Application of SNORD15A in urinary sediment as a biomarker for early tumors

Abstract

This invention relates to the application of SNORD15A from urinary sediment as a biomarker for early tumors, belonging to the biomedical field. The biomarker is selected from urinary sediment SNORD15A; the kit includes a reverse transcription reaction system, a quantitative real-time PCR reaction system, and an internal control system. Studies have found that SNORD15A is significantly upregulated in renal cell carcinoma patients, especially those with early-stage renal cell carcinoma, in TCGA databases, paraffin-embedded samples (FFPE), and urinary sediment compared to the control group, and the difference is statistically significant. Furthermore, SNORD15A is stable in urinary sediment and is not easily degraded by enzymes, making it a potential biomarker for the diagnosis and early diagnosis of renal cell carcinoma. Receiver operating characteristic (ROC) curves show that SNORD15A has a diagnostic efficacy (AUC) of 0.7432 for renal cell carcinoma, a sensitivity of 61.8%, and a specificity of 79%; and a diagnostic efficacy (AUC) of 0.7441 for early-stage renal cell carcinoma, with a sensitivity of 54.2% and a specificity of 87.7%, confirming the potential of SNORD15A as a novel non-invasive biomarker for the diagnosis and early diagnosis of renal cell carcinoma.

Description

Technical Field

[0001] This invention relates to the application of SNORD15A in urinary sediment as a biomarker for early tumors, and belongs to the biomedical field. Background Technology

[0002] Renal cell carcinoma (RCC) is a common malignant disease of the urinary system, accounting for 85% of primary kidney malignancies. There are three main pathological types of RCC: clear cell renal cell carcinoma (ccRCC), papillary renal cell carcinoma (pRCC), and chromophobe renal cell carcinoma (chRCC). RCC develops insidiously, and patients are often unaware of its onset in its early stages. Furthermore, most people do not have the habit of early cancer screening, leading to some patients being diagnosed at an advanced stage or with metastasis, missing the optimal treatment window. Currently, tumor markers traditionally used to assist in the screening and diagnosis of RCC include carcinoembryonic antigen (CEA) and alpha-fetoprotein (AFP). However, as pan-cancer markers, their sensitivity and specificity are not ideal. Therefore, relying solely on existing markers is insufficient for early screening and diagnosis of RCC. Exfoliative cytology and histopathology remain the gold standard for diagnosing renal cell carcinoma, but these methods are invasive and can cause psychological trauma to patients. On the other hand, surgical resection is the most effective treatment for renal cell carcinoma, but overall treatment outcomes are unsatisfactory. Especially for patients with advanced stages and metastases, the five-year survival rate is very low, and their poor sensitivity to radiotherapy and chemotherapy is also a significant factor limiting the improvement of renal cell carcinoma prognosis. Therefore, there is an urgent need to find a more sensitive and specific early diagnostic biomarker for renal cell carcinoma and a more effective therapeutic target to achieve early detection, early diagnosis, and early treatment of renal cell carcinoma patients, improve their prognosis and survival, and reduce renal cell carcinoma mortality.

[0003] snoRNAs are non-coding RNAs widely distributed in eukaryotes, containing 60-300 nucleotides (nt). Multiple studies have shown that snoRNAs are expressed in mammalian tissues, plasma, serum, urine, and other body fluids. Due to their ability to bind with corresponding proteins to form small nucleolar riboprotein (snoRNP) complexes, snoRNAs are relatively stable and easily detected. Summary of the Invention

[0004] To address the current challenges and limitations in the early detection, diagnosis, and treatment of renal cell carcinoma (RCC), this invention provides a convenient, rapid, and highly specific kit for the early diagnosis of RCC. Research in this application has revealed that the expression level of SNORD15A in urinary sediment is significantly upregulated in RCC patients and those with early-stage RCC, demonstrating good diagnostic efficacy for RCC, particularly early-stage RCC.

[0005] The technical solution of this application is as follows: The application of urinary sediment SNORD15A as a biomarker for early tumors, specifically renal cell carcinoma; the nucleotide sequence of urinary sediment SNORD15A is SEQ ID No. 1, specifically: CTTCGATGAAGAGATGATGACGAGTCTGACTTGGGGATGTTCTCTTTGCCCAGGTGGCCTACTCTGTGCTGCGTTCTGTGGCACAGTTTAAAGAGCCCTGGTTGAAGTAATTTCCTAAAGATGACTTAGAGGCATTTGTCTGAGAAGG.

[0006] Preferably, the kit includes urine sediment SNORD15A; specifically, it includes a reverse transcription reaction system, a real-time PCR reaction system, and an internal control system; the real-time PCR reaction system includes a forward primer for urine sediment SNORD15A and a reverse universal primer for urine sediment SNORD15A. The nucleotide sequence of the forward primer targeting SNORD15A is SEQ ID No.2, specifically: TTCGATGAAGAGATGATGACGAGTCTG; The nucleotide sequence of the reverse universal primer for SNORD15A is SEQ ID No.3, specifically: CCACAGAACGCAGCACAGAGTAG.

[0007] Preferably, the internal reference system includes forward and reverse primers for internal reference U6; The nucleotide sequence of the forward primer for the internal reference U6 is SEQ ID No.4, specifically: TGGAACGCTTCACGAATTTGCG; The nucleotide sequence of the reverse primer for the internal reference U6 is SEQ ID No. 5, specifically: GGAACGATACAGAGAAGATTAGC.

[0008] Preferably, the reagents in the reverse transcription reaction system include polyadenylate polymerase, reverse transcriptase mixture, reverse transcription buffer, and nuclease-free double-distilled water.

[0009] The preparation method of the above reagent kit includes the following steps: (1) Extract urine sediment; (2) Extract total RNA; (3) Genomic DNA removal reaction; (4) Reverse transcription reaction; (5) Preparation before quantitative PCR amplification; (6) Real-time PCR amplification reaction; (7) Internal control system reaction (8) Data Analysis Plot fluorescence amplification curves and melting curves to obtain Ct values. Analyze the results of quantitative real-time PCR using the ΔCt method. The ΔCt value represents the relative expression level of the target RNA; the smaller the ΔCt value, the stronger the expression of the target RNA. ΔCt = Ct value of target RNA - Ct value of internal reference RNA.

[0010] The beneficial effects of this invention are: This invention is the first to propose that, compared to healthy donors, sNORD15A levels in the urinary sediment of patients with renal cell carcinoma are significantly upregulated. ROC curve analysis shows that the diagnostic efficacy (AUC) of sNORD15A in diagnosing renal cell carcinoma is 0.7432, with a sensitivity of 61.8% and a specificity of 79%. Compared to healthy donors, sNORD15A levels in the urinary sediment of patients with early-stage renal cell carcinoma are significantly upregulated. ROC curve analysis shows an AUC of 0.7441, a sensitivity of 54.2%, and a specificity of 87.7%. Attached Figure Description

[0011] Figure 1 SNORD15A expression is upregulated in FFPE renal cell carcinoma tissues; Figure 2 SNORD15A was significantly upregulated in the urine sediment of renal cell carcinoma. Figure 3 SNORD15A was significantly upregulated in the urinary sediment of early-stage renal cell carcinoma; Figure 4 ROC curve analysis of SNORD15A in urinary sediment as a diagnostic marker for renal cell carcinoma; Figure 5 ROC curve analysis of SNORD15A in urinary sediment as a diagnostic marker for early renal cell carcinoma. Detailed Implementation

[0012] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and the raw materials used are commercially available products.

[0013] Example 1 1. Experimental Design This experiment involved collecting urine samples from newly diagnosed renal cell carcinoma patients and healthy volunteers at Shandong Cancer Hospital. Urine sediment was isolated and enriched to obtain RNA from the sediment. SNORD15A expression in the urine sediment was detected using qPCR, and the differences in expression between healthy volunteers and those with renal cell carcinoma were statistically analyzed to determine its diagnostic efficacy.

[0014] 2. Patients and samples involved in the experiment Urine sediment samples from 100 patients with renal cell carcinoma were collected at the Cancer Hospital Affiliated to Shandong First Medical University, and urine sediment samples from 131 healthy volunteers were collected at the Third Provincial Hospital of Shandong.

[0015] Inclusion criteria for kidney cancer patients: A confirmed diagnosis of kidney cancer based on a combination of clinical symptoms, imaging findings, and pathological examination; no prior radiotherapy, chemotherapy, or surgical treatment prior to tissue sampling; TNM staging of kidney cancer patients according to the American Joint Committee on Cancer (AJCC) 8th edition TNM staging criteria; Grade classification according to the World Health Organization (WHO) 2016 Furman classification system. Exclusion criteria for kidney cancer patients: Prior anti-tumor treatment; concurrent presence of other tumors or metabolic diseases that may affect the results; Inclusion criteria for healthy volunteers: No tumors or other interfering diseases shown on physical examination.

[0016] 3. Determination of SNORD15A levels in urinary sediment The expression level of SNORD15A in the urinary sediment of patients with renal cell carcinoma and healthy volunteers was analyzed using qPCR. The specific steps are as follows: 3.1 Collection of urine sediment Collect 15-20 ml of morning urine from the above-mentioned renal cancer patients or healthy volunteers, centrifuge at room temperature (2000 r / min, 20 min), and discard the supernatant as much as possible; add 1 ml of PBS buffer to each urine tube to resuspend and wash the urine sediment, centrifuge under the same conditions, discard the supernatant, and store the remaining urine sediment at -80℃ for later use.

[0017] 3.2 Extraction of total RNA Add 0.5 ml of TRIzol Reagent to the urine sediment obtained by low-speed centrifugation, repeatedly pipet and let stand for 10-20 min to ensure complete lysis of the urine sediment; add 100 μL of chloroform, vortex to mix, and incubate for 10 min. Centrifuge at 12000 g at 4 ℃ for 15 min (the mixture will separate into a lower red phenol-chloroform phase, a middle layer of white flocculent matter, and an upper layer of colorless aqueous phase, with RNA distributed in the aqueous phase). Transfer the upper aqueous phase to a new RNase-free EP tube using a pipette (be careful not to aspirate the middle layer). Add 250 μL of isopropanol, incubate for 10 min, then centrifuge at 12000 g at 4 ℃ for 10 min. A white, visible RNA precipitate will appear; remove the upper liquid. Add 750 μL of 75% ethanol, vortex to mix, centrifuge at 7500 g at 4 ℃ for 5 min, wash the RNA, and remove the upper liquid. Air-dry RNA tubes for 5–10 minutes, then add 15–20 μL of RNase-free water to dissolve the RNA. Repeatedly pipette the solution and incubate in a 55–60°C water bath for 5–10 minutes to ensure complete RNA dissolution. Store the RNA sample at -80°C for later use. Analyze the sample concentration and purity using ASP-3700 software.

[0018] 3.3 Reverse transcription reaction and qPCR (1) Genomic DNA removal reaction: Reaction system: 2 μL 5×gDNA Eraser Buffer, 1 μL gDNA Eraser, 7 μL TotalRNA. Reaction conditions: 42 ℃ for 2 minutes (or room temperature for 5-30 minutes), then maintain at 4 ℃.

[0019] (2) Reverse transcription reaction: Reaction system: 10 μL reaction solution from step 1, 1 μL PrimeScript RT EnzymeMix I, 1 μL RT Primer Mix, 4 μL 5×PrimeScriptBuffer 2 (for Real Time), 4 μL LRNase Free dH2O; Reaction conditions: 37 ℃ for 15 minutes, 85 ℃ for 5 seconds, and 4℃ for maintenance.

[0020] (3) Preparation before quantitative PCR amplification Preparation of primer solution: Centrifuge at 4000 rpm for 30-60 seconds before opening the cap; then slowly open the cap, add an appropriate amount of ultrapure filtered water to dissolve the primer to a final concentration of 10 μM; after capping, shake thoroughly to mix. (4) Real-time PCR amplification reaction Amplification system: 10.0 μL SYBR Green Master Mix fluorescent dye, 0.4 μL forward primer (TTCGATGAAGAGATGATGACGAGTCTG), 0.4 μL reverse universal primer (CCACAGAACGCAGCACAGAGTAG), 2 μL cDNA solution, 7.2 μL nuclease-free water; reaction conditions: pre-denaturation at 95℃ for 30 seconds, followed by denaturation at 95℃ for 5 seconds, and amplification extension reaction at 60℃ for 30 seconds, for a total of 40 cycles; (5) Internal control system reaction The U6 gene was used as an internal reference gene. The specific reaction system was as follows: 10.0 μL SYBR Green Master Mix fluorescent dye, 0.4 μL forward primer, 0.4 μL reverse primer, 2 μL cDNA solution, and 7.2 μL nuclease-free water. The reaction conditions were: pre-denaturation at 95℃ for 30 seconds, followed by denaturation at 95℃ for 5 seconds, and amplification extension reaction at 60℃ for 30 seconds, for a total of 40 cycles. 4. Mathematical Statistical Analysis Statistical analysis was performed using SPSS 22.0 and GraphPad Prism 6.0 software. For comparisons of continuous data, if the data followed a normal distribution, parametric tests were used, and the results were expressed as mean ± standard deviation. If the data did not follow a normal distribution, nonparametric tests were used, specifically the Mann-Whitney test, and the results were expressed as median and interquartile range. The DKruskal-Wallis H test was used for comparisons between the three groups. Diagnostic combinations were established using binary logistic regression, and the SNORD15A of differential expression was determined using receiver operating characteristic (ROC) curves and the area under the curve (AUC). A p-value < 0.05 was considered statistically significant.

[0021] 5. Summary of case characteristics of renal cell carcinoma patients and their relationship with the expression level of SNORD15A in urinary sediment. Table 1 analyzes the clinical characteristics of patients with renal cell carcinoma, including age, sex, smoking and alcohol consumption, histological type, and tumor size. SNORD15A expression in urinary sediment was associated with smoking but not with age, sex, alcohol consumption, metastasis, or histological type.

[0022] Table 1. Relationship between SNORD15A expression level in urinary sediment and clinical characteristics of patients with renal cell carcinoma. 6. Differences in SNORD15A levels between healthy volunteers and renal cell carcinoma patients. To verify the expression trend of SNORD15A in renal cell carcinoma, this study included paired FFPE tissue samples from 36 patients with renal cell carcinoma. The expression level of SNORD15A in FFPE tissues of renal cell carcinoma was detected using quantitative real-time PCR. The results are as follows: Figure 1 Compared with paired adjacent normal tissues, the content of SNORD15A in renal cell carcinoma tissues was significantly increased, with a statistical significance level of P=0.0169.

[0023] 7. Differences in SNORD15A levels in urinary sediment between healthy volunteers and patients with renal cell carcinoma. We collected morning urine samples from 100 patients with renal cell carcinoma and 131 healthy volunteers, and centrifuged the urine sediment as described above. The expression level of SNORD15A was detected by q-PCR, and the results of statistical analysis are shown below. Figure 2 As expected, the trend of SNORD15A expression in renal cell carcinoma urine sediment was the same as that in renal cell carcinoma tissue, i.e., the expression level was significantly higher than that in the healthy control group, and the difference was statistically significant (P<0.0001).

[0024] Based on TNM staging, 57 early-stage renal cell carcinoma samples were identified from 100 renal cell carcinoma urine sediment samples. Quantitative real-time PCR was used to detect the expression level of SNORD15A in urine sediment samples from early-stage renal cell carcinoma patients and healthy volunteers. The results are as follows: Figure 3 As shown, compared with the control group, the expression level of SNORD15A was significantly increased in urinary sediment samples of early renal cell carcinoma (P<0.0001).

[0025] 8. ROC curve analysis of the diagnostic efficacy of SNORD15A in urinary sediment for renal cell carcinoma. To evaluate the potential efficacy of SNORD15A as a diagnostic biomarker for renal cell carcinoma, we constructed an ROC curve using Prism software and subsequently calculated its area under the curve (AUC), as well as its diagnostic sensitivity and specificity. The results are as follows: Figure 4 The diagnostic efficacy of SNORD15A was 0.7432 (AUC), with a sensitivity of 61.8% and a specificity of 79%.

[0026] 9. Diagnostic efficacy of SNORD15A in early renal cell carcinoma based on urinary sediment. To evaluate the diagnostic value of SNORD15A as a biomarker for early renal cell carcinoma, ROC curves were re-established in this study. The results are as follows: Figure 5 The results showed that SNORD15A had a diagnostic efficacy AUC of 0.7441, a sensitivity of 54.2%, and a specificity of 87.7%.

Claims

1. The application of a reagent for detecting the SNORD15A biomarker in urinary sediment in the preparation of an early renal cell carcinoma detection kit, characterized in that, The tumor is renal cell carcinoma; the nucleotide sequence of SNORD15A in the urine sediment is SEQ ID No. 1, specifically: CTTCGATGAAGAGATGATGACGAGTCTGACTTGGGGATGTTCTCTTTGCCCAGGTGGCCTACTCTGTGCTGCGTTCTGTGGCACAGTTTAAAGAGCCCTGGTTGAAGTAATTTCCTAAAGATGACTTAGAGGCATTTGTCTGAGAAGG.

2. A reagent kit for diagnosing early-stage renal cell carcinoma, characterized in that, The kit includes urine sediment SNORD15A; specifically, it includes a reverse transcription reaction system, a real-time PCR reaction system, and an internal control system; the real-time PCR reaction system includes a forward primer for urine sediment SNORD15A and a reverse universal primer for urine sediment SNORD15A. The nucleotide sequence of the forward primer targeting SNORD15A is SEQ ID No.2, specifically: TTCGATGAAGAGATGATGACGAGTCTG; The nucleotide sequence of the reverse universal primer for SNORD15A is SEQ ID No. 3, specifically: CCACAGAACGCAGCACAGAGTAG.

3. The kit for diagnosing early-stage renal cell carcinoma according to claim 2, characterized in that, The internal reference system includes forward and reverse primers for internal reference U6; The nucleotide sequence of the forward primer for the internal reference U6 is SEQ ID No.4, specifically: TGGAACGCTTCACGAATTTGCG; The nucleotide sequence of the reverse primer for the internal reference U6 is SEQ ID No. 5, specifically: GGAACGATACAGAGAAGATTAGC.

4. The kit for diagnosing early-stage renal cell carcinoma according to claim 2, characterized in that, The reagents in the reverse transcription reaction system include polyadenylate polymerase, reverse transcriptase mixture, reverse transcription buffer, and nuclease-free double-distilled water.

Images