Construction method, structure and application of enzyme-free and label-free DNA logic gate

Abstract

The present invention discloses a construction method, construction structure and application of an enzyme-free, label-free, efficient DNA logic gate, including constructing an enzyme-free, label-free DNA sensing system, constructing AND, OR and NOR type DNA logic gates; constructing an electrochemical sensing interface for multiple logic gate detection of miRNA and methylated DNA. The enzyme-free, label-free, efficient DNA logic gate of the present invention uses a toehold-mediated DNA strand displacement reaction to achieve accurate recognition of miRNA and methylated DNA, and constructs an AND, OR and NOR type logic gate electrochemical sensing platform by in-situ synthesized silver nanoclusters to catalyze the reduction of H2O2, which has important guiding significance and application value for the early diagnosis of related diseases.

Description

Technical Field

[0001] The present invention relates to the field of electrochemical biosensors, and in particular to a construction method, a construction structure and an application of an enzyme-free and label-free DNA logic gate. Background Art

[0002] In recent years, logical operations have received extensive attention from scientific researchers in research directions such as molecular computing, intelligent diagnosis, and multiplexed sensor detection. Given that DNA has excellent sequence controllability, recognition ability, and easy programming, it is suitable as a basic material for building logic gates. It is widely used in molecular computing, nanomachine construction, marker detection, and disease diagnosis. The development potential and future application prospects of DNA logic gates and their operations are gradually emerging. Existing DNA logic gates are mainly based on protease action or DNA tile technology for calculation, but these methods have the disadvantages of requiring covalent labeling of signal molecules, complex design, and cumbersome operation. Therefore, there is an urgent need to develop an enzyme-free, label-free DNA logic gate.

[0003] Metal nanoclusters, represented by gold, silver, copper, and platinum nanoclusters (Au, Ag, Cu, Pt NCs), have excellent optical, catalytic, chiral, magnetic, and electrochemical properties. Among them, silver nanoclusters (AgNCs) have good conductivity, catalytic performance, and biocompatibility, and are therefore widely used in biomedicine, chemistry, and analytical sensing. Silver nanoclusters have a good catalytic effect on hydrogen peroxide, and their performance depends largely on factors such as the structure, size, and dispersibility of the material. Therefore, the preparation method is crucial to the catalytic performance of silver nanoclusters. Studies have shown that cytosine bases can selectively bind to silver ions, and then cytosine-rich DNA chains can be used as templates to synthesize silver nanoclusters with good stability and dispersibility. Therefore, in situ synthesis of silver nanoclusters using DNA as a template on the sensing interface and catalytic detection of hydrogen peroxide can avoid complex signal labeling processes and improve the sensitivity of detection. In addition, the toehold-mediated strand displacement reaction is a reaction that uses the unpaired region (toehold) as a fulcrum to displace one or more previously hybridized DNA chains based on the hybridization of two completely complementary or partially complementary DNA chains. This reaction has high specificity and does not require the participation of any enzymes, thereby reducing detection costs and further improving sensor performance. Therefore, the use of toehold-mediated strand displacement reactions to achieve precise identification, combined with the in-situ synthesis of nanoclusters to amplify detection signals, is expected to build enzyme-free, label-free, and efficient DNA logic gates. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a construction method, construction structure and application of an enzyme-free and label-free DNA logic gate, which utilizes toehold-mediated strand displacement reaction to achieve precise identification, combines in situ synthesis of nanoclusters to amplify the detection signal, and realizes the sensing analysis of miRNA 122 and methylated DNA.

[0005] In order to solve the above technical problems, the technical solution of the present invention is: a method for constructing an enzyme-free, label-free DNA logic gate, and its innovation lies in: the method for constructing an enzyme-free, label-free DNA logic gate comprises the following steps:

[0006] Step S1: firstly, the fixed probe IP1, the fixed probe IP2 and the auxiliary probe AP are mixed, and then annealed and hybridized to obtain a V-shaped composite probe VP; wherein the sequence of the fixed probe IP1 is 5′-(CH 2 ) 6 -SH-TTTTTTCAATGGTGTTTG-3′, the sequence of the fixed probe IP2 is 5′-GGTGACAAGCGACGAAGCAGTTTTTT-(CH 2 ) 6 -SH-3′, and the sequence of the auxiliary probe AP is 5′-CAAACACCATTGTTTTCTGCTTCGTCGCTTGTCACCACCTA-3′;

[0007] Step S2: pre-treating the gold electrode, then fixing the V-shaped composite probe VP to the pre-treated surface of the gold electrode, and sealing with mercaptohexanol MCH to obtain MCH / VP / AuE, wherein the MCH / VP / AuE is used as a sensing substrate for a DNA logic gate;

[0008] Step S3: hybridize the miRNA, methylated DNA and the ligation probe LP, and then dropwise add them to the MCH / VP / AuE interface obtained in step S2 for reaction;

[0009] Wherein, the sequence of the miRNA 122 is 5′-UCAUCGGAGCUCACACUCCA-3′, the sequence of the methylated DNA is 5′-TAGGTGGTGACAAGCGACGAAGCAGGCTCCGATGA-3′, and the sequence of the ligation probe LP is TCATCGGAGCTCACACTCCA;

[0010] Step S4: after the interface reaction in step S3 is completed, the signal probe SP is added for hybridization, after the hybridization is completed, 100 μM silver nitrate is added for incubation, and after the incubation, the mixture is rinsed, and after the rinse is completed, 500 μM sodium borohydride is dropped to synthesize silver nanoclusters in situ;

[0011] Wherein, the sequence of the signal probe SP is 5′-CAAACACCATTGCCCCCCCCCCCC-3′.

[0012] Preferably, in step S1, the mixing ratio of the fixed probe IP1, the fixed probe IP2 and the auxiliary probe AP is 1:1:1.

[0013] Preferably, the annealing hybridization treatment in step S1 is that the fixed probe IP1, the fixed probe IP2 and the auxiliary probe AP are mixed and heated at 95° C. for 10 minutes, and then cooled to 25° C. at a rate of 1° C. / min.

[0014] Preferably, the pretreatment of the gold electrode in step S2 is as follows: first, the gold electrode is immersed in a piranha solution for half an hour, polished with alumina powder, and ultrasonically treated in distilled water and ethanol in sequence; then, the gold electrode is placed in a 0.5MH 2 SO 4 solution and electrochemically scanned in the range of -0.3 to 1.55 V until a stable cyclic voltammetry curve is obtained; then, the V-shaped composite probe VP is reacted with tri(2-carboxyethyl)phosphine for 60 minutes to open the disulfide bond, and then dripped onto the treated AuE surface, incubated for 12 hours under light-proof conditions, and after rinsing, mercaptohexanol MCH is dripped onto the sensing interface for sealing for 2 hours to obtain MCH / VP / AuE.

[0015] Preferably, the piranha solution is a mixture of concentrated sulfuric acid and hydrogen peroxide, wherein the concentrated sulfuric acid is 98% H 2 SO 4 , the hydrogen peroxide is 30% H 2 O 2 , and the volume ratio of the concentrated sulfuric acid to the hydrogen peroxide is 3:1.

[0016] Preferably, the alumina powder polishing is performed at least twice, including a rough polishing and a fine polishing. The rough polishing is performed using alumina powder with a diameter of 0.3 μm, and the fine polishing is performed using alumina powder with a diameter of 0.05 μm.

[0017] Preferably, in step S3, miRNA 122, methylated DNA and ligation probe LP are hybridized at room temperature for 2 hours, and then dripped onto the electrode surface to react with MCH / VP / AuE for 90 minutes.

[0018] Preferably, in step S4, the signal probe SP is added to the electrode surface for hybridization reaction for 60 minutes, then 100 μM silver nitrate is added for incubation for half an hour, and after washing, 500 μM sodium borohydride is added to the sensing interface for reaction for 5 minutes.

[0019] The construction structure of the enzyme-free and label-free DNA logic gate uses the enzyme-free and label-free DNA logic gate construction method. The construction structure of the enzyme-free and label-free DNA logic gate is a DNA logic gate obtained by using the enzyme-free and label-free DNA logic gate construction method.

[0020] The application of the enzyme-free and label-free DNA logic gate adopts the construction structure of the enzyme-free and label-free DNA logic gate. The application of the enzyme-free and label-free DNA logic gate is the application of the DNA logic gate in miRNA122 and methylated DNA sensing.

[0021] The advantages of the present invention are as follows: compared with the prior art, the present invention utilizes toehold-mediated strand displacement reaction to achieve accurate identification, combines the in-situ synthesis of nanoclusters to catalyze hydrogen peroxide reduction, realizes multiple logic gate sensing analysis of miRNA 122 and methylated DNA, and provides an enzyme-free, label-free, efficient DNA logic gate construction method, construction structure and application. The enzyme-free, label-free, efficient DNA logic gate of the present invention constructs an AND, OR and NOR type logic gate electrochemical sensing platform by in-situ synthesis of silver nanoclusters to catalyze the reduction of H 2 O 2, which has important guiding significance and application value for the early diagnosis of related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0023] Figure 1 It is a schematic diagram of the principle of a construction method of an enzyme-free and label-free DNA logic gate, a construction structure and an enzyme-free and label-free DNA sensing system in application of the present invention;

[0024] Figure 2 The present invention discloses a method for constructing an enzyme-free and label-free DNA logic gate, a construction structure, and the principle and characterization diagram of an AND-type DNA logic gate in its application: A, schematic diagram of an AND logic gate; B, characterization diagram of polyacrylamide gel electrophoresis; C, characterization diagram of differential pulse voltammetry; D, truth table of an AND-type logic gate;

[0025] Figure 3 The present invention discloses a method for constructing an enzyme-free and label-free DNA logic gate, a construction structure, and a principle and characterization diagram of an OR-type DNA logic gate in application: A, schematic diagram of an OR-type logic gate; B, characterization diagram of polyacrylamide gel electrophoresis; C, characterization diagram of differential pulse voltammetry; D, truth table of an OR-type logic gate;

[0026] Figure 4 The present invention discloses a method for constructing an enzyme-free and label-free DNA logic gate, a construction structure, and the principle and characterization diagram of a NOR-type DNA logic gate in application: A, schematic diagram of a NOR-type logic gate; B, characterization diagram of polyacrylamide gel electrophoresis; C, characterization diagram of differential pulse voltammetry; D, truth table of a NOR-type logic gate. DETAILED DESCRIPTION

[0027] The method for constructing an enzyme-free and label-free DNA logic gate of the present invention comprises the following steps:

[0028] Step S1: firstly, the fixed probe IP1, the fixed probe IP2 and the auxiliary probe AP are mixed, and then annealed and hybridized to obtain a V-shaped composite probe VP;

[0029] Among them, the sequence of the fixed probe IP1 is 5′-(CH 2 ) 6 -SH-TTTTTTCAATGGTGTTTG-3′, the sequence of the fixed probe IP2 is 5′-GGTGACAAGCGACGAAGCAGTTTTTT-(CH 2 ) 6 -SH-3′, and the sequence of the auxiliary probe AP is 5′-CAAACACCATTGTTTTCTGCTTCGTCGCTTGTCACCACCTA-3′;

[0030] Step S2: pre-treat the gold electrode, then fix the V-shaped composite probe VP to the pre-treated surface of the gold electrode, and seal it with mercaptohexanol MCH to obtain MCH / VP / AuE, and MCH / VP / AuE is used as the sensing substrate of the DNA logic gate;

[0031] Step S3: hybridize the miRNA, methylated DNA and the ligation probe LP, and then dropwise add them to the MCH / VP / AuE interface obtained in step S2 for reaction;

[0032] Among them, the sequence of miRNA 122 is 5′-UCAUCGGAGCUCACACUCCA-3′, the sequence of methylated DNA is 5′-TAGGTGGTGACAAGCGACGAAGCAGGCTCCGATGA-3′, and the sequence of the ligation probe LP is TCATCGGAGCTCACACTCCA;

[0033] Step S4: After the interface reaction in step S3 is completed, the signal probe SP is added for hybridization. After the hybridization is completed, 100 μM silver nitrate is added for incubation, and the mixture is rinsed after incubation. After the rinse is completed, 500 μM sodium borohydride is dropped to synthesize silver nanoclusters in situ; wherein the sequence of the signal probe SP is 5′-CAAACACCATTGCCCCCCCCCCCC-3′.

[0034] The present invention utilizes toehold-mediated strand displacement reaction to achieve accurate identification, and combines the in-situ synthesis of nanoclusters to catalyze hydrogen peroxide reduction to achieve multiple logic gate sensing analysis of miRNA 122 and methylated DNA, providing a method, structure and application of enzyme-free and label-free efficient DNA logic gates. The enzyme-free and label-free efficient DNA logic gates of the present invention, through in-situ synthesis of silver nanoclusters to catalyze the reduction of H 2 O 2, construct an AND, OR and NOR type logic gate electrochemical sensing platform, which has important guiding significance and application value for the early diagnosis of related diseases.

[0035] In the above step S1, the mixing ratio of fixed probe IP1, fixed probe IP2 and auxiliary probe AP is 1:1:1. Annealing hybridization treatment is that fixed probe IP1, fixed probe IP2 and auxiliary probe AP are mixed and heated at 95°C for 10 minutes, and then cooled to 25°C at a speed of 1°C / min.

[0036] The pretreatment of the gold electrode in the above step S2 is as follows: first, the gold electrode is immersed in a piranha solution for half an hour, and polished with alumina powder, wherein the alumina powder polishing is at least twice, including a rough polishing and a fine polishing, the rough polishing is performed with alumina powder with a diameter of 0.3 μm, and the fine polishing is performed with alumina powder with a diameter of 0.05 μm; then, ultrasonic treatment is performed in distilled water and ethanol in sequence. Then, the gold electrode is placed in a 0.5MH 2 SO 4 solution and electrochemical scanning is performed in the range of -0.3 to 1.55V until a stable cyclic voltammetry curve is obtained, wherein the piranha solution is a mixture of concentrated sulfuric acid and hydrogen peroxide, wherein the concentrated sulfuric acid is 98% H 2 SO 4, the hydrogen peroxide is 30% H 2 O 2, and the volume ratio of the concentrated sulfuric acid to the hydrogen peroxide is 3:1. The V-shaped composite probe VP was then reacted with tri(2-carboxyethyl)phosphine for 60 minutes to open the disulfide bond, and then dropped onto the treated AuE surface and incubated for 12 hours in the dark. After rinsing, mercaptohexanol MCH was dropped onto the sensing interface for sealing for 2 hours to obtain MCH / VP / AuE.

[0037] In the above step S3, miRNA 122, methylated DNA and connection probe LP were hybridized at room temperature for 2 hours, and then added to the electrode surface to react with MCH / VP / AuE for 90 minutes. In the above step S4, signal probe SP was added to the electrode surface for hybridization reaction for 60 minutes, followed by adding 100 μM silver nitrate for incubation for half an hour, and then 500 μM sodium borohydride was added to the sensing interface for reaction for 5 minutes after washing.

[0038] The construction structure of the enzyme-free and label-free DNA logic gate is a DNA logic gate obtained by using the construction method of the enzyme-free and label-free DNA logic gate. The application of the enzyme-free and label-free DNA logic gate is the application of the DNA logic gate in miRNA 122 and methylated DNA sensing.

[0039] The specific principles are as follows:

[0040] like Figure 1As shown in the figure, the V-shaped composite probe VP prepared in advance is first self-assembled onto the surface of the gold electrode through the Au-S bond, and then blocked with MCH to obtain the sensing interface MCH / VP / AuE. At the same time, miRNA122 and methylated DNA are used as input 1 (T1) and input 2 (T2), and the two ends of the connecting probe LP are hybridized with T1 and T2 respectively to form a double-stranded complex. The complex first hybridizes with the auxiliary probe AP through the toehold chain displacement reaction of T1 to release the fixed probe IP1. At the same time, the hybridization causes T2 to displace the fixed probe IP2 through the chain migration reaction. Then the signal probe SP is added. The signal probe SP is rich in cytosine sequences. Cytosine can coordinate with silver ions. After adding the reducing agent sodium borohydride, AgNCs can be obtained. AgNCs has good catalytic performance for hydrogen peroxide to achieve catalytic reduction of H 2 O 2, thereby providing a significantly enhanced electrochemical signal for the sensor and realizing the sensing analysis of miRNA 122 and methylated DNA.

[0041] Principle and characterization of AND-type DNA logic gate: MCH / VP / AuE was used as the sensing substrate for AND-type DNA logic gate analysis. When the interface had no input or only methylated DNA was input, the MCH / VP / AuE interface was incubated with the connection probe LP, and the V-type composite probe VP did not change. When miRNA 122 was input, the connection probe LP hybridized with the V-type composite probe VP probe through miRNA 122, but the signal probe SP could not complete hybridization. Only when miRNA 122 and methylated DNA were input at the same time, the fixed probe IP2 leaked out and hybridized with the signal probe SP, and the AgNCs synthesized in situ achieved catalytic reduction of H 2 O 2 .

[0042] First, the principle of AND logic gate is verified by polyacrylamide electrophoresis experiment. Figure 2 As shown in B, VP (band 1) shows a clear band. After adding the connection probe LP (band 2), the V-type composite probe VP band does not change significantly. Further adding miRNA 122 (band 3), miRNA 122 hybridizes with the V-type composite probe VP to displace the fixed probe IP2 probe, and at the same time obtains a double-stranded complex, the molecular weight of which increases, showing a relatively low mobility. After adding methylated DNA (band 4), the V-type composite probe VP band does not change significantly, because methylated DNA cannot directly hybridize with the V-type composite probe VP. When miRNA 122 and methylated DNA are added at the same time (band 5), the V-type composite probe VP band disappears, and a new bright band appears, indicating that miRNA 122 and methylated DNA hybridize with the V-type composite probe VP, the molecular weight of the obtained complex further increases, and its electrophoretic migration rate further decreases.

[0043] Then the feasibility of AND-type logic gate is analyzed by differential pulse voltammetry technique. Figure 2 As shown in Figure C, the MCH / VP / AuE interface does not show an obvious peak current signal (curve a), indicating that the interface has no obvious catalytic activity for H 2 O 2 . When miRNA 122 (curve b) or methylated DNA (curve c) is added alone, the peak current does not change significantly when MCH / VP / AuE is incubated with the linked probe LP. Only when miRNA 122 and methylated DNA are present at the same time (curve d), the sensing interface can obtain a significantly enhanced current signal.

[0044] The above results indicate that this system can realize AND-type logic gate analysis of miRNA 122 and methylated DNA. Figure 2 D is the truth table of the logic gate.

[0045] Principle and characterization of OR-type DNA logic gate: Based on the AND-type DNA logic gate, toehold sequences are introduced at both ends of the AP chain, and two signal probes SP (signal probe SP1 and signal probe SP2) are introduced. Signal probes SP1 and signal probes SP2 can hybridize with fixed probes IP1 and IP2, respectively. When there is no input at the interface, the MCH / VP / AuE interface does not react with the connection probe LP. When only miRNA 122 is input, miRNA 122 hybridizes with the V-type composite probe VP, releasing the fixed probe IP1 to hybridize with the signal probe SP1, and further synthesizing AgNCs to achieve catalytic reduction of H 2 O 2. Similarly, when only methylated DNA is input, the V-type composite probe VP is opened to release the fixed probe IP2 to hybridize with the signal probe SP2, and an enhanced electrochemical signal can be obtained. When miRNA 122 and methylated DNA are input at the same time, the fixed probes IP1 and IP2 hybridize with the signal probes SP1 and SP2, respectively, and an enhanced electrochemical signal is obtained by synthesizing AgNCs in situ.

[0046] First, the principle of OR logic gate is verified by polyacrylamide electrophoresis experiment. Figure 3As shown in Figure B, the V-type composite probe VP (band 1) presents a clear band. After the connection probe LP is added (band 2), the V-type composite probe VP band does not change significantly. Further adding miRNA 122 (band 3), miRNA 122 hybridizes with the V-type composite probe VP to displace the fixed probe IP1 probe, and a double-stranded complex is obtained at the same time. The molecular weight of the complex increases and shows a relatively low mobility. At the same time, after adding methylated DNA (band 4), the V-type composite probe VP band disappears significantly, because the methylated DNA can directly hybridize with the V-type composite probe VP. When miRNA 122 and methylated DNA are added at the same time (band 5), a new bright band appears, indicating that miRNA 122 and methylated DNA hybridize with the V-type composite probe VP, the molecular weight of the obtained complex is further increased, and its electrophoretic migration rate is further reduced.

[0047] Then the feasibility of OR-type logic gate is analyzed by differential pulse voltammetry technique. Figure 3 As shown in Figure C, the MCH / VP / AuE interface does not show an obvious peak current signal (curve a), indicating that the interface has no obvious catalytic activity for H 2 O 2 . When miRNA 122 (curve b) or methylated DNA (curve c) is added alone, the peak current is significantly enhanced when MCH / VP / AuE is incubated with the connection probe LP. And when miRNA 122 and methylated DNA are present at the same time (curve d), the sensing interface can obtain a significantly enhanced current signal.

[0048] The above results indicate that this system can realize OR-type logic gate analysis of miRNA 122 and methylated DNA. Figure 3 D is the truth table of the logic gate.

[0049] Principle and characterization of NOR-type DNA logic gate: Based on the AND-type DNA logic gate, the ligation probe LP needle is designed to perform a strand displacement reaction to open the V-type composite probe VP. T1 and T2 can hybridize with the ligation probe LP to hinder the hybridization of the ligation probe LP and the V-type composite probe VP. When there is no input at the interface, the V-type composite probe VP hybridizes with the ligation probe LP, releasing the fixed probe IP2 to hybridize with the signal probe SP, and further synthesizing AgNCs to achieve catalytic reduction of H 2 O 2. When only miRNA 122 is input, miRNA 122 hybridizes with the 3′ end of the ligation probe LP probe, so that the toehold closure of the ligation probe LP cannot hybridize with the V-type composite probe VP, that is, AgNCs cannot be synthesized. When only methylated DNA is input, it hybridizes with the 5′ end of the ligation probe, and the ligation probe also cannot hybridize with the V-type composite probe VP. And when miRNA 122 and methylated DNA are input at the same time, MCH / VP / AuE does not react.

[0050] First, the operation principle of NOR logic gate is verified by polyacrylamide electrophoresis experiment. Figure 4 As shown in B, the V-type composite probe VP (band 1) presents a clear band. After adding the connection probe LP (band 2), the V-type composite probe VP and the connection probe LP hybridize to present a new band. When miRNA 122 is added (band 3), the V-type composite probe VP band remains unchanged, and miRNA122 hybridizes with the connection probe LP to obtain a new band with higher mobility. After adding methylated DNA (band 4), the V-type composite probe VP band remains unchanged, and the methylated DNA hybridizes with the connection probe LP to obtain a high-mobility band. When miRNA 122 and methylated DNA are added at the same time (band 5), the V-type composite probe VP band is clearly visible. After miRNA122 and methylated DNA hybridize with the connection probe LP at the same time, a new bright band is presented, and its molecular weight is further increased, and the electrophoretic migration rate is reduced.

[0051] Then the feasibility of NOR logic gate is analyzed by differential pulse voltammetry. Figure 4 As shown in Figure C, when there is no input at the interface (curve a), the MCH / VP / AuE interface can be incubated with the connection probe LP to achieve in situ synthesis of AgNCs and obtain a higher current signal. When miRNA 122 (curve b) or methylated DNA (curve c) is input alone, miRNA 122 and methylated DNA hybridize with the connection probe LP, and MCH / VP / AuE does not change significantly. Similarly, when miRNA122 and methylated DNA are input at the same time (curve d), the connection probe LP cannot hybridize with the V-shaped composite probe VP, that is, AgNCs cannot be synthesized, and a weak current signal is obtained.

[0052] The above results indicate that this system can realize NOR-type logic gate analysis of miRNA 122 and methylated DNA. Figure 4 D is the truth table of the logic gate.

[0053] It should be noted that in the description of this specification, the terms are only used for descriptive purposes and to distinguish similar objects. There is no order of precedence between the two, and they cannot be understood as indicating or implying relative importance. In addition, in the description of this specification, unless otherwise specified, the meaning of "multiple" is two or more.

[0054] Any numerical value quoted herein includes all values ​​of the lower and upper values ​​with one unit increment from the lower limit to the upper limit, and there is at least two units between any lower value and any higher value. These are just examples intended to be clearly expressed, and it can be considered that all possible combinations of numerical values ​​listed between the lowest value and the highest value are clearly stated in this specification in a similar manner.

[0055] It should be understood that the above description is for illustration and not for limitation. Many embodiments and many applications beyond the examples provided will be apparent to those skilled in the art upon reading the above description. Therefore, the scope of the present teachings should not be determined with reference to the above description, but should be determined with reference to the appended claims and the full scope of equivalents possessed by such claims. For the purpose of comprehensiveness, all articles and references, including disclosures of patent applications and publications, are incorporated herein by reference. The omission of any aspect of the subject matter disclosed herein in the preceding claims is not intended to be a waiver of the subject matter, nor should it be considered that the inventors did not consider the subject matter to be part of the disclosed inventive subject matter.

Claims

1. A method for constructing an enzyme-free, label-free DNA logic gate, characterized in that: The method for constructing the enzyme-free and label-free DNA logic gate comprises the following steps: Step S1: first, the fixed probe IP1, the fixed probe IP2 and the auxiliary probe AP are mixed, and then annealed and hybridized to obtain a V-shaped composite probe VP; wherein the sequence of the fixed probe IP1 is 5ʹ-(CH2)6-SH-TTTTTTCAATGGTGTTTG-3ʹ, the sequence of the fixed probe IP2 is 5ʹ-GGTGACAAGCGACGAAGCAGTTTTTT-(CH2)6-SH-3ʹ, and the sequence of the auxiliary probe AP is 5ʹ-CAAACACCATTGTTTTCTGCTTCGTCGCTTGTCACCACCTA-3ʹ; Step S2: pre-treating the gold electrode, then fixing the V-shaped composite probe VP to the pre-treated surface of the gold electrode, and sealing with mercaptohexanol MCH to obtain MCH / VP / AuE, wherein the MCH / VP / AuE is used as a sensing substrate for a DNA logic gate; Step S3: hybridize the miRNA, methylated DNA and the ligation probe LP, and then dropwise add them to the MCH / VP / AuE interface obtained in step S2 for reaction; Wherein, the sequence of the miRNA is 5ʹ-UCAUCGGAGCUCACACUCCA-3ʹ, the sequence of the methylated DNA is 5ʹ-TAGGTGGTGACAAGCGACGAAGCAGGCTCCGATGA-3ʹ, and the sequence of the ligation probe LP is TCATCGGAGCTCACACTCCA; Step S4: After the interface reaction in step S3 is completed, the signal probe SP is added for hybridization, and after the hybridization is completed, 100 μM silver nitrate is added for incubation, and then rinsed after incubation. After the rinsing is completed, 500 μM sodium borohydride is dropped to synthesize silver nanoclusters in situ; Wherein, the sequence of the signal probe SP is 5ʹ-CAAACACCATTGCCCCCCCCCCCC-3ʹ.

2. The method for constructing an enzyme-free, label-free DNA logic gate according to claim 1, characterized in that: In the step S1, the mixing ratio of the fixed probe IP1, the fixed probe IP2 and the auxiliary probe AP is 1:1:

1.

3. The method for constructing an enzyme-free, label-free DNA logic gate according to claim 1, characterized in that: In the step S1, the annealing hybridization treatment is to heat the fixed probe IP1, the fixed probe IP2 and the auxiliary probe AP at 95°C for 10 minutes after mixing, and then cool down to 25°C at a rate of 1°C / min.

4. The method for constructing an enzyme-free, label-free DNA logic gate according to claim 1, characterized in that: The pretreatment of the gold electrode in step S2 is as follows: first, the gold electrode is immersed in a piranha solution for half an hour, polished with alumina powder, and ultrasonically treated in distilled water and ethanol in sequence; then, the gold electrode is placed in a 0.5 M H2SO4 solution and electrochemically scanned in the range of −0.3 to 1.55 V until a stable cyclic voltammetry curve is obtained; then, the V-type composite probe VP is reacted with tri(2-carboxyethyl)phosphine for 60 minutes to open the disulfide bond, and then dripped onto the treated AuE surface, incubated for 12 hours under light-proof conditions, and after rinsing, mercaptohexanol MCH is dripped onto the sensing interface for sealing for 2 hours to obtain MCH / VP / AuE.

5. The method for constructing an enzyme-free, label-free DNA logic gate according to claim 4, characterized in that: The piranha solution is a mixture of concentrated sulfuric acid and hydrogen peroxide, wherein the concentrated sulfuric acid is 98% H2SO4, the hydrogen peroxide is 30% H2O2, and the volume ratio of the concentrated sulfuric acid to the hydrogen peroxide is 3:

1.

6. The method for constructing an enzyme-free, label-free DNA logic gate according to claim 4, characterized in that: The alumina powder polishing is performed at least twice, including a rough polishing and a fine polishing. The rough polishing is performed using alumina powder with a diameter of 0.3 µm, and the fine polishing is performed using alumina powder with a diameter of 0.05 µm.

7. The method for constructing an enzyme-free, label-free DNA logic gate according to claim 1, characterized in that: In step S3, the miRNA, methylated DNA and the connection probe LP are hybridized at room temperature for 2 hours, and then dropped onto the electrode surface to react with MCH / VP / AuE for 90 minutes.

8. The method for constructing an enzyme-free, label-free DNA logic gate according to claim 1, characterized in that: In step S4, the signal probe SP is added to the electrode surface for hybridization reaction for 60 minutes, and then 100 μM silver nitrate is added for incubation for half an hour. After washing, 500 μM sodium borohydride is added to the sensing interface for reaction for 5 minutes.

9. A structure for constructing an enzyme-free, label-free DNA logic gate, using the method for constructing an enzyme-free, label-free DNA logic gate as claimed in any one of claims 1 to 8, characterized in that: The construction structure of the enzyme-free and label-free DNA logic gate is a DNA logic gate obtained by adopting the construction method of the enzyme-free and label-free DNA logic gate.

10. Application of an enzyme-free, label-free DNA logic gate, using the construction structure of the enzyme-free, label-free DNA logic gate as claimed in claim 9, characterized in that: The application of the enzyme-free and label-free DNA logic gate is the application of the DNA logic gate in miRNA and methylated DNA sensing.

Images