A method and kit for detecting the key exogenous gene Cas12 in gene editing products

Abstract

This invention provides a method and kit for detecting the key exogenous gene Cas12 in gene-edited products, belonging to the field of gene-editing technology. Using the exogenous sequence of the Cas12a(Cpf1) endonuclease introduced into gene-edited cotton as the target site, this invention designs a pair of primers with high specificity and detection sensitivity. Simultaneously, it establishes a detection kit and method for detecting Cas12 specificity in gene-encoded products. The method provided by this invention features high specificity, good sensitivity, strong reproducibility, low cost, and stable and reliable detection results, making it suitable for the initial screening of exogenous genes Cas12 in gene-edited crops.

Description

Technical Field

[0001] This invention belongs to the field of gene editing technology, specifically relating to a method and kit for detecting the key exogenous gene Cas12 in gene editing products. Background Technology

[0002] Gene editing technology can effectively edit target genes, which is of great significance in biological research. [1-3] Third-generation gene editing technology, CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), is a defense system in bacteria. These repetitive sequences were first discovered in *E. coli* by Ishino et al. in 1987. [4] In 2000, Mojica et al. used computer analysis to discover that they are commonly found in bacteria. [5] The CRISPR / Cas system has become one of the most popular gene-editing technologies due to its simple vector construction process and high editing efficiency. [6] .

[0003] The complex formed by the Cas protein in the CRISPR / Cas system and the CRISPR transcript has the function of cutting DNA sequences. [7-8] CRISPR-Cas systems are broadly classified into two categories: Type 1 and Type 2. Type 1 includes types I, III, and IV, which require multiple Cas proteins. Type 2 includes types II, V, and VI, which require only a single scissor protein. [9] The common Cas9, Cas12a (Cpf1), and Cas13a all belong to type 2, but the Cas12 system is quite different from the Cas9 system. [10-11] 1. Cas12a (Cpf1) only requires CRISPR RNAs (crRNA), while Cas9 requires trans-activating crRNA (tracrRNA) in addition to crRNA. [12-14] 2. Cas12a (Cpf1) can target a wider number of sites because it can recognize proto-spacer adjacent motif (PAM) sites located at the 5' end of the target and rich in thymine nucleotides (T), while Cas9 recognizes PAM sites located at the 3' end of the target and rich in guanine nucleotides (G). 3. Cas12a (Cpf1) can produce sticky ends, while Cas9 produces blunt ends. [12,15]4. Cas9 has two structural domains, the RuvC domain and the HNH domain, while Cas12a(Cpf1) has only one RuvC-like structural domain.

[16] 5. In numerous non-target analyses, Cas9 edits at unexpected or random sites, a phenomenon not observed in the vast majority of Cas12 systems.

[17] 6. Because the CRISPR / Cpf1 system has a shorter crRNA and a smaller Cas protein, it can handle larger vector payloads, making it more suitable for multi-target editing. [10,12,18] .

[0004] As is well known, the Cas9 system has been widely used in gene-editing products, but Cas12a (Cpf1) has better adaptability, and its advantages compensate for the shortcomings of the Cas9 system. Researchers have now used Cas12a (Cpf1) for gene editing in multiple species. Some countries have already allowed the marketization of gene-editing products, but China has not yet issued regulatory policies for gene-editing products. Chinese scientists, including Academician Li Jiayang, have proposed a regulatory framework for genome editing technology, the most crucial aspect of which is whether gene-edited crops contain exogenous DNA such as endonucleases before entering the market.

[19] If exogenous nucleic acid sequences are introduced, the management strategy should be similar to that for genetically modified organisms. In 2021, my country developed a detection method for the Cas9 nuclease.

[20] However, no reports have been found on qualitative and quantitative detection methods for Cas12 endonuclease.

[0005] References

[0006] 1.Gasiunas,G.;Barrangou,R.;Horvath,P.;Siksnys,V.,Cas9-crRNAribonucleoprotein complex mediates specific DNA cleavage for adaptiveimmunity inbacteria.Proc Natl Acad Sci USA 2012,109,E2579-2586.

[0007] 2.Cong.,L.;Ran,F.A.;Cox,D.;Lin,S.;Barretto,R.;Habib,N.;Hsu,P.D.;Wu,X.;Jiang,W.;Marraffini,L.A.,et al.,Multiplex Genome Engineering Using CRISPR / Cas Systems.SCIENCE 2013,339,819-823.

[0008] 3.Terns,M.P.;Terns,R.M.,CRISPR-based adaptive immune systems.CurrOpin Microbiol 2011,14,321-327.

[0009] 4.ISHINO,Y.;HIDEO SHINAGAWA;MAKINO,K.;AMEMURA,M.;NAKATA,A.,NucleotideSequence of the iap Gene,Responsible for Alkaline Phosphatase IsozymeConversion in Escherichia coli,and Identification of the Gene Product.JOURNALOF BACTERIOLOGY 1987,169,5429-5433.

[0010] 5.Mojica,F.J.M.; C.;Soria,E.;Juez,G.,Biologicalsignificance of a family of regularly spaced repeats in the genomes ofArchaea,Bacteria and mitochondria.Molecular Microbiology 2000,36,244-246.

[0011] 6.Gong,C.;Huang,S.;Song,R.;Qi,W.,Comparative Study between theCRISPR / Cpf1(Cas12a)and CRISPR / Cas9 Systems for Multiplex Gene Editing inMaize.Agriculture 2021,11,429.

[0012] 7.Li,T.M.;Du,B.,CRISPR-Cas system and coevolution of bacteria andphages.Yi Chuan 2011,33,213-218.

[0013] 8.Zhuping,Y.;Yuan,C.;Hongjian,W.;Zhimiao,L.;Qingjing,Y.;Meiying,R.;Rongqing,W.;Guozhi,Z.;Yuejian,Y.,Application of CRISPR / Cas9Genome EditingTechnology in Plant Genetic Engineering Breeding.Molecular Plant Breeding2017,15,2647-2655.

[0014] 9.Shmakov,S.;Smargon,A.;Scott,D.;Cox,D.;Pyzocha,N.;Yan,W.;Abudayyeh,O.O.;Gootenberg,J.S.;Makarova,K.S.;Wolf,Y.I.,et al.,Diversity and evolutionofclass 2CRISPR-Cas systems.Nat Rev Microbiol 2017,15,169-182.

[0015] 10.Zetsche,B.;Heidenreich,M.;Mohanraju,P.;Fedorova,I.;Kneppers,J.;DeGennaro,E.M.;Winblad,N.;Choudhury,S.R.;Abudayyeh,O.O.;Gootenberg,J.S.,etal.,Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array.NatBiotechnol 2017,35,31-34.

[0016] 11.Swarts,D.C.;van der Oost,J.;Jinek,M.,Structural Basis for GuideRNA Processing and Seed-Dependent DNA Targeting by CRISPR-Cas12a.Molecularcell 2017,66,221-233e224.

[0017] 12.Zetsche,B.;Gootenberg,J.S.;Abudayyeh,O.O.;Slaymaker,I.M.;Makarova,K.S.;Essletzbichler,P.;Volz,S.E.;Joung,J.;van der Oost,J.;Regev,A.,et al.,Cpf1 is a single RNA-guided endonuclease of a class 2CRISPR-Cas system.Cell2015,163,759-771.

[0018] 13.Gao,Z.;Fan,M.;Das,A.T.;Herrera-Carrillo,E.;Berkhout,B.,Extinctionof all infectious HIV in cell culture by the CRISPR-Cas12a system with only asingle crRNA.Nucleic Acids Res 2020,48,5527-5539.

[0019] 14.Zaidi,S.S.-e.-A.;Mahfouz,M.M.;Mansoor,S.,CRISPR-Cpf1:ANew Tool forPlant Genome Editing.Trends in Plant Science 2017,22,550-553.

[0020] 15.Safari,F.;Zare,K.;Negahdaripour,M.;Barekati-Mowahed,M.;Ghasemi,Y.,CRISPR Cpf1 proteins:structure,function and implications for genomeediting.Cell Biosci 2019,9,36.

[0021] 16. Ju, T., Research on a novel nucleic acid fluorescence detection method based on CRISPR / Cas12a. 2021.

[0022] 17. Modrzejewski, D.; Hartung, F.; Lehnert, H.; Sprink, T.; Kohl, C.; Keilwagen, J.; Wilhelm, R., Which Factors Affect the Occurrence of Off-Target EffectsCaused by the Use of CRISPR / Cas: A Systematic Review in Plants. Front Plant Sci2020,11,574959.

[0023] 18. Wang, M.; Mao, Y.; Lu, Y.; Tao, X.; Zhu, JK, Multiplex Gene Editing in Rice Using the CRISPR-Cpf1 System. Mol Plant 2017, 10, 1011-1013.

[0024] 19. Huang, S.; Weigel, D.; Beachy, RN; Li, J., A proposed regulatory framework for genome-edited crops. Nature Genetics 2016, 48, 109-111.

[0025] 20. Lin, D.; Qian, WH; Min, Z.; Ling, WY; Fu, WX; Yun, CX; Feng, Summary of the Invention

[0026] In view of this, the purpose of this invention is to provide a detection method and kit for the key exogenous gene Cas12 in gene editing products, and to establish an effective, specific and sensitive detection method by screening detection primers.

[0027] This invention provides a detection primer for the key exogenous gene Cas12 in gene editing products, including a forward primer with a nucleotide sequence as shown in SEQ ID NO: 5 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 6.

[0028] This invention provides a detection kit for the key exogenous gene Cas12 in gene editing products, characterized by comprising the detection primers, PCR amplification buffer, dNTP mixture and Taq DNA polymerase.

[0029] Preferably, the PCR amplification buffer is a 10×PCR Buffer containing magnesium ions.

[0030] This invention provides the application of the detection primers or the detection kit in detecting CRISPR-Cas12 gene-edited plants.

[0031] Preferably, the CRISPR-Cas12 gene-edited plants include one or more of the following: cotton, rice, corn, rapeseed, and soybean, all of which have undergone CRISPR-Cas12 gene editing.

[0032] Preferably, the CRISPR-Cas12 gene-edited plant accounts for no less than 0.1% of the mass fraction of the sample to be tested.

[0033] This invention provides a method for detecting CRISPR-Cas12 gene-edited plants, comprising the following steps:

[0034] Extract genomic DNA from the sample to be tested;

[0035] Using the extracted genomic DNA as a template, a PCR reaction system was prepared using the primers to perform PCR amplification reaction and obtain PCR amplification products;

[0036] Analysis of the PCR amplification product yielded a sample containing a 271 bp DNA fragment, which was identified as a CRISPR-Cas12 gene-edited plant.

[0037] Preferably, the volume of the PCR reaction system is 25 μL: containing Mg 2+ 2.5 μL of 10×PCR Buffer, 2 μL of dNTP mixture, forward primer with a final concentration of 100–300 nmol / L, reverse primer with a final concentration of 100–300 nmol / L, 0.15 μL of 5 U / μL Taq DNA polymerase, 2 μL of 50 ng / μL DNA template, and the remainder ddH2O.

[0038] Preferably, the reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 59–63°C for 45 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 7 min; and storage at 4°C.

[0039] Preferably, the analytical method for the PCR amplification reaction products is agarose gel electrophoresis;

[0040] The agarose gel has a mass percentage of 2%.

[0041] This invention provides a primer for detecting the key exogenous gene Cas12 in gene-edited products, comprising a forward primer with the nucleotide sequence shown in SEQ ID NO: 5 and a reverse primer with the nucleotide sequence shown in SEQ ID NO: 6. Based on the Cas12 gene as a template, this invention designs a series of amplification primers, and after screening, obtains a primer pair with high specificity and detection sensitivity, providing convenience for the detection of CRISPR-Cas12 (Cpf1) gene-edited plants.

[0042] This invention provides a method for detecting CRISPR-Cas12 gene-edited plants. Based on the aforementioned detection primers, a rapid and accurate detection method has been developed. This method is beneficial for researchers in screening and identifying exogenous Cas12a (Cpf1) genes during gene-edited crop breeding. Furthermore, it can serve as an important regulatory strategy for the future commercialization of gene-edited crops, thus possessing practical significance. Simultaneously, the method provided by this invention has low requirements for equipment, is simple to operate, and low in cost, enabling accurate and convenient detection. It provides technical support for establishing a detection and identification system for gene-edited products in the future. Attached Figure Description

[0043] Figure 1 The sequence is the Cas12(Cpf1) endonuclease sequence, where the underlined parts represent the forward and reverse primer sequences.

[0044] Figure 2 The results show the primer screening results; A. Primer Cas12-1, amplified band size of 263bp. B. Primer Cas12-2, amplified band size of 354bp. C. Primer Cas12-3, amplified band size of 271bp. 1: Blank control; 2: Negative control; 3-14: Annealing temperatures set at 52, 53, 54, 56, 57, 59, 61, 63, 65, 66, 67, and 68℃ respectively; M: DNA molecular weight standard Ladder H1 (100bp-1000bp);

[0045] Figure 3The results of screening PCR reaction system and conditions for primer Cas12-3 are shown below: 1: blank control; 2: negative control; 3-7: primer concentrations of 0.1, 0.2, 0.3, 0.4 and 0.5 μmol / L, respectively.

[0046] Figure 4 The results show the specificity of gene-edited cotton detected by conventional PCR; 1: Blank control; 2: Negative control; 3: Gene-edited cotton with a mass fraction of 1%; 4: Genetically modified cotton mixture; 5: Genetically modified soybean mixture; 6: Genetically modified rice mixture; 7: Genetically modified corn mixture; 8: Genetically modified rapeseed mixture; 9: Non-gene-edited cotton; 10: Gene-edited rice;

[0047] Figure 5 The results of amplification of four different gene-edited cotton families using Cas12-3 primers were obtained.

[0048] Figure 6 The results of gene-edited cotton pedigree testing are as follows: 1: Blank control; 2: Negative control; 3: Gene-edited cotton-1; 4: Gene-edited cotton-2; 5: Gene-edited cotton-3; 6: Gene-edited cotton-4;

[0049] Figure 7 The results of the stability test of the PCR detection method for gene-edited cotton are as follows: 1: blank control; 2: negative control; 3-62: experimental results of 60 independent amplifications using gene-edited cotton DNA with a mass fraction of 0.1%. Detailed Implementation

[0050] This invention provides a detection primer for the key exogenous gene Cas12 in gene editing products, including a forward primer with a nucleotide sequence as shown in SEQ ID NO: 5 (GCGACAATTCTCCGCTATG) and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 6 (TGTGGCAGTCGTTGAGGTTA).

[0051] In this invention, multiple pairs of amplification primers were designed using the DNA sequence of the exogenous gene Cas12a (Cpf1) (GenBank: OK557998.1) as a template. PCR amplification results showed that the electrophoretic bands amplified by the detection primers protected in this invention were bright, single, and clear, with no primer dimers produced. Other primer pairs, however, produced weaker electrophoretic bands or non-specific amplification, making them unsuitable for detecting the key exogenous gene Cas12 in gene-editing products. The primers can be synthesized by a gene synthesis company.

[0052] This invention provides a detection kit for the key exogenous gene Cas12 in gene editing products, characterized by comprising the detection primers, PCR amplification buffer, dNTP mixture and Taq DNA polymerase.

[0053] In this invention, the PCR amplification buffer is preferably a 10× PCR buffer containing magnesium ions. This invention does not impose any particular restrictions on the source of the PCR amplification buffer, dNTP mixture, and Taq DNA polymerase; any source of these components well-known in the art may be used.

[0054] This invention provides the application of the detection primers or the detection kit in detecting CRISPR-Cas12 gene-edited plants.

[0055] In this invention, the CRISPR-Cas12 gene-edited plants preferably include one or more of the following: cotton, rice, corn, rapeseed, and soybean, all of which have undergone CRISPR-Cas12 gene editing. After sensitivity testing, the CRISPR-Cas12 gene-edited plants preferably account for no less than 0.1% of the mass fraction of the substance to be tested.

[0056] This invention provides a method for detecting CRISPR-Cas12 gene-edited plants, comprising the following steps:

[0057] Extract genomic DNA from the sample to be tested;

[0058] Using the extracted genomic DNA as a template, a PCR reaction system was prepared using the primers to perform PCR amplification reaction and obtain PCR amplification products;

[0059] Analysis of the PCR amplification product yielded a sample containing a 271 bp DNA fragment, which was identified as a CRISPR-Cas12 gene-edited plant.

[0060] In this invention, the volume of the PCR reaction system is preferably 25 μL: containing Mg 2+ The reagents included 2.5 μL of 10×PCR Buffer, 2 μL of dNTP mixture, forward primers with a final concentration of 100–300 nmol / L, reverse primers with a final concentration of 100–300 nmol / L, 0.15 μL of 5 U / μL Taq DNA polymerase, 2 μL of 50 ng / μL DNA template, and the remainder ddH2O. Through optimization experiments on primer concentrations, the results showed that 0.1–0.3 μmol / L could produce specific target fragments, but further increases in primer concentration led to the appearance of heterogeneous bands in the amplified fragments, failing to meet the specificity requirements.

[0061] In this invention, the preferred reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 59–63°C for 45 s, extension at 72°C for 30 s, for 35 cycles; extension at 72°C for 7 min; and storage at 4°C. Annealing temperature optimization experiments show that while specific bands can be obtained at annealing temperatures between 52 and 68°C, the amplification efficiency at excessively high (64–68°C) or excessively low (52–55°C) temperatures is lower than that at 59–63°C.

[0062] In this invention, the preferred method for analyzing the PCR amplification reaction products is agarose gel electrophoresis. The agarose gel contains 2% by mass. Agarose gel electrophoresis analysis of the reaction products has the advantages of being simple, rapid, and low-cost, while meeting the detection requirements.

[0063] The following detailed description, in conjunction with embodiments, of a detection method and kit for the key exogenous gene Cas12 in a gene editing product provided by the present invention, should not be construed as limiting the scope of protection of the present invention.

[0064] Example 1

[0065] A method for detecting the key exogenous gene Cas12a (Cpf1) in gene-editing products.

[0066] Materials and methods

[0067] 1.1 Materials

[0068] 1.1.1 Experimental Samples

[0069] Cotton (Gossypium spp.) edited with CRISPR-Cas12 (Cpf1) gene

[21] Gene-edited rice (Oryzasativa)

[22] The materials used include: Genetically modified rice mixtures: TT51-1, KF-6, KF-2, KMD-1, M12, and KF-8; genetically modified soybean (Glycine max) mixtures: 356043, 305423, CV127, MON89788, A5547-127, and A2704-12; genetically modified maize (Zea mays) mixtures: Bt11, Bt176, MON810, MON863, GA21, NK603, T25, TC1507, MON89034, MON88017, 59122, MIR604, 3272, and MON87460; and genetically modified rapeseed (Brassica). (Napaus) mixture: MS1, MS8, RF1, RF2, RF3, T45, Oxy235 and Topas19 / 2; transgenic cotton mixture: MON1445, MON531, MON15985, LLCOTTON25 and MON88913; all the above transgenic materials were purchased from the Science and Technology Development Center of the Ministry of Agriculture and Rural Affairs.

[0070] References

[0071] 21. Li, B.; Rui, H.; Li, Y.; Wang, Q.; Alariqi, M.; Qin, L.; Sun, L.; Ding, 2019,17,1862-1864.

[0072] 22. Peng, C.; Wang, H.; Xu, X.; Wang,

[0073] 1.1.2 Instruments and Equipment

[0074] KS12 biosafety cabinet (Thermo, Germany); Lab Dancer test tube shaker (IKA, Germany); 16-centrifuge micro-centrifuge (BECKMAN, USA); DK-S26 electric thermostatic water bath (Shanghai Senxin Experimental Instrument Co., Ltd., Shanghai); NANODROP 2000C nucleic acid and protein analyzer (Thermo, Germany); 96-well ultra-fast gradient PCR instrument (Biometra, Germany); Lab cycler Gradient (SensoQuest, Germany); ZF-258 fully automated gel imaging analysis system (Shanghai Jiapeng Technology Co., Ltd., Shanghai); EPS301 gel electrophoresis system (GE, USA).

[0075] 1.2 Methods

[0076] 1.2.1 Sample Preparation

[0077] The preparation method for gene-edited cotton with different mass fractions is as follows: DNA samples are prepared by mixing 100% gene-edited cotton and 100% non-gene-edited cotton in the following mass ratios: 10% (containing 10g of 100% gene-edited cotton and 90g of 100% non-gene-edited cotton), 1% (containing 10g of 10% gene-edited cotton and 90g of 100% non-gene-edited cotton), 0.1% (containing 10g of 1% gene-edited cotton and 90g of 100% non-gene-edited cotton), and 0.05% (containing 10g of 0.1% gene-edited cotton and 10g of 100% non-gene-edited cotton).

[0078] 1.2.2 DNA Extraction

[0079] Weigh 100 mg of various transgenic mixtures, non-gene-edited cotton, and gene-edited cotton powder with mass fractions of 100%, 10%, 1%, 0.1%, and 0.05%, respectively, and extract DNA using a plant DNA extraction kit, following the instructions in the manual.

[0080] 1.2.3 PCR amplification

[0081] Qualitative PCR used a 25 μL reaction system: 10×PCR Buffer (Mg 2+The final concentration of the reagents was 200 nmol / L, consisting of 2.5 μL of dNTP Mixture, 0.5 μL each of forward and reverse primers (10 μmol / L), 0.15 μL of rTaq DNA polymerase (5 U / μL), and 2 μL of DNA template (50 ng / μL). The final volume was brought to 25 μL with ddH2O. Qualitative PCR conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s; 60℃ annealing for 45 s; 72℃ extension for 30 s; the amplification reaction was repeated 35 times, with a final extension at 72℃ for 7 min; storage at 4℃.

[0082] 1.2.3.1 Primer Design and Screening

[0083] Based on the sequence of the Cas12a(Cpf1) exogenous DNA from gene-edited cotton provided by the developers, and after analyzing the Cas12a(Cpf1) endonuclease sequence, three pairs of primers were designed using Primer Premier 5.0 (see Table 1). The amplified fragment lengths analyzed by Primer Premier 5.0 were all between 260 and 360 bp. Using gene-edited cotton DNA as a template, annealing temperatures of 52, 53, 54, 56, 57, 59, 61, 63, 65, 66, 67, and 68 °C were used for screening the three pairs of primers.

[0084] Table 1. Sequence information of qualitative PCR primers

[0085]

[0086] This invention is based on the Cas12a(Cpf1) endonuclease sequence (GenBank: OK557998.1), such as Figure 1 As shown, three pairs of primers were developed using Primer Premier 5.0 for screening assays of specificity, sensitivity, and efficiency.

[0087] In the experiment, gene-edited cotton DNA containing the exogenous sequence Cas12a(Cpf1) was used as a template. The reaction system and conditions for qualitative PCR are described in 1.2.3. An annealing temperature gradient experiment was conducted to determine the optimal annealing temperature. The annealing temperatures were set to 52, 53, 54, 56, 57, 59, 61, 63, 65, 66, 67, and 68℃. PCR amplification results showed that some products amplified by primer Cas12-1 contained impurities, and a single band appeared at annealing temperatures of 59–63℃, but the band was weak. Primer Cas12-2 amplified products with many impurities, and although a single band appeared at 66–68℃, it was also weak. Primer Cas12-3 amplified products with a single and clear band, and no primer dimers were found. The amplification efficiency reached its highest at annealing temperatures of 59–63℃. Figure 2Based on the experimental results, the final primer was determined to be Cas12-3, and the amplified band size was 271 bp. The optimal annealing temperature range was 59–63℃.

[0088] 1.2.3.2 Optimization of Qualitative PCR System

[0089] Using gene-edited cotton as the optimized DNA template, primer concentrations were set to 0.1, 0.2, 0.3, 0.4, and 0.5 μmol / L, respectively. The amplification products were detected by 2% agarose gel electrophoresis; the brightest bands indicated the optimal primer concentration.

[0090] To optimize the qualitative PCR reaction system using Cas12-3 primers, optimization experiments were conducted with different primer concentrations (0.1, 0.2, 0.3, 0.4, and 0.5 μmol / L). Figure 3 The results showed that at an annealing temperature of 60℃, the amplification bands significantly strengthened with increasing primer concentration, but impurities appeared at higher primer concentrations. Considering the sensitivity and specificity of the detection method, a primer concentration of 0.3 μmol / L was determined to achieve a high amplification efficiency without impurities or primer dimers. Combined with the annealing temperature of 59–63℃ determined in the primer design and screening experiments, the reaction system and conditions for the qualitative PCR detection method were determined based on the experimental results as follows: a 25 μL reaction system consisting of 10×PCR Buffer (containing Mg...) 2+ 2.5 μL of dNTP Mixture, 0.75 μL each of forward and reverse primers (10 μmol / L), bringing the final concentration to 300 nmol / L, 0.15 μL of rTaq DNA polymerase (5 U / μL), and 2 μL of DNA template (50 ng / μL) were added to a final volume of 25 μL with ddH2O. Reaction conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s; 59–63℃ annealing for 45 s; 72℃ extension for 30 s; the amplification reaction was repeated 35 times, with a 72℃ extension for 7 min; stored at 4℃.

[0091] 1.2.3.3 Specificity Detection

[0092] PCR amplification was performed using DNA from 1% gene-edited cotton, 6 other transgenic rice varieties, 6 common transgenic soybean varieties, 14 common transgenic corn varieties, 8 common transgenic rapeseed varieties, 5 common transgenic cotton varieties, and non-gene-edited cotton as templates. The conventional PCR amplification products were electrophoresed on 2% agarose gel at 160V for 30 min, and the results were observed using a gel imaging system.

[0093] To test the specificity of the established qualitative PCR detection method, this study used DNA from mixed samples of other transgenic crops, Cas9-edited rice samples, and non-genetically edited cotton DNA as templates for PCR amplification (Xiu, WX; Lin, YJ; Qing, S.; Xiang, L.; Ming, LY; Wen, PL, Establishment of a Novel Event-specific Quantitative PCR Method for Genetically Modified Cotton (Gossypium sp.) GHB119 Detection. Journal of Agricultural Biotechnology 2014, 22, 380-388.). The experimental results are as follows: Figure 4 As shown, only 1% of the gene-edited cotton samples amplified the expected DNA fragment, while the expected band size was not amplified in the other samples, indicating that the established method for detecting Cas12a(Cpf1) exogenous sequences has high specificity. Next, four different gene-edited cotton families were amplified using Cas12-3 primers, and the experimental results are shown below. Figure 5 As shown, except for the blank control and negative control, all gene-edited cotton family samples amplified the target fragment of the expected size.

[0094] 1.2.3.4 Sensitivity Detection

[0095] DNA from gene-edited cotton with mass fractions of 100%, 10%, 1%, 0.1%, and 0.05% was used as templates for amplification using primers. The amplification products were electrophoresed on a 2% agarose gel at 160V for 30 min, and the results were observed using a gel imaging system.

[0096] In the sensitivity test of the qualitative PCR method, DNA from gene-edited cotton with mass fractions of 10%, 5%, 1%, 0.1%, and 0.05% was used as a template for qualitative PCR amplification. Figure 6 The results showed that the PCR product became weaker with decreasing DNA content in the gene-edited cotton. Even at a concentration as low as 0.05%, PCR amplification still produced bands, indicating that the sensitivity of this method could reach 0.1%. To further confirm the stable detection limit of 0.1%, 60 qualitative PCR amplifications were performed using 0.1% gene-edited cotton genomic DNA as a template. The results are as follows: Figure 7As shown, all 60 PCR runs amplified the expected DNA fragment, meeting the requirements for determining the detection limit for gene-editing components (Xiaofu, W.; Xiaoyun, C.; Qingmei, M.; Zibin, Z.; Hui, L.; Shuqing, Z.; Junfeng, X., Analysis and Quality Control for the Detection of Transgenic in FAPAS Proficiency Tests. Journal of Chinese Institute of Food Science and Technology 2016, 16, 224-230.). Therefore, the detection limit of this method can be determined to be 0.1%.

[0097] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A detection primer for a key exogenous gene Cas12a in a gene editing product, characterized in that, a forward primer comprising a nucleotide sequence as set forth in SEQ ID NO: 5 and a reverse primer comprising a nucleotide sequence as set forth in SEQ ID NO:

6.

2. A detection kit for a key exogenous gene Cas12a in a gene editing product, characterized in that, The kit comprises the detection primer of claim 1, a PCR amplification buffer, a dNTP mixture, and Taq DNA polymerase.

3. The test kit according to claim 2, characterized in that, The PCR amplification buffer is a 10x PCR Buffer containing magnesium ions.

4. Use of the detection primer of claim 1 or the detection kit of claim 2 or 3 in detecting the exogenous gene Cas12a in a CRISPR-Cas12a gene edited plant, wherein the CRISPR-Cas12a gene edited plant comprises one or more than two of CRISPR-Cas12a gene edited cotton, rice, corn, rape, soybean.

5. Use according to claim 4, characterized in that, The mass fraction of the CRISPR-Cas12a gene edited plant in the sample to be detected is not less than 0.1%.

6. A method of detecting a CRISPR-Cas12a gene edited plant, comprising, The method comprises the following steps: extracting genomic DNA of the sample to be detected; using the extracted genomic DNA as a template, preparing a PCR reaction system using the primer of claim 1 to perform a PCR amplification reaction to obtain a PCR amplification reaction product; analyzing the PCR amplification reaction product to obtain a sample of a 271 bp DNA fragment as a CRISPR-Cas12a gene edited plant.

7. The detection method according to claim 6, characterized in that, The volume of the PCR reaction system is 25 μL: Mg 2 + 10×PCR Buffer 2.5 μL, dNTP mixture 2 μL, final concentration 100-300 nmol / L forward primer, final concentration 100-300 nmol / L reverse primer, 5 U / μL r Taq DNA polymerase 0.15 μL, 50 ng / μL DNA template 2 μL, the rest of ddH2O.

8. The method of claim 6, wherein the step of detecting is characterized by, The reaction conditions are 95 ℃ pre-denaturation for 5 min; 95 ℃ denaturation for 30 s, 59 ~ 63 ℃ annealing for 45 s, 72 ℃ extension for 30 s, 35 cycles; 72 ℃ extension for 7 min; and 4 ℃ preservation.

9. The method of any one of claims 6 to 8, wherein the method further comprises, The analysis method of the PCR amplification reaction product is agarose gel electrophoresis. The mass percentage of the agarose gel is 2%.

Images