A mutant of glycerol phosphate oxidase and its use

Abstract

The present application relates to the field of biotechnology, and specifically, to a mutant of glycerol phosphate oxidase and its use. The present application provides a mutant of glycerol phosphate oxidase (GPO), wherein the amino acid sequence of the mutant of glycerol phosphate oxidase is relative to the amino acid sequence of the wild-type glycerol phosphate oxidase, and the amino acid at position 426, position 236, position 102 or position 168 is mutated to cysteine, forming a disulfide bond to stabilize the protein conformation. The mutant of glycerol phosphate oxidase provided by the present application can effectively improve the stability of glycerol phosphate oxidase in Escherichia coli, and help solve the problem of instability and inactivation of GPO during clinical application.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a mutant of glycerol phosphate oxidase and uses thereof. Background Art

[0002] Glycerol phosphate oxidase (GPO) is an oxidase with flavin adenine dinucleotide (FAD) as a cofactor. It can catalyze L-α-glycerophosphate to produce dihydroxyacetone phosphate and release H2O2 at the same time. GPO is used together with lipase and glycerol kinase to clinically detect the level of triglycerides in the body. Triglycerides are a routine indicator of clinical blood lipids. Increased triglycerides will not only cause atherosclerotic cardiovascular diseases, but also cause microvascular complications in diabetic patients. Therefore, it has received widespread attention. GPO can be used as a key indicator of triglycerides to monitor the development of cardiovascular and other diseases.

[0003] GPO exists in a variety of microorganisms, such as enterococci, lactobacillus and streptomyces. At present, most of the domestic production of GPO is directly extracted from microorganisms, but its culture conditions are complex and the corresponding enzyme yield is low, which ultimately leads to complex GPO production process and high price. Therefore, it is difficult to carry out large-scale fermentation production.

[0004] E. coli is one of the commonly used bacteria in the production of bio-enzyme preparations. Its characteristics are: simple culture conditions, clear genetic background, high protein expression level and mature fermentation technology. Based on these advantages of the E. coli system, some domestic companies have also adopted E. coli fermentation to produce GPO for large-scale production, but after application, it was found that its stability was poor and it was difficult to meet its application in clinical triglyceride detection.

[0005] Therefore, there is an urgent need to find a GPO with better stability to meet the needs of clinical testing. Summary of the invention

[0006] In view of the above-mentioned shortcomings of the prior art, in order to solve the technical problem of poor GPO stability in the prior art, the object of the present invention is to provide a mutant of glycerol phosphate oxidase and its use, so as to solve the problems in the prior art.

[0007] To achieve the above-mentioned purpose and other related purposes, the present application provides a glycerol phosphate oxidase mutant in a first aspect, wherein the amino acid sequence of the glycerol phosphate oxidase mutant is relative to the amino acid sequence of the wild-type glycerol phosphate oxidase, and two or four of the amino acid residues at the amino acid positions 236, 426, 102 and 168 are mutated to amino acids suitable for forming disulfide bonds. The amino acid sequence of the wild-type glycerol phosphate oxidase includes the sequence shown in SEQ ID NO.1.

[0008] Compared with the wild-type glycerol phosphate oxidase, the mutant of the glycerol phosphate oxidase can improve the stability of the glycerol phosphate oxidase, preferably can improve the stability of the glycerol phosphate oxidase produced by Escherichia coli.

[0009] The amino acid sequence of the mutant of glycerol phosphate oxidase is relative to the amino acid sequence of the wild-type glycerol phosphate oxidase, in which the amino acid residues at the 236th and 426th amino acid positions are replaced by cysteine, and the amino acid sequence of the mutant of glycerol phosphate oxidase is shown in SEQ ID NO.3.

[0010] The amino acid sequence of the mutant of glycerol phosphate oxidase is relative to the amino acid sequence of the wild-type glycerol phosphate oxidase, in which the amino acid residues at the 102nd and 168th amino acid positions are replaced by cysteine, and the amino acid sequence of the mutant of glycerol phosphate oxidase is shown in SEQ ID NO.2.

[0011] The second aspect of the present application provides an isolated polynucleotide encoding the mutant of the above-mentioned glycerol phosphate oxidase. Preferably, the isolated polynucleotide sequence includes a sequence as shown in one of SEQ ID NO.5 and SEQ ID NO.6.

[0012] The third aspect of the present application provides a construct comprising the above-mentioned isolated polynucleotide.

[0013] The fourth aspect of the present application provides a host comprising the above-mentioned construct or gene in which the above-mentioned exogenous polynucleotide is integrated, wherein the host is a microorganism, a cell or a virus.

[0014] The fifth aspect of the present application provides a method for producing glycerol phosphate oxidase, comprising culturing a host under conditions suitable for the expression of the above-mentioned glycerol phosphate oxidase mutant to obtain the glycerol phosphate oxidase.

[0015] The sixth aspect of the present application provides a use of a mutant of glycerol phosphate oxidase in the preparation of a detection product. Preferably, the detection product is a triglyceride detection product.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] 1. By changing the protein conformation, the key amino acids are mutated to form disulfide bonds, thereby improving the stability of the mutant of glycerol phosphate oxidase.

[0018] 2. By mutating the 236th and 426th positions of glycerol phosphate oxidase to cysteine, a disulfide bond is formed, which improves the stability of the enzyme by about 70% compared with the wild-type enzyme.

[0019] 3. By constructing a mutant of oil phosphate oxidase, its affinity with the coenzyme FAD is enhanced, thus improving the problem that the coenzyme FAD of the original wild-type GPO is easily detached and the activity is greatly reduced. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Shown is a schematic diagram of the enzyme activity and stability results of the GPO mutants.

[0021] Figure 2 Shown is a graph showing the percentage of remaining enzyme activity of GPO mutants after treatment at 37°C for 3 days.

[0022] Figure 3 The result of electrophoresis of GPO mutant expression is shown as a schematic diagram. Among them, lane 1 is GPO-M102C-D168C-supernatant, lane 2 is GPO-M102C-D168C-flow-through, lane 3 is GPO-M102C-D168C-wash, lane 4 is GPO-M102C-D168C-elution, lane 5 is GPO-V236C-S426C-supernatant, lane 6 is GPO-V236C-S426C-flow-through, lane 7 is GPO-V236C-S426C-wash, and lane 8 is GPO-V236C-S426C-elution.

[0023] Figure 4 The schematic diagram shows the electrophoresis results of GPO mutant purification, wherein lane 1 is GPO-WT, lane 2 is GPO-M102C-D168C, and lane 3 is GPO-V236C-S426C. DETAILED DESCRIPTION

[0024] In order to make the invention purpose, technical scheme and beneficial effect of the present invention clearer, the present invention is further described below in conjunction with examples. It should be understood that the examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified, and those familiar with the technology can easily understand other advantages and effects of the present invention from the contents disclosed in this description.

[0025] After extensive exploration and research, the inventors of the present application unexpectedly discovered a mutant of glycerol phosphate oxidase. Compared with the wild-type glycerol phosphate oxidase, the mutant of glycerol phosphate oxidase has improved stability and enhanced affinity for the coenzyme FAD, so that it can be applied to the field of triglyceride detection. The present invention was completed on this basis.

[0026] The present application provides a glycerol phosphate oxidase mutant, wherein the amino acid sequence of the glycerol phosphate oxidase mutant is relative to the amino acid sequence of the wild-type glycerol phosphate oxidase, and two or four of the amino acid residues at the amino acid positions 236, 426, 102 and 168 are mutated to amino acids suitable for forming disulfide bonds. The amino acid sequence of the wild-type glycerol phosphate oxidase includes the sequence shown in SEQ ID NO.1.

[0027] The amino acid sequence of the mutant of the glycerol phosphate oxidase is selected from one of the following situations:

[0028] a) The amino acid sequence of the mutant of glycerol phosphate oxidase is relative to the amino acid sequence of the wild-type glycerol phosphate oxidase, and the amino acid residues at the 236th and 426th amino acid positions are mutated into amino acids suitable for forming disulfide bonds. In a specific embodiment of the present application, the amino acid sequence of the mutant of glycerol phosphate oxidase is relative to the amino acid sequence of the wild-type glycerol phosphate oxidase, and the amino acid residue at the 236th amino acid position can be replaced by cysteine, that is, valine is replaced by cysteine; the amino acid residue at the 426th amino acid position can be replaced by cysteine, that is, serine is replaced by cysteine. The amino acid sequence of the mutant of glycerol phosphate oxidase may include the sequence shown in SEQ ID NO.3;

[0029] b) The amino acid sequence of the mutant of glycerol phosphate oxidase is relative to the amino acid sequence of the wild-type glycerol phosphate oxidase, and the amino acid residues at the amino acid positions 102 and 168 are mutated into amino acids suitable for forming disulfide bonds. In a specific embodiment of the present application, the amino acid sequence of the mutant of glycerol phosphate oxidase is relative to the amino acid sequence of the wild-type glycerol phosphate oxidase, and the amino acid residue at the amino acid position 102 can be replaced by cysteine, that is, methionine is replaced by cysteine; the amino acid residue at the amino acid position 168 can be replaced by cysteine, that is, aspartic acid is replaced by cysteine, and the amino acid sequence of the mutant of glycerol phosphate oxidase can include the sequence shown in SEQ ID NO.2.

[0030] c) The amino acid sequence of the mutant of glycerol phosphate oxidase is relative to the amino acid sequence of the wild-type glycerol phosphate oxidase, and the amino acid residues at the 236th, 426th, 102nd and 168th amino acid positions are mutated into amino acids suitable for forming disulfide bonds.

[0031] The mutant of the glycerol phosphate oxidase of the present application has improved stability compared with the wild-type glycerol phosphate oxidase. The stability of the glycerol phosphate oxidase refers to treating the sample at 37°C for 3 days, treating the sample at 4°C and 37°C with or without FAD, and measuring the enzyme activity by a kinetic scanning method, and using the residual enzyme activity to represent the stability.

[0032] Specifically, the calculation formula of the enzyme activity is:

[0033] Enzyme activity per unit volume (U / ml) = (△OD / min (△ODtest-△ODblank) × Vt × df) / 29.9

[0034] =△OD / min×1.739×df;

[0035] Vt: total volume;

[0036] Vs: sample volume;

[0037] 29.9: millimolar extinction coefficient of quinoline dye under the conditions of determination;

[0038] 1 / 2: Factor for producing half a mole of quinoline dye based on one mole of H2O2;

[0039] 1.0: optical path length (cm);

[0040] Df: dilution factor.

[0041] Specifically, the calculation formula of the residual enzyme activity is:

[0042] Remaining enzyme activity (%) = enzyme activity after treatment at 37°C for 3 days / enzyme activity after storage at 4°C × 100%.

[0043] The present application also provides an isolated polynucleotide encoding a mutant of glycerol phosphate oxidase.

[0044] The term "isolated" refers to the removal of a substance from its original environment (e.g., its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide separated from some or all of the substances that coexist with it in the natural system is isolated. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the vector or composition is not a component of its natural environment, they are still isolated. In a specific embodiment of the present application, the isolated polynucleotide sequence includes a sequence as shown in one of SEQ ID NO.5 and SEQ ID NO.6.

[0045] The present application also provides a construct containing the aforementioned isolated polynucleotide. The construct is represented by a nucleotide sequence, which further comprises an optional nucleotide sequence. Specifically, the nucleic acid construct further comprises an additional expression regulatory element, which is configured to be operably connected to the optional nucleotide sequence. The construct can usually be obtained by inserting the isolated polynucleotide into a suitable vector, and a person skilled in the art can select a suitable vector. For example, the vector can be an expression vector or a cloning vector. For another example, the type of the vector can be a plasmid, a phage, a phage derivative, an animal virus, and a cosmid, etc. Preferably, it is pET39b.

[0046] The present application also provides a host, containing the aforementioned construct or the aforementioned polynucleotide integrated with an exogenous source in the genome. The construct is transformed, transduced or transfected into the host by conventional methods in the art, such as calcium chloride chemical transformation, high voltage electric shock transformation. The host includes microorganisms, cells or viruses. Specifically, it can be a prokaryotic cell or a eukaryotic cell, preferably Escherichia coli, Bacillus subtilis, yeast (such as Pichia pastoris) or various animal and plant cells, and more preferably the host is a genetically engineered bacterium commonly used in the art, such as Escherichia coli, Bacillus subtilis or Pichia pastoris. Preferably, the host is Escherichia coli BL21 (DE3) or Escherichia coli Top 10. The above-mentioned Escherichia coli needs to be able to express the mutant of the above-mentioned glycerol phosphate oxidase, so as to provide the conditions for the existence of the mutant of the glycerol phosphate oxidase. The method for constructing the above-mentioned Escherichia coli should be known to those skilled in the art. For example, the above-mentioned Escherichia coli can be obtained by constructing E.coli BL21 (DE3).

[0047] The present application also provides a method for producing glycerol phosphate oxidase, comprising the following steps: inducing the host to express glycerol phosphate oxidase under the condition that the mutant of the aforementioned glycerol phosphate oxidase exists. Suitable induction expression methods should be known to those skilled in the art. For example, the aforementioned host can be induced under suitable conditions to provide glycerol phosphate oxidase. For another example, it can be first fermented in LB liquid culture medium for 8 to 12 hours, 8 to 10 hours, or 10 to 12 hours, and can be cultured under temperature conditions of 37 to 40°C, 37 to 38°C, 38 to 39°C, or 39 to 40°C, and then transferred to 2xYT culture medium according to an inoculation amount of 2 to 5%, 2 to 3%, 3 to 4% or 4 to 5%. For another example, the host can be induced to express glycerol phosphate oxidase under temperature conditions of 37 to 40°C, 37 to 38°C, 38 to 39°C, or 39 to 40°C. For another example, when the bacteria are in the logarithmic growth phase, preferably in the early stage of the logarithmic growth phase, expression can be induced to provide glycerol phosphate oxidase. For another example, fermentation can be induced for 4 to 6 hours, or 4 to 5 hours.

[0048] The mutant of the glycerol phosphate oxidase of the present application can be used in the field of preparing medical diagnostic reagents, and can be used for clinical detection of the level of triglycerides in the body, thereby monitoring the development of cardiovascular diseases.

[0049] The mutant of the glycerol phosphate oxidase of the present application can effectively improve the stability of the glycerol phosphate oxidase. Experimental data show that when the amino acid (valine) at position 236 of the glycerol phosphate oxidase is mutated to cysteine, and the serine at position 426 is mutated to cysteine, in the presence of the mutant of the glycerol phosphate oxidase, the stability is improved by 70% compared with the wild-type glycerol phosphate oxidase, and the affinity with the coenzyme FAD is also enhanced, which helps to solve the inactivation problem of GPO in the clinical application process and has good industrialization prospects.

[0050] The invention of the present application is further described below by way of examples, but the scope of the present application is not limited thereby.

[0051] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in the field of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields.

[0052] Example 1

[0053] Construction of site-directed mutation engineering bacteria for glycerol phosphate oxidase

[0054] Amplification of the gene sequence GPO of glycerol phosphate oxidase: The gene sequence of the synthesized glycerol phosphate oxidase (as shown in SEQ ID NO.4) was used as a template, and PCR amplification was performed with primers GPO-F and GPO-R (sequence shown in Table 1). PCR amplification conditions: 95℃ 3min; 36 cycles (95℃ 20s, 60℃ 20s, 72℃ 3min); 72℃ 10min. After electrophoresis verification and electrophoresis gel recovery, the purified GPO fragment was obtained. The above-purified GPO fragment and the pET39b plasmid were double-digested with NdeI and XhoI enzymes, respectively, and the digestion products were connected by T4 ligase at 4℃ overnight. The ligation product was transformed into Escherichia coli Top10, coated on the LB solid plate containing, cultured for 16h, and then colony PCR was performed. The colony was sent to the company for sequencing. After the sequencing was correct, the positive plasmid was named p39-GPO. The amino acid sequence of the glycerol phosphate oxidase carried by p39-GPO is shown in SEQ ID NO.1.

[0055]

[0056]

[0057] Table 1 Primers

[0058] Serial Number Primer name Sequence (5'-3') SEQ ID NO.7 GPO-F GGAATTCCATATGTTTTCAAACAAGACAAGACAAG SEQ ID NO.8 GPO-R CCGCTCGAGTTTCTCGCCCTTTAGTTCACGC

[0059] Example 2

[0060] Verification of glycerol phosphate oxidase producing strains

[0061] The recombinant plasmid p39-GPO sequenced correctly in Example 1 was transformed into Escherichia coli BL21 (DE3). The monoclonal transformants were selected and added to LB medium supplemented with kanamycin (50 mg / ml), cultured at 37°C overnight, and then transferred to 2xYT medium, inoculated at 2%, and cultured until OD600 was 0.8-0.1, and IPTG with a final concentration of 0.5 mM was added to induce expression. The bacteria were collected and lysed under ultrasonic conditions at 120 W, working time 3 s, and interval 5 s. After that, the supernatant was obtained by centrifugation at a speed of 9000 rpm, time 10 min, and temperature of 4 °C. The enzyme activity was determined and verified by SDS-PAGE. The experimental results are shown as follows: Figure 3 shown.

[0062] LB medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH = 7.0.

[0063] 2xYT medium: tryptone: 16 g / L, yeast extract: 10 g / L, NaCl 5 g / L, pH = 7.0.

[0064] Example 3

[0065] Construction of mutant strains

[0066] The point mutation kit (Quanshijin Biology, catalog number: FM111-01) was used to perform PCR amplification with the p39-GPO plasmid of Example 1 as a template and the primers in Table 2 to construct a mutant plasmid. The mutant plasmid was transformed into Escherichia coli Top10, coated on a solid LB plate containing, cultured for 16 hours, and then subjected to colony PCR detection. The plasmid was sent to the company for sequencing. After the sequencing was correct, the obtained positive plasmids were named GPO-M102C-D168C and GPO-V236C-S426C. Among them, the amino acid sequence of the glycerophosphate oxidase carried by GPO-M102C-D168C is shown in SEQ ID NO.2, and the nucleotide sequence is shown in SEQ ID NO.5; the amino acid sequence of the glycerophosphate oxidase carried by GPO-V236C-S426C is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.6.

[0067] Table 2 Primers

[0068]

[0069]

[0070]

[0071]

[0072] Example 4

[0073] Fermentation of glycerol phosphate oxidase producing strains

[0074] The plasmid with correct sequencing was transformed into E. coli expression strain BL21 (DE3), and a single clone was picked into LB medium, cultured in a shaker at 37°C, 200r / min for 8h, and then inoculated into 2xYT medium at 2% until OD600 was between 0.8 and 1, IPTG was added to a final concentration of 1mM, and induced culture was carried out in a shaker at 30°C, 160r / min for 4 to 6h. The bacteria were collected, and after ultrasonic cell disruption, the supernatant was centrifuged for crude enzyme activity determination and SDS-PAGE identification.

[0075] Example 5

[0076] Purification of GPO mutants and activity assay

[0077] According to the method described in Example 4, the cells after induced expression were collected, the cells were broken and centrifuged to obtain the supernatant, and the GPO C-terminal His-tag was used to bind to the nickel column for purification. The buffer used for purification was: buffer A: 25mM Tris-HCL, 150mM NaCl, pH = 7.5; buffer B: 25mM Tris-HCL, 150mM NaCl, 500mM imidazole. A solution and B solution were combined for gradient elution purification to obtain a pure protein sample with a molecular weight of 67kD. The results are shown in FIG. Figure 4 shown.

[0078] The activity of GPO mutants was determined by kinetic scanning. The definition of 1 enzyme activity unit (U / ml) is: the amount of enzyme required to consume 1μmol of L-α-glycerophosphate per minute under the environment of pH 6.5 and temperature of 37°C. Enzyme activity determination conditions: Prepare the following working mixture in PIPES buffer: 1.4mM 4-aminoantipyrine (4-AA), 2.5mM 2-hydroxy-3-m-toluidine propanesulfonic acid sodium (TOOS), 5U / ml peroxidase (POD). Add 25μl of sample to 625μl of working mixture, mix well, read the OD550 readings at different time points in the spectrophotometer, form a kinetic curve, and finally calculate the enzyme activity according to the formula.

[0079] Example 6

[0080] Analysis of GPO mutant stability

[0081] The method used to detect the stability of GPO mutants is: dilute the wild type and mutants of GPO to less than 50U / ml, treat at 4℃ and 37℃ for 3 days, and the samples are divided into two types: with FAD and without FAD (4-FAD, indicating samples with FAD added at 4℃; 4-noFAD, indicating samples without FAD added at 4℃; 37-FAD, indicating samples with FAD added at 37℃; 37-noFAD, indicating samples without FAD added at 37℃), and the concentration of FAD is 0.01mg / ml. After the samples are treated under the above conditions, the activity is determined by the kinetic scanning method, and the stability is obtained by comparing the activity of 37-noFAD to the activity of 4-noFAD. The results are as follows: Figure 1 and Figure 2 shown.

[0082] In summary, the present invention uses structural biology to predict the amino acids that may form disulfide bonds in GPO, and mutates the corresponding amino acids into cysteine ​​through point mutation. The stability of the GPO-V236C-S426C mutant is improved by nearly 70%, which can better meet the needs of clinical testing and has broad market prospects.

[0083] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by a person of ordinary skill in the art without departing from the spirit and technical concept disclosed by the present invention shall still be covered by the claims of the present invention.

Claims

1. A glycerol phosphate oxidase mutant, characterized in that: The amino acid sequence of the mutant of the glycerol phosphate oxidase is relative to the amino acid sequence of the wild-type glycerol phosphate oxidase, and the amino acid residues at positions 236 and 426 are replaced by amino acids suitable for forming disulfide bonds; or, the amino acid sequence of the mutant of the glycerol phosphate oxidase is relative to the amino acid sequence of the wild-type glycerol phosphate oxidase, and the amino acid residues at positions 102 and 168 are replaced by amino acids suitable for forming disulfide bonds; the amino acid suitable for forming disulfide bonds is cysteine; The amino acid sequence of the wild-type glycerol phosphate oxidase is shown in SEQ ID NO.

1.

2. The mutant of glycerol phosphate oxidase according to claim 1, characterized in that Compared with the wild-type glycerol phosphate oxidase, the mutant of the glycerol phosphate oxidase can improve the stability of the glycerol phosphate oxidase.

3. The mutant of glycerol phosphate oxidase according to claim 2, characterized in that Compared with the wild-type glycerol phosphate oxidase, the mutant of the glycerol phosphate oxidase can improve the stability of the glycerol phosphate oxidase produced by Escherichia coli.

4. The mutant of glycerol phosphate oxidase according to claim 1, characterized in that The amino acid sequences of the mutant of the glycerol phosphate oxidase are shown in SEQ ID NO.3 and SEQ ID NO.

2.

5. An isolated polynucleotide encoding the mutant of glycerol phosphate oxidase according to any one of claims 1 to 4.

6. The polynucleotide according to claim 5, wherein The isolated polynucleotide sequence includes a sequence as shown in one of SEQ ID NO.5 and SEQ ID NO.

6.

7. A construct comprising the isolated polynucleotide of claim 5.

8. A host comprising the construct according to claim 7 or the gene in which the exogenous polynucleotide according to claim 5 is integrated, wherein the host is a microorganism or a cell, and the cell is a non-plant cell.

9. The host according to claim 8, characterized in that The host is a virus.

10. A method for producing glycerol phosphate oxidase, comprising culturing the host according to claim 8 under conditions suitable for the expression of the glycerol phosphate oxidase mutant according to any one of claims 1 to 4 to obtain the glycerol phosphate oxidase.

11. Use of the mutant of glycerol phosphate oxidase according to any one of claims 1 to 4 in preparing a detection product.

12. The use according to claim 11, characterized in that The detection product is a triglyceride detection product.

Images