDa, wherein 15 ml of the same solvent as the suspension is present outside the osmotic membrane and in contact with the osmotic membrane, and the inside and outside of the osmotic membrane are horizontally stirred at 37 °C and 60 rpm, the pH of the suspension is 7.4, and A t is the absorbance of the porous silica particles measured t hours after measuring A0, wherein the bioactive substance is a drug for treating a disease selected from the group consisting of vascular diseases, lymphatic diseases, ischemic heart diseases, hypertension, and dyslipidemia.

2. The injectable preparation according to claim 1, wherein at least a part of the silanol groups on the surface of the particles or inside the pores of the particles is substituted by at least one functional group selected from the group consisting of aldehyde, ketone, amine, silyl, carboxyl, sulfonic acid, thiol, ammonium, ester, imide, thioimide, ether, indene, sulfonyl, polyethylene glycol, substituted or unsubstituted C1 to C 30 alkyl, substituted or unsubstituted C3 to C 30 cycloalkyl, and substituted or unsubstituted C6 to C 30 aryl.

3. The injectable preparation according to claim 1, wherein at least a part of the silanol groups on the surface of the particles or inside the pores of the particles is substituted with at least one functional group selected from the group consisting of amino, amine, PEG, propyl, octyl, carboxyl, thiol, sulfonic acid, methyl phosphonate, and aldehyde groups.

4. The injectable preparation according to claim 1, wherein the diameter of the particles is 100 to 1000 nm.

5. The injectable preparation according to claim 1, wherein the ζ potential of the particles at pH 7.4 is +3 mV to +100 mV or -100 mV to -18 mV.

6. The injectable preparation according to claim 1, wherein the particles have a volume of 0.7 to 2.2 ml per gram.

7. The injectable preparation according to claim 1, wherein the maximum release amount of the bioactive substance loaded on the particles is 99 wt% or more.

8. The injectable preparation according to claim 1, wherein the bioactive substance is at least one selected from the group consisting of nucleic acids, nucleotides, proteins, peptides, amino acids, antigens, growth factors, and elements constituting them.

9. The injectable preparation according to claim 1, wherein the vascular disease is an arterial disease, a venous disease, a cardiovascular disease, a cerebrovascular disease, or a peripheral vascular disease.

10. The injectable preparation according to claim 9, wherein the arterial disease is lower limb arterial occlusion.

11. The injectable preparation according to claim 1, wherein the vascular disease is arteriosclerosis.

12. The injectable preparation according to claim 2, wherein the ester is selected from the group consisting of carbamate, sulfate, sulfonate, phosphate, and methyl phosphonate.

13. The injectable preparation according to claim 2, wherein the amine is selected from the group consisting of an amino group and an aminoalkyl group.

14. The injectable preparation according to claim 1, wherein the bioactive substance is a compound.

Images