A method and kit for rapid detection of deep-seated Aspergillus infections
By combining specific primers and probes and optimizing PCR amplification conditions, the problem of low detection efficiency of deep-infected Aspergillus has been solved, enabling rapid and accurate single-tube detection and differentiation, which is suitable for scientific research and clinical testing.
Patent Information
- Application Number
- CN202211065765.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-01
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2042-09-01
AI Technical Summary
Existing technologies for detecting Aspergillus in deep-seated infections suffer from low detection efficiency, long detection time, and poor specificity. In particular, it is difficult to accurately distinguish between Aspergillus flavus, Aspergillus niger, and Aspergillus fumigatus in the early stages, and false positives and environmental contamination are common.
Using specific primer and probe compositions and optimized PCR amplification conditions, combined with nucleic acid direct-crack extraction buffer and PCR premix, rapid DNA extraction and amplification are achieved through high-temperature heating and specific temperature control, enabling rapid and accurate detection of samples in a single tube.
It enables DNA extraction within 15 minutes and PCR amplification within 26 minutes, and can simultaneously detect and distinguish Aspergillus flavus, Aspergillus niger, and Aspergillus fumigatus in a single tube, reducing the risk of false positives and improving detection efficiency and specificity, making it suitable for scientific research and clinical testing.
Smart Images

Figure CN116064899B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method and kit for rapid detection of deeply infected Aspergillus species, specifically a method and kit for rapid PCR nucleic acid detection of deeply infected Aspergillus species (Aspergillus fumigatus, Aspergillus flavus, and Aspergillus niger), belonging to the field of biodetection technology. Background Technology
[0002] Invasive pulmonary aspergillosis (IPA) is an infectious disease caused by the invasion of Aspergillus hyphae into the lung parenchyma. It primarily occurs in immunocompromised individuals, such as patients undergoing broad-spectrum antibiotics, organ transplantation, or chemotherapy for cancer, accounting for 50%–60% of invasive aspergillosis infections. Aspergillus is an opportunistic pathogen, causing infection in humans with approximately 20 species, the most common being Aspergillus flavus, Aspergillus niger, and Aspergillus fumigatus. Early diagnosis of IPA is difficult, and the condition is easily masked by the primary disease, leading to misdiagnosis, missed diagnosis, and delayed treatment. The mortality rate for untreated pulmonary aspergillosis can reach 30%–80%. Therefore, accurate and timely diagnostic methods for pulmonary aspergillosis are an urgent clinical need, and developing a more sensitive and specific early diagnostic method for IPA is urgently required.
[0003] Currently, common methods for detecting deep aspergillosis include pathological histological examination, imaging examination, culture, determination of specific antigens, and molecular diagnostic techniques. Among these, microscopic examination of sterile tissues and blood culture can provide direct evidence for the diagnosis of IPA. The accuracy of pathological diagnosis depends on the lesion location, specimen pretreatment methods, and the experience of the diagnostic physician, and it is time-consuming and expensive. Aspergillus culture is currently the gold standard for diagnosing invasive aspergillosis, but its positive detection rate is low and the detection time is too long, which is not conducive to early diagnosis. Imaging diagnostic methods mainly include X-ray, CT, and MRI, but the imaging features are not specific and can also be seen in infections caused by other pathogens. Therefore, there is an urgent need in this field for a product that can detect aspergillosis quickly, with high sensitivity and specificity, thereby saving detection time and improving detection efficiency.
[0004] The invention patent with publication number CN108070675A provides a specific primer-probe combination capable of simultaneously detecting *Aspergillus fumigatus*, *Aspergillus flavus*, and *Aspergillus niger*. The reaction program for the kit prepared with this primer-probe combination is: 50℃ for 2 min; 95℃ for 10 min; 95℃ for 15 s; 57℃ for 30 s, for 40 cycles. This patent focuses on examining the specificity, sensitivity, and stability of its specific primer-probe combination against *Aspergillus fumigatus*, *Aspergillus flavus*, and *Aspergillus niger*, as well as whether it has cross-reactivity with other bacteria. However, this specific primer-probe combination cannot distinguish *Aspergillus fumigatus*, *Aspergillus flavus*, and *Aspergillus niger* at the species level, nor does it involve the examination and research of rapid amplification during the PCR reaction. Aspergillus fumigatus, Aspergillus flavus, and Aspergillus niger are all fungi. Due to their thick cell walls (thicker than most plants), complex structures, and diverse metabolic products, fungal DNA extraction has always been a challenge for nucleic acid detection. For rapid nucleic acid amplification, some literature reports the use of unconventional rapid PCR instruments, such as light-heated, hot-water-heated, and air-heated PCR instruments, combined with high-thermal-conductivity metal consumables and specific consumables with a thickness of less than 0.1 mm, to achieve rapid nucleic acid amplification. However, there are few reports on how to achieve rapid nucleic acid amplification by optimizing the PCR system and amplification conditions on existing commercial PCR instruments. Summary of the Invention
[0005] This invention aims to address how to rapidly improve detection efficiency and save detection time in the detection of deeply infected Aspergillus species. To this end, it provides a rapid detection method for deeply infected Aspergillus species, enabling rapid detection of a series of processes from nucleic acid extraction to nucleic acid amplification reaction. It also provides a specific primer-probe composition capable of distinguishing between Aspergillus flavus, Aspergillus niger, and Aspergillus fumigatus. Based on this rapid detection system, this invention also provides a kit for the rapid detection of deeply infected Aspergillus species.
[0006] This invention is achieved through the following technical solution: A method for rapid detection of deeply infected Aspergillus, comprising mixing the sample to be tested with a nucleic acid cleavage extraction solution and heating at 60-65°C for 8-20 min, then heating at 93-98°C for 5-10 min to obtain a DNA extract of the sample to be tested; adding the DNA extract to a PCR premix containing a composition of deeply infected Aspergillus to obtain a PCR reaction solution; and performing the following PCR amplification reaction on the PCR reaction solution:
[0007] The denaturation process is carried out at a controlled temperature of 90–100°C with a dwell time of 0–5 seconds, followed by annealing and extension at a controlled temperature of 50–70°C with a dwell time of 0–5 seconds. This process is repeated 35–50 times.
[0008] The nucleic acid direct-crack extraction solution includes tris(hydroxymethyl)aminomethane hydrochloride, sodium dodecyl sulfonate, and protease;
[0009] The PCR premix also includes at least one of deoxyribonucleoside triphosphate, DNA polymerase, amplification buffer, and PCR enhancer.
[0010] The composition for deep infection with Aspergillus comprises the following components:
[0011] For example, the upstream primer of Aspergillus flavus shown in SEQ ID NO:1, the downstream primer of Aspergillus flavus shown in SEQ ID NO:2, and the probe of Aspergillus flavus shown in SEQ ID NO:3;
[0012] For example, the upstream primer of Aspergillus niger shown in SEQ ID NO:4, the downstream primer of Aspergillus niger shown in SEQ ID NO:5, and the probe of Aspergillus niger shown in SEQ ID NO:6;
[0013] And the upstream primer of Aspergillus fumigatus as shown in SEQ ID NO:7, the downstream primer of Aspergillus fumigatus as shown in SEQ ID NO:8, and the probe of Aspergillus fumigatus as shown in SEQ ID NO:9.
[0014] Furthermore, the composition for deep infection with Aspergillus also includes:
[0015] As shown in SEQ ID NO:10, the internal standard forward primer;
[0016] As shown in SEQ ID NO:11, the internal standard downstream primer;
[0017] And an internal standard probe as shown in SEQ ID NO:12.
[0018] The amount of primers used in the composition for deep infection of Aspergillus is 100-1000 nM; the amount of probes used in the composition for deep infection of Aspergillus is 50-800 nM.
[0019] The PCR enhancers include betaine, DMSO, and glycerol.
[0020] Another technical solution of the present invention is: a rapid detection kit for deep infection of Aspergillus, comprising the aforementioned nucleic acid cleavage extract and PCR premix, and performing PCR amplification reaction according to the aforementioned method.
[0021] Furthermore, the composition for deep infection with Aspergillus also includes:
[0022] As shown in SEQ ID NO:10, the internal standard forward primer;
[0023] As shown in SEQ ID NO:11, the internal standard downstream primer;
[0024] And an internal standard probe as shown in SEQ ID NO:12.
[0025] The amount of primers used in the composition for deep infection of Aspergillus is 100-1000 nM; the amount of probes used in the composition for deep infection of Aspergillus is 50-800 nM.
[0026] The PCR enhancers include betaine, DMSO, and glycerol.
[0027] In the composition for deep infection of Aspergillus described in this invention, the fluorophores of the probes do not interfere with each other. In this invention, "does not interfere with each other" means that each probe in the composition uses a different fluorophore, and they do not affect each other's detection; that is, different channels can be used for detection. For example, FAM, HEX, ROX, and CY5 can be used. The absorbance values of these fluorophores are not close, and different detection channels can be selected, thus avoiding mutual interference.
[0028] Furthermore, the fluorescent group of the Aspergillus flavus probe shown in SEQ ID NO:3 is FAM; the fluorescent group of the Aspergillus niger probe shown in SEQ ID NO:6 is HEX; the fluorescent group of the Aspergillus fumigatus probe shown in SEQ ID NO:9 is ROX; and the fluorescent group of the internal standard probe shown in SEQ ID NO:12 is CY5.
[0029] When preparing a rapid detection kit for deep-seated Aspergillus infections according to the present invention, the kit may contain nucleic acid cleavage extract, dNTP(U), DNA polymerase, PCR buffer, UDG enzyme, or Mg 2+ At least one of them.
[0030] Nucleic acid direct-cleavage extract refers to a chemical reagent capable of purifying and extracting substances suitable for PCR. Examples include strongly acidic or strongly alkaline chemical reagents. Exemplary nucleic acid direct-cleavage extracts may include one or more components such as tris(hydroxymethyl)aminomethane hydrochloride, sodium dodecyl sulfate, and protease, but the invention is not limited thereto.
[0031] Furthermore, when dNTP(U) is used in the kit, the amount of dNTP(U) is 0.2–0.5 mM. When DNA polymerase is used, the concentration of DNA polymerase is 5–20 U / μL; for example, Taq DNA polymerase can be used. When UDG enzyme is used, the concentration of UDG enzyme is 0.1–1 U / μL.
[0032] It should be noted that the above-mentioned uses and methods provided by this invention are all for non-diagnostic purposes. "Non-diagnostic purposes" means that they are not intended to obtain information about an individual's infection or susceptibility to related diseases. For example, this method can be used in experiments for scientific research purposes to detect whether a culture contains Aspergillus.
[0033] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0034] (1) This invention provides a method for extracting samples of deeply infected Aspergillus by direct splitting. It does not require complicated operations such as centrifugation and removal of supernatant. The sample and direct splitting extract are simply mixed and heated to obtain a DNA extract that can be used for PCR amplification. The extraction time is only 15 minutes.
[0035] (2) This invention provides a rapid PCR nucleic acid amplification system and method suitable for deep infection of Aspergillus. It uses efficient amplification primers, PCR enhancers and specific PCR amplification conditions, namely: through a specific amplification program and a specific dwell time, the target DNA is amplified. The operation is simple and the amplification time is only 26 min, which greatly improves the detection efficiency.
[0036] (3) The present invention also proposes a novel composition for deep infection of Aspergillus that is applicable to the PCR nucleic acid amplification method. The novel composition is a mixture of specific primers and probes for Aspergillus flavus, Aspergillus niger and Aspergillus fumigatus. Combined with the fluorescent probe method, it can be used to perform detection in one test using a single tube, which can avoid false positives and environmental pollution caused by cross-contamination between samples. It has the characteristics of low detection cost, high throughput, high sensitivity, good specificity and simple operation.
[0037] (4) Under the premise of ensuring the accuracy and effectiveness of amplification, the time required for each cycle is significantly shortened. As the number of cycles increases, the time and energy saved become more and more obvious, thus achieving the goal of rapidly and simply amplifying Aspergillus nucleic acid, thereby providing enough nucleic acid samples for various scientific research.
[0038] (5) The composition of the present invention can provide information on 4 target points in a single test tube during the detection process, and the operation is simple. The results can be determined by the Ct value. The entire detection process is carried out under single-tube closed conditions, avoiding false positives and environmental contamination caused by cross-contamination between samples.
[0039] (6) The composition of the present invention can simultaneously detect and type three Aspergillus species that cause deep infections, enabling the Aspergillus species that cause infection to be detected in the early stage of infection. The detection results can be used for targeted treatment to avoid high mortality.
[0040] In summary, this invention provides a specific probe-primer composition capable of distinguishing Aspergillus flavus, Aspergillus niger, and Aspergillus fumigatus at the species level. Furthermore, it designs specific DNA extraction methods and PCR amplification reaction procedures for the target Aspergillus species and the probe-primer composition. These methods significantly reduce extraction and reaction times while maintaining amplification efficiency, thereby improving detection efficiency and contributing to clinical research on invasive pulmonary aspergillosis. Attached Figure Description
[0041] Figure 1 The amplification curves are for Example 3 and Comparative Example 1.
[0042] Figure 2 The amplification curves are for Example 4, Comparative Example 2, and Comparative Example 3.
[0043] Figure 3 This is the amplification curve of the clinical sample containing aflatoxin detected in Example 5.
[0044] Figure 4 The amplification curves are shown for the sensitivity of Aspergillus niger, Aspergillus flavus and Aspergillus fumigatus in the composition investigated in Example 6. Detailed Implementation
[0045] The invention's objective, technical solution, and beneficial effects will be further explained in detail below.
[0046] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the claimed invention. Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0047] Given the low detection efficiency and specificity differences of primer-probe compositions in traditional PCR methods for detecting deeply infected Aspergillus, this invention provides a rapid PCR detection method for deeply infected Aspergillus. This method features innovative designs in three main aspects: First, regarding the direct-crack extraction of nucleic acids, addressing the difficulty in extracting fungal DNA, the direct-crack extraction solution designed in this invention first uses a protease to digest the viscous proteins in sputum to reduce sample viscosity; second, the protease and the surfactant sodium dodecyl sulfate in the direct-crack extraction solution work together to degrade the fungal cell wall and cell membrane; finally, the sample is heated to 95°C, completely destroying the fungal cell wall and cell membrane, allowing for the full release of sample DNA. This direct-crack extraction method eliminates the need for complex operations such as centrifugation and supernatant removal; simply mixing the sample with the nucleic acid direct-crack extraction solution and heating it yields the DNA extract, facilitating rapid detection. Secondly, the primers in the PCR premix are designed and optimized to achieve extremely high amplification efficiency, high sensitivity, good repeatability, and strong specificity. Furthermore, other components in the PCR premix have also been designed and optimized, containing PCR enhancers such as betaine, DMSO, and glycerol. Thirdly, based on the above two conditions, this invention optimizes the amplification system, employing the following reaction conditions to amplify sample DNA: denaturation at 90–100℃ for 0–5 seconds, annealing and extension at 50–70℃ for 0–5 seconds, for 35–50 cycles. In summary, the innovative design provided by this invention enables rapid PCR detection of deeply infected Aspergillus fungi, effectively shortening the amplification time and improving detection efficiency while ensuring the amplification efficiency and accuracy of the target fungal DNA, thus achieving the goal of rapid detection of deeply infected Aspergillus fungi.
[0048] Furthermore, unlike the universal primers disclosed in patent number "CN108070675A" which cannot distinguish between Aspergillus flavus, Aspergillus niger, and Aspergillus fumigatus, this method also provides a species-specific primer-probe composition capable of differentiating Aspergillus flavus, Aspergillus niger, and Aspergillus fumigatus. Based on this straight-crack extraction and PCR amplification reaction, this invention also provides a rapid kit for detecting deeply infected Aspergillus species.
[0049] The following examples illustrate specific implementations of the present invention. Of course, the scope of protection of the present invention is not limited to the following examples.
[0050] Example 1: Composition for deep infection with Aspergillus
[0051] Includes the following components:
[0052] Aspergillus flavus upstream primer (SEQ ID NO:1): TTTGAAAAGAGAGTTAA;
[0053] Aspergillus flavus downstream primer (SEQ ID NO:2): CCGGCTGAACCCTGGA;
[0054] Aspergillus probe (SEQ ID NO:3): 5`6-FAMTGAAATTGTTGAAGGGAAGCGCT-3`BHQ1;
[0055] upstream primer for Aspergillus niger (SEQ ID NO:4): GCCCGCCGGAGACCCCAACA;
[0056] downstream primer for Aspergillus niger (SEQ ID NO:5): TGAAAGTTTTAACTGATTGCAT;
[0057] Aspergillus niger probe (SEQ ID NO:6): 5`VIC-ATCAACTCAGACTGCACGCTTTCAGAC-3`BHQ1;
[0058] upstream primer for Aspergillus fumigatus (SEQ ID NO:7): CGAGCGTATGGGGCTTTGTCA;
[0059] downstream primer for Aspergillus fumigatus (SEQ ID NO:8): TGATCCGAGGTCAACCTTAG;
[0060] Aspergillus fumigatus probe (SEQ ID NO:9): 5`ROX-AATAAAGTTGGGTGTCGGCTGGCGC-3`BHQ2;
[0061] Internal standard upstream primer (SEQ ID NO:10): AGATTTGGACCTGCGAGCG;
[0062] Internal standard downstream primer (SEQ ID NO:11): GAGCGGCTGTCTCCACAAGT;
[0063] Internal standard probe (SEQ ID NO:12): 5`Cy5-TTCTGACCTGAAGGCTCTGCGCG-3`BHQ2;
[0064] Among them, the fluorescent group of the Aspergillus flavus probe shown in SEQ ID NO:3 is FAM; the fluorescent group of the Aspergillus niger probe shown in SEQ ID NO:6 is HEX; the fluorescent group of the Aspergillus fumigatus probe shown in SEQ ID NO:9 is ROX; the fluorescent group of the internal standard probe shown in SEQ ID NO:12 is CY5, and the 3' end of the probe also has a BHQ1 or BHQ2 quenching group.
[0065] In one specific embodiment (such as Example 2), the amount of primer in the composition for deep infection with Aspergillus is limited to 600 nM and the amount of probe is limited to 200 nM. Alternatively, in another specific embodiment, the amount of primer in the composition for deep infection with Aspergillus is limited to 100 nM and the amount of probe is limited to 50 nM; or the amount of primer is limited to 1000 nM and the amount of probe is limited to 800 nM.
[0066] Example 2: A method for rapid detection and typing of deep-seated Aspergillus infections
[0067] The present invention tests samples such as throat swabs, sputum, bronchoalveolar lavage fluid, and blood, and performs the following operations in the sample processing room:
[0068] (1) Add 200 μL of nucleic acid direct-crack extraction solution (tris(hydroxymethyl)aminomethane hydrochloride, sodium dodecyl sulfate and protease) to the sample, shake and resuspend, heat at 65°C for 10 min, and then heat at 95°C for 5 min to obtain DNA extract.
[0069] (2) Prepare PCR premix according to the following composition:
[0070] DNA polymerase 0.2 μL, UDG enzyme 0.5 μL, the composition of Example 1 800 nM, and nucleic acid extraction solution of step 1 4 μL.
[0071] (3) On the PCR amplification instrument, the target sequence of the gene to be tested is specifically amplified by primers and probes. The PCR amplification program is set as follows: 50℃ UDG enzyme digestion for 120s, 95℃ for 60s, 95℃ for 0s, 60℃ for 0s, for 40 cycles.
[0072] (4) Results Analysis:
[0073] 1) The target detection signals are FAM-Aspergillus flavus, HEX-Aspergillus niger, and ROX-Aspergillus fumigatus, with the internal control being the CY5 channel.
[0074] 2) Baseline settings: The baseline is generally set to 3-15 cycles, which can be adjusted according to the actual situation. The adjustment principle is: select a region where the fluorescence signal is relatively stable before exponential amplification; avoid signal fluctuations at the beginning of fluorescence acquisition; and reduce the endpoint (Ct) by 1-2 cycles compared to the earliest sample showing exponential amplification. Threshold settings: The principle is to set the threshold line so that it just exceeds the highest point of the normal negative control, generally at 1 / 3-1 / 2 of the amplification slope.
[0075] 3) First, analyze whether the internal standard has an amplification curve in the CY5 channel and Ct≤40. If so, it means that the detection is effective and subsequent analysis can be carried out.
[0076] A) If a typical S-type amplification curve is detected in the FAM channel and Ct≤40, it indicates that Aspergillus flavus is positive; if Ct>40 or there is no Ct, it is negative.
[0077] B) If a typical S-type amplification curve is detected in the VIC channel and Ct≤40, it indicates that Aspergillus niger is positive; if Ct>40 or there is no Ct, it is negative.
[0078] C) If the ROX channel detects a typical S-type amplification curve and Ct≤40, it indicates that Aspergillus fumigatus is positive; if Ct>40 or there is no Ct, it is negative.
[0079] D) If Ct is not detected in the CY5 channel or Ct > 40, it indicates that the concentration of the sample in this test is too low or there are interfering substances that inhibit the reaction, and the experiment needs to be prepared again.
[0080] F) For positive samples and bacterial cultures, internal standard test results are not required.
[0081] Example 3:
[0082] Following the operating steps and conditions of Example 2 above, one negative control, one simulated positive sample of three Aspergillus species, and one positive control were tested:
[0083] The nucleic acid extraction time was 15 minutes. During the nucleic acid amplification process, the Gentire 48E real-time fluorescence quantitative PCR instrument manufactured by Xi'an Tianlong Technology Co., Ltd. was used to amplify and detect the samples according to the amplification program in Example 2. The total amplification program time was 26 minutes, and the amplification curve is shown below. Figure 1 As shown in the left figure, the amplification curve of Example 3 maintains a good shape and has high amplification efficiency. The sample information and amplification Ct value are shown in Table 1.
[0084] Comparative Example 1:
[0085] Following the same operating steps and conditions as in Example 3, amplification was performed on the same negative control, three Aspergillus-simulated positive samples, and positive control samples, with the only difference being:
[0086] The PCR reaction conditions were set as follows: UNG enzyme 50℃ for 2 min, UNG inactivation at 94℃ for 2 min, 94℃ for 15 s, 60℃ for 30 s, for 40 cycles.
[0087] Fluorescence was acquired at 60℃ in each cycle, and the total amplification program time was 70 min. The PCR instrument used was a Gentire 48E real-time quantitative PCR instrument manufactured by Xi'an Tianlong Technology Co., Ltd. The amplification curves are shown below. Figure 1 As shown in the right figure, the sample information and amplification Ct values are shown in Table 1.
[0088] Table 1
[0089]
[0090] * Note: Ct value refers to the number of cycles required for the fluorescence signal in each reaction tube to reach the set threshold in real-time fluorescence PCR.
[0091] As shown in Table 1 above, the Ct value of Example 3 is very similar to that of Comparative Example 1, which uses traditional PCR reaction conditions. Furthermore, the Ct values of most channels are lower than those of the corresponding amplification channels under traditional PCR reaction conditions. This indicates that the effectiveness and accuracy of nucleic acid amplification in Example 3 are the same as in Comparative Example 1, but the time required is only 26 minutes, significantly less than the time required for Comparative Example 1 (70 minutes), saving nearly two-thirds of the detection time. Therefore, when performing PCR amplification on compositions deeply infected with Aspergillus, the method of this invention can significantly reduce the reaction time while achieving the same amplification efficiency under the same number of cycles. Thus, it can shorten the detection time and improve detection efficiency in clinical testing.
[0092] Example 4:
[0093] Following the operating conditions described in Example 3 above, a sample of three simulated positive Aspergillus strains was tested. The nucleic acid extraction time was 15 minutes, and the amplification detection time was 26 minutes. The amplification curve is shown below. Figure 2 As shown in Figure a, it can be seen that Example 4 has typical amplification curves in all four fluorescence channels, indicating that the sample contains three fungi: Aspergillus flavus, Aspergillus niger, and Aspergillus fumigatus. Sample information and amplification Ct values are shown in Table 2.
[0094] Comparative Example 2:
[0095] Take the same simulated sample as in Example 4, and perform nucleic acid extraction and amplification detection on the sample according to the operating conditions described in Example 3 above. The only difference is:
[0096] Nucleic acid extraction was performed using Dylan Bio's "Nucleic Acid Extraction or Purification Reagent". The nucleic acid extraction steps are as follows: digestion of viscous proteins in sputum with digestive fluid, lysis of fungi with lysis buffer, purification with DNA purification column, washing away impurities twice, and elution with elution buffer to obtain DNA from the sample. The kit has a total of 13 steps and the extraction time is about 90 minutes.
[0097] The amplification program used the same amplification reagents and procedures as in Example 3, with an amplification time of 26 minutes. The amplification curve is shown below. Figure 2 As shown in b, the sample information and amplification Ct values are shown in Table 2.
[0098] As shown in Table 2 above, the amplification Ct value of the nucleic acid extracted by the direct cleavage method of the sample in Example 4 is very similar to that of the nucleic acid extracted by the traditional column adsorption method in Comparative Example 2. Moreover, the Ct values of the ROX channel and the CY5 channel are both smaller than the Ct values of the corresponding amplification channels in the column adsorption method. This indicates that the extraction efficiency of the nucleic acid direct cleavage extraction method proposed in this invention is the same as that of the column adsorption method used in Comparative Example 2, but the time required is only 15 min, which is significantly less than the time required by Comparative Example 2 (90 min).
[0099] Comparative Example 3:
[0100] The same simulated specimen as in Example 4 was used for nucleic acid extraction using the "Nucleic Acid Extraction or Purification Reagent" from Dylan Bio. The nucleic acid extraction steps were as follows: digestion of viscous proteins in sputum with digestive fluid, lysis of fungi with lysis buffer, purification with DNA purification column, washing away impurities twice, and elution with elution buffer to obtain DNA from the sample. The kit has a total of 13 steps and the extraction time is about 90 minutes.
[0101] The *Aspergillus fumigatus*, *Aspergillus flavus*, and *Aspergillus niger* nucleic acid detection kit (fluorescent PCR method) from Hangzhou Dilan Biotechnology Co., Ltd. was used for detection. The PCR reaction conditions were set as follows: 50℃ for 2 min; 95℃ for 10 min; 95℃ for 15 s; 57℃ for 30 s, for 40 cycles. The total amplification time was 78 min. The amplification curve is shown below. Figure 2 As shown in Figure c. According to its instruction manual, the FAM channel primers and probes are for detecting three types of Aspergillus, and the HEX fluorescence channel is for detecting internal controls. Figure 2 Figure c shows that the sample exhibits amplification curves in both the FAM and HEX fluorescence channels, therefore, the sample's detection results can be categorized into three possibilities. It contains one of three Aspergillus species, but the specific species is unknown. It contains any two of the three Aspergillus species, but the specific two species are unknown. All three Aspergillus species were present. Sample information and amplified Ct values are shown in Table 2.
[0102] Table 2
[0103]
[0104] As can be seen from the detection results of Example 4 and Comparative Example 3, the nucleic acid extraction time of the sample according to the method of the present invention is 15 min and the amplification time is 26 min, while the nucleic acid extraction time of Comparative Example 3 is 90 min and the amplification time is 78 min, which significantly shortens the overall detection time. In addition, the primer and probe combination of the present invention can achieve species-level identification of the three Aspergillus species, while the primer and probe combination used in Comparative Example 3 is a universal detection primer for the three Aspergillus species, which can only indicate whether the sample contains the three Aspergillus species, but cannot achieve species-level identification.
[0105] Example 5:
[0106] Following the operating conditions of Example 3 above, the amplification curve for clinical testing of aflatoxin-positive samples is shown below. Figure 3 As shown, the amplification curve of Example 5 maintains a good morphology and has high amplification efficiency, which can effectively detect clinical samples.
[0107] Example 6: Sensitivity and Precision Study of the Composition of the Present Invention
[0108] Pure cultures of *Aspergillus flavus*, *Aspergillus niger*, and *Aspergillus fumigatus* were added to negative sputum samples at a volume of 1% to prepare single-template simulated samples with final concentrations of 200 CFU / ml, 1000 CFU / ml, and 5000 CFU / ml, respectively. Nucleic acid was extracted using a fungal nucleic acid extraction kit for PCR experiments. Each sample and each concentration was tested 20 times, and the Ct values were statistically analyzed. The results are as follows: Figure 4 As shown in the figure, the sensitivity of Aspergillus flavus, Aspergillus niger and Aspergillus fumigatus can reach at least 200 cfu / ml; the coefficient of variation (CV) of Ct values in 20 determinations of the same sample is less than 1%, indicating that this method has good precision, as shown in Table 3 below.
[0109] Table 3 Precision Results
[0110]
[0111] Example 7: Reagent Kit
[0112] The kit in this example contains the following reagents: nucleic acid extraction reagent, composition for deep infection of Aspergillus (Example 1), dNTP(U), DNA polymerase, PCR buffer, UDG enzyme, and Mg. 2+ Alternatively, one or more of the above reagents may be included in other possible embodiments, such as only nucleic acid extraction reagent and dNTP(U), or only nucleic acid extraction reagent, PCR buffer and UDG enzyme.
[0113] The nucleic acid extraction reagent mainly consists of tris(hydroxymethyl)aminomethane hydrochloride, sodium dodecyl sulfate, and protease, used to disrupt the fungal cell wall and cell membrane, releasing fungal DNA; dNTP(U) is the raw material for synthesizing double-stranded DNA, with a concentration typically of 0.2 mM; DNA polymerase uses parental DNA as a template to catalyze the polymerization of substrate dNTP molecules to form daughter DNA, and also has 5'-3' DNA exonuclease activity, which can complete probe cleavage, with a dosage typically of 0.2 μL; PCR buffer provides a buffer environment for the reaction, and its main components include tris(hydroxymethyl)aminomethane, hydrochloric acid, ammonium sulfate, and magnesium sulfate; UDG enzyme prevents PCR contamination, with a dosage typically of 0.5 μL.
[0114] The method of using the reagent kit is as described in Example 2.
[0115] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications or equivalent changes made to the above embodiments based on the technical essence of the present invention shall fall within the protection scope of the present invention.
Claims
1. A method for rapid detection and typing of deep-seated Aspergillus infections for non-diagnostic purposes, characterized in that: The sample to be tested was mixed with the nucleic acid direct-crack extraction solution and heated at 65°C for 10 min, then heated at 95°C for 5 min to obtain the DNA extract of the sample to be tested. The DNA extract was added to a PCR premix containing a composition of deeply infected Aspergillus to prepare a PCR reaction solution. The PCR reaction solution was then subjected to the following PCR amplification reaction: The target gene sequence was specifically amplified using primers and probes. The PCR amplification program was set as follows: 50℃ UDG enzyme digestion for 120s, 95℃ for 60s, 95℃ for 0s, 60℃ for 0s, for 40 cycles. The nucleic acid direct-crack extraction solution includes tris(hydroxymethyl)aminomethane hydrochloride, sodium dodecyl sulfonate, and protease; The PCR premix includes UDG enzyme, a composition for deep infection with Aspergillus, DNA polymerase, and nucleic acid cleavage extract; The composition for deep infection with Aspergillus comprises the following components: For example, the upstream primer of Aspergillus flavus shown in SEQ ID NO:1, the downstream primer of Aspergillus flavus shown in SEQ ID NO:2, and the probe of Aspergillus flavus shown in SEQ ID NO:3; For example, the upstream primer of Aspergillus niger shown in SEQ ID NO:4, the downstream primer of Aspergillus niger shown in SEQ ID NO:5, and the probe of Aspergillus niger shown in SEQ ID NO:6; For example, the upstream primer of Aspergillus fumigatus shown in SEQ ID NO:7, the downstream primer of Aspergillus fumigatus shown in SEQ ID NO:8, and the probe of Aspergillus fumigatus shown in SEQ ID NO:9; As shown in SEQ ID NO:10, the internal standard forward primer; As shown in SEQ ID NO:11, the internal standard downstream primer; And the internal standard probe as shown in SEQ ID NO:12, The amount of primer used in the composition for deep infection with Aspergillus is 600 nM; the amount of probe used in the composition for deep infection with Aspergillus is 200 nM. Results analysis: 1) The target detection signals are FAM-Aspergillus flavus, HEX-Aspergillus niger, and ROX-Aspergillus fumigatus, with the internal control being the CY5 channel; 2) Baseline settings: Set the baseline to 3-15 cycles, and set the threshold to 1 / 3-1 / 2 of the amplification slope; 3) Analyze whether the internal standard has an amplification curve in the CY5 channel, and Ct≤40. If so, the detection is valid and further analysis should be performed. A) If a typical S-type amplification curve is detected in the FAM channel and Ct≤40, it indicates that Aspergillus flavus is positive; if Ct>40 or no Ct is detected, it is negative. B) If a typical S-type amplification curve is detected in the VIC channel and Ct≤40, it indicates that Aspergillus niger is positive; if Ct>40 or there is no Ct, it is negative. C) If the ROX channel detects a typical S-type amplification curve and Ct≤40, it indicates that Aspergillus fumigatus is positive; if Ct>40 or there is no Ct, it is negative. D) If Ct is not detected in the intrinsic CY5 channel or Ct > 40, it indicates that the sample concentration is too low or there are interfering substances inhibiting the reaction, and the experiment needs to be prepared again; F) For positive samples and bacterial cultures, internal standard test results are not required.
2. The method according to claim 1, characterized in that: The PCR enhancers include betaine, DMSO, and glycerol.
3. A rapid detection kit for deep-seated Aspergillus infections, characterized in that: It includes the PCR premix solution according to any one of claims 1 to 2, and performs PCR amplification reaction according to the method of claim 1.
Citation Information
Patent Citations
Primer probe combination capable of simultaneously detecting three aspergilli and fluorogenic quantitative PCR kit
CN108070675A
Reagent set, kit and detection method for detecting fungal infection
CN109295174A
Primer probe combination for separate detection of aspergillus according to species, kit and detection method and application of combination
CN109943662A
Aspergillillus gene detecting chip and its preparing method and using method
CN1587418A