A method and application of strain engineering modification based on flow cytometry without plate-coating operation

Abstract

The present invention constructs a method for engineering strains without plate operation based on flow cytometry, which combines the transformation of a DNA sequence carrying a selective marker gene into the genome of the target fungal protoplast, flow cytometric sorting, deep-well plate culture, and rapid phenotypic analysis. It can be directly used for screening and separating protoplasts after genetic transformation of filamentous fungi, solving the bottleneck problems of long time, laboriousness, and low throughput in the process of plate culture, transformant selection, conidia preparation, and shake flask identification in existing filamentous fungi technology. The method of the present invention is easy to operate, saves time and labor, greatly improves the efficiency of filamentous fungal engineering, and can conveniently and effectively carry out high-throughput construction of high-yield engineered filamentous fungi.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and biotechnology, and in particular relates to the construction and application of a plate-free operation-free strain engineering method based on flow cytometry. Background Art

[0002] The industrial trait improvement of high-yield strains of filamentous fungi is mainly achieved through genetic engineering technology. However, the traditional filamentous fungal strain modification technology is very complicated and tedious, including genetic transformation of the strain, pouring the plate after transformation, plate culture of protoplasts, picking transformants from the selection plate onto solid plates, culturing colonies for sporulation, collecting conidia of the transformants for subsequent PCR verification and shake flask culture for phenotypic analysis (existing engineering modification processes such as Figure 7 As shown in the figure, a large number of complex manual operations are required to pour plates, select individual transformants from the culture plates and culture them on solid plates for isolation, collect and wash the conidia of the transformants, and inoculate the conidia into triangular shake flasks for shaking culture. These operations are complicated, time-consuming, labor-intensive, and costly, which seriously limits the selection and breeding of industrial production strains of filamentous fungi.

[0003] In recent years, although high-throughput screening technologies based on flow cytometry sorting have been developed for Trichoderma reesei, these technologies still require conventional genetic transformation and post-transformation plating operations, including plating transformed protoplasts onto regeneration culture plates, selecting colonies from selective plates and transferring them to individual solid plates for culture, and then collecting and washing the formed molecular spores; or culturing mycelium to further prepare protoplasts for further sorting and culture. These technologies still require time-consuming and labor-intensive manual operations.

[0004] Therefore, it is necessary to establish a convenient, fast and effective method for the transformation of engineered strains without plate operation to solve the serious bottlenecks faced by current traditional technologies, and provide a convenient, fast and effective method for the high-throughput construction of high-yield engineered strains of filamentous fungi, which has important industrial application prospects. Summary of the Invention

[0005] The present invention addresses the above bottleneck issues. It combines genetic manipulation technology, flow cytometry sorting, deep-well plate culture, and rapid phenotypic analysis to provide a flow cytometry-based strain engineering method that does not require plate operation. This method is suitable for the rapid construction of engineered filamentous fungal strains, especially for the simple and rapid construction of high-yield industrial filamentous fungal strains. The overall process is as follows: Figure 1 shown.

[0006] Therefore, the present invention provides a method for engineering filamentous fungi based on flow cytometry without plate operation, characterized in that it comprises the following steps:

[0007] (1) transforming a gene with a screening marker, such as a selective marker gene or an auxotrophic gene, and a target DNA sequence into the genome of the target fungal protoplast;

[0008] (2) the protoplasts obtained after transformation are regenerated and germinated in a culture medium containing a selective substance corresponding to the selective marker gene, wherein the regeneration and germination culture refers to culturing transformants to a short hyphae morphology for subsequent screening, preferably the short hyphae morphology refers to short hyphae not exceeding 70 μm, specifically transformants with a short hyphae morphology cultured for 8-16 hours;

[0009] (3) using flow cytometry to detect the transformants obtained in step (2), and directly sorting them into well plates for fermentation culture. Preferably, the well plates (especially deep-well plates) are culture vessels with high-throughput screening functions;

[0010] (4) Analysis and detection: The transformants selected for the well plate fermentation culture in step (3) are centrifuged and the supernatant in the well plate is taken out for protein determination. The relative levels of secreted target proteins are compared to obtain mutant strains that have been successfully transformed by genetic engineering.

[0011] Optionally, the method further comprises the following steps:

[0012] (5) The mutant strain obtained in the previous step is selected for re-screening in shake flasks, and the mutant strain with high target protein production is re-engineered using the method described in steps (1-4).

[0013] Preferably, the filamentous fungus includes but is not limited to any one of the genera Myceliophthora, Aspergillus, Thielavia, Neurospora, Trichoderma, Penicillium, Fusarium, or Rhizopus, more preferably Myceliophthora and Aspergillus, most preferably Myceliophthora thermophila or Aspergillus niger.

[0014] Further preferably, the sorting in step (3) is set to sort a single to ten transformants per well, for example, the sorting is set to sort a single, double or triple transformants per well; the deep-well plate is a 96-deep-well plate, a 48-deep-well plate, a 24-deep-well plate or a 12-deep-well plate;

[0015] More preferably, the transformants obtained in the flow cytometer detection step (2) are directly sorted into a deep-well plate, specifically, the transformant suspension is filtered through a mesh (e.g., ≤70 μm pore size white cells) and then analyzed by flow cytometry, and the transformants that have regenerated, germinated, and successfully expressed the target protein are correctly distinguished by adjusting and optimizing the FSC, SSC, and FL1-log-Height parameters and sorted into a high-throughput well plate filled with liquid culture medium;

[0016] More preferably, the selectable marker gene refers to a gene used to screen transformant cells during the genetic transformation process, more specifically, including (but not limited to): hygromycin resistance gene (hph), chlorpyrifos (sur), G418 resistance gene (neo), and glufosinate resistance gene (bar); the nutritional deficiency gene refers to a gene used to screen transformant cells during the genetic transformation process, more specifically, including (but not limited to): uracil deficiency gene (pyrG), tryptophan deficiency gene (trp), arginine nutritional deficiency (argB), histidine nutritional deficiency (His), amdS nitrogen source nutritional screening gene, and niaD nitrogen source nutritional screening gene.

[0017] Furthermore, the transformation also includes a co-transformed fluorescent protein gene; correspondingly, in step (4), transformants are screened by observing fluorescence under a fluorescence microscope; preferably, the fluorescent protein gene is green fluorescent protein GFP, and in step (4), transformants are screened by observing green fluorescence under a fluorescence microscope; further, the transformation of the target gene is identified by colony PCR.

[0018] More specifically, the transformation described in step (1) is to include a 2A peptide-mediated saccharification enzyme TeglaA and a green fluorescent protein GFP recombinant expression vector and a CRISPR-Cas9-mediated gene editing system; optionally, step (4) also includes observing the GFP expression of the transformants under a fluorescence microscope and identifying the editing efficiency of the target gene by colony PCR.

[0019] The present invention also provides an engineered filamentous fungus with improved saccharifying enzyme production, which is obtained by engineering the filamentous fungus using the method described, wherein the target DNA encodes a saccharifying enzyme gene, and the saccharifying enzyme production capacity of the engineered filamentous fungus is improved by engineering;

[0020] Preferably, the filamentous fungus includes but is not limited to any one of the genera Myceliophthora, Aspergillus, Thielavia, Neurospora, Trichoderma, Penicillium, Fusarium, or Rhizopus, more preferably Myceliophthora and Aspergillus, most preferably Myceliophthora thermophila and Aspergillus niger.

[0021] Specifically, the filamentous fungus is Myceliophthora thermophila, and the engineering modification includes transforming Myceliophthora thermophila with the TeglaA recombinant expression vector, and performing multiple rounds of editing on the Myceliophthora thermophila genome based on CRISPR-Cas9 technology to knock out proteases Mtalp-1 and Mtspr-14, carbon catabolite repression effector Mtcre-1 and F-box protein Mtexo-1;

[0022] The filamentous fungus is Aspergillus niger, and the engineering modification includes transforming Aspergillus niger with a TeglaA recombinant expression vector and editing the Aspergillus niger genome based on CRISPR-Cas9 technology to knock out the carbon catabolite repression effector transcription factor AncreA and the adapter protein subunit Anap3m.

[0023] The present invention also provides a method for producing saccharifying enzymes using the engineered filamentous fungus. Specifically, the engineered filamentous fungus is cultured in the presence of starch raw material or starch inducer to hydrolyze starch.

[0024] Compared with the prior art, the present invention has outstanding beneficial effects: in view of the fact that the traditional engineering transformation steps of filamentous fungal strains are complicated, time-consuming and labor-intensive, and it is difficult to carry out high-throughput construction of engineered strains, the present invention provides a method for strain engineering transformation based on flow cytometry without plate operation. The technical method for strain engineering transformation provided by the present invention solves the problem that the current traditional technical process of filamentous fungi is complicated, time-consuming and requires a lot of manual operation. The method of the present invention combines genetic modification technology, flow cytometric analysis and sorting method, deep-well plate culture and rapid phenotypic identification, providing a fast and effective method for the transformation of filamentous fungal strains. The method of the present invention is based on the ability of flow cytometry to quickly perform single-cell detection and analysis on protoplasts regenerated and germinated after transformation, constructing a large number of analysis target groups, and directly sorting transformants to deep-well plate culture by flow cytometry, eliminating the tedious, time-consuming and labor-intensive process of pouring plates and plate growth culture and subsequent picking, thereby improving the sorting speed and screening efficiency. In addition, deep-well plate fermentation culture avoids the long time required for colony growth and spore production and the complex manual steps of collecting and washing spores. Compared to the traditional method of plate preparation, plate culture, transformant selection, colony sporulation, spore collection and washing, and then fermentation, the strain engineering time is shortened from 18-24 days to 5-6 days. Therefore, the method of the present invention is easy to operate, saves time and labor, greatly improves the time and efficiency of filamentous fungal strain engineering, and provides a convenient and effective method for high-throughput construction of high-yield engineered filamentous fungal strains.

[0025] Furthermore, the method of the present invention was successfully applied to the construction of high-yielding saccharifying enzyme strains from the industrial filamentous fungi Myceliophthora thermophila and Aspergillus niger. This enabled the rapid identification and analysis of a large number of mutant strains within a short period of time, allowing for the rapid isolation of target strains. The resulting high-yielding engineered saccharifying enzyme strains, MtYM6 and AnLM3, were obtained. The recombinant strain MtYM6, with six gene mutations, showed a protein yield that was ~17.3 times higher than the wild-type strain, and a ~25.1-fold increase in saccharifying enzyme activity. The recombinant strain AnLY3, with three gene mutations, showed a ~1.2-fold increase in protein yield and ~1.3-fold increase in saccharifying enzyme activity compared to currently used industrial strains, demonstrating significant application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of a flow cytometry-based plate-free strain engineering method.

[0027] Figure 2 Figure 3 shows the microscopic analysis of the regeneration and germination of protoplasts of Myceliophthora thermophila in liquid culture. (AD) shows the protoplast morphology after 0-12 hours of culture without selection pressure, and (EF) shows the protoplast morphology after 9 hours of culture with the addition of the antibiotics glufosinate (E) or G418 (F).

[0028] Figure 3 This flow cytometry-based, plate-free method was used to construct a recombinant strain expressing TeGlaA in Myceliophthora thermophila. (A) Transformants obtained through genetic manipulation for screening; (B) Single, double, and triple transformants were sorted by flow cytometry and plated onto deep-well plates; (C) The mutant strain was grown in a 24-deep-well plate in the presence of 2% water-soluble starch for three days.

[0029] Figure 4 Figure 1 shows the mutant screening process in a 24-deep-well plate. (A) shows the protein secretion concentration in the supernatant after 3 days of fermentation; (B) shows the expression of green fluorescent protein in conidia and hyphae of the recombinant strain MtYM3; (C) shows the results of Western blot analysis of the secretion of MhGlaA-9×His by the recombinant strain; (D) shows the protein SDS-PAGE electrophoresis analysis of the supernatants of the recombinant strain MtYM3 and the wild-type strain MtWT under 2% water-soluble starch conditions; (E) shows the protein concentration and saccharifying enzyme activity in the fermentation supernatant.

[0030] Figure 5 Figure 1 is a flow cytometric sorting process diagram. (A) and (B) show the second-round sorting of transformants; (D) and (E) show the third-round edited transformants; (C) and (F) show the protein secretion concentrations in the supernatant after 3-day fermentation in 24-deep-well plates; (G) shows the SDS-PAGE electrophoresis analysis of the supernatant of the recombinant strains MtYM4 and MtYM6 and the wild-type strain MtWT under starch conditions; (H) shows protein secretion and saccharifying enzyme activity; (I) shows the transcription levels of the major amylase gene and the transcription factor MtamyR by RT-qPCR.

[0031] Figure 6 This flow cytometry-based, plate-free method was used to construct a high-yielding strain of glucoamylase in Aspergillus niger. (A) Microscopic analysis of A. niger protoplasts cultured in liquid medium for 0-18 hours, (B and C) flow cytometric sorting, (D) protein secretion concentration in the supernatant of the sorted mutants after 4 days of fermentation in 24-deep-well plates, (E) green fluorescent protein expression in conidia and hyphae of the recombinant strain AnLM3, and (F) protein secretion and glucoamylase activity in the fermentation supernatants of the recombinant strain AnLM3 and the starting strain N1.

[0032] Figure 7 Schematic diagram of the strain engineering method in the prior art. DETAILED DESCRIPTION

[0033] After extensive and in-depth research, the present inventors provide a method for engineering strains without plate operation based on flow cytometry and its application, such as Figure 1The following examples are used to show that the method of the present invention can be used to construct high-yield saccharifying enzyme recombinant strains MtYM6 and AnLM3 in thermophilic Myceliophthora and Aspergillus niger quickly, effectively, and time-savingly. Figure 5 and Figure 6 As shown, the saccharifying enzyme production capacity can be significantly improved, thereby providing a strain engineering modification method for improving the saccharifying enzyme production capacity of filamentous fungi.

[0034] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).

[0035] The methods for obtaining the various biological materials described in the examples merely provide experimental methods for achieving the disclosed objectives and should not be construed as limiting the sources of the biological materials used in the present invention. In fact, the sources of biological materials used are diverse, and any legally and ethically accessible biological material may be substituted for and used as indicated in the examples.

[0036] The original starting strain Myceliophthora thermophila ATCC 42464 used in the examples was purchased from the American type culture collection, and the Aspergillus niger starting strain N1 used in the examples was from Shandong Longkote Enzyme Preparation Co., Ltd.

[0037] If the specific technology or conditions are not specified in the examples, the technology or conditions described in the literature in this field or the product instructions shall be followed. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased through regular channels. Among them, the percentage concentrations that appear are all mass percentage concentrations unless otherwise specified. The primers used and nucleic acid sequencing were completed by Suzhou GENEWIZ Biotechnology Co., Ltd. GENEWIZ. Among them, "MYCTH_..." is the gene site number of thermophilic myceliophthora, "An01g09210" and "An02g03830" are the gene site numbers of Aspergillus niger.

[0038] The present invention is further illustrated by the following examples, which provide detailed embodiments and specific operating procedures to facilitate understanding of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solutions of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but such modifications or replacements fall within the scope of protection of the present invention.

[0039] Example 1: Transformation of filamentous fungal strains without plate manipulation based on flow cytometry

[0040] 1. Microscopic observation of regeneration and germination of protoplasts of Myceliophthora thermophila in culture medium

[0041] The protoplasts of the wild-type strain of Myceliophthora thermophila ATCC 42464 were placed in MM liquid medium supplemented with 1 mol / L sorbitol and cultured at 35°C. Microscopic observation was performed at different culture times, such as 0, 6, 9, and 12 hours. Figure 2 As shown, after 9 hours of culture without selection pressure, protoplasts regenerated and germinated into short mycelia no larger than 70 μm, which could be used for subsequent flow cytometric sorting; whereas no germination was observed in the culture medium supplemented with antibiotics.

[0042] MM medium: 50× Vogel's salts 20 mL, sucrose 20 g, agar 15 g, bring to 1 L, and autoclave. 50× Vogel's salts (1 L): trisodium citrate (1 / 2 H2O) 150 g, anhydrous KH2PO4 250 g, anhydrous NH4NO3 100 g, MgSO4·7H2O 10 g, CaCl2·2H2O 5 g, trace element salt solution 5 mL, biotin (0.1 mg / mL) 2.5 mL, bring to 1 L.

[0043] 2. Genetic modification of target filamentous fungi through 2A peptide-mediated co-expression strategy and CRISPR-Cas9 editing system

[0044] A. Construction of 2A peptide-mediated recombinant expression vector for saccharifying enzyme TeGlaA

[0045] An expression vector was constructed using the plasmid pAN52-MhGlaA (Li, F., Liu, Q., Li, X., Zhang, C., Li, J., Sun, W., et al. (2020) Construction of a new thermophilic fungus Myceliophthora thermophila platform for enzyme production using a versatile 2Apeptide strategy combined with an efficient CRISPR-Cas9 system. Biotechnology letters 42: 1181-1191.). The saccharifying enzyme gene TeglaA from Talaromyces emersonii was substituted for MhGlaA to create the fusion protein expression cassette MtPtef1-TeglaA-2A-GFP-TtrpC. Then, the promoter MtPtef1 of the thermophilic Myceliophthora translation elongation factor TEF1A was replaced with the promoter AnPtef1 of the Aspergillus niger translation elongation factor TEF1A, and a fusion protein expression cassette AnPtef1-TeglaA-2A-GFP-TtrpC for recombinant expression of TeglaA in Aspergillus niger was constructed.

[0046] The PCR primer pairs required for expression cassette construction were MtPtef1-F / MtPtef1-R, TeglaA-F / GFP-R, and AnPtef1-F / AnPtef1-R. The primer sequences are shown in Table 1. The PCR reaction system consisted of 10 μL of 5× Phusion HF buffer, 1 μL of 10 mM dNTPs, 2.0 μL each of 10 mM primer-F and primer-R, 1 μL of template DNA, 0.5 μL of Phusion DNA polymerase, and 33.5 μL of water. The PCR reaction conditions were: 98°C for 30 s, followed by 35 cycles of 98°C for 10 s, 65°C for 30 s, and 72°C for 1.5 min; and finally, 72°C for 10 min and 4°C for 10 min. The above PCR fragments were rapidly assembled into a backbone plasmid double-digested with restriction endonucleases Bgl II and BamH I using the Gibson Assembly technology system to construct TeGlaA recombinant expression vectors pAN52-MtPtef1-TeGlaA and pAN52-AnPtef1-TeGlaA (such as Figure 3 (As shown in A). 10 μg of the recombinant expression vector was linearized by restriction endonuclease Hind III and used for subsequent transformation.

[0047] Table 1

[0048]

[0049]

[0050] B. Construction of sgRNA expression cassette vector for target gene and its cognate donor DNA vector

[0051] Target sites for the target genes Mtspr-14, Anap3m, and AncreA were designed using the sgRNACas9 tool. The U6p promoter, target site, and sgRNA backbone were ligated using fusion PCR. The sgRNA expression cassette vectors (MtU6p-Mtspr-14-sgRNA, AnU6p-Anap3m-sgRNA, and AnU6p-AncreA-sgRNA) were constructed using the gene overlap extension (SOE) method. The required primer sequences are shown in Table 1. The PCR reaction system consisted of 10 μL of 5× Phusion HF buffer, 1 μL of 10 mM dNTPs, 2.5 μL of upstream / downstream primers, 1 μL of template DNA, 0.5 μL of Phusion DNA polymerase, and 2.5 μL of ddH2O3. The PCR reaction conditions were as follows: 98°C for 30 s first; then 98°C for 10 s, 65°C for 30 s, and 72°C for 1 min, for 34 cycles; and finally 72°C for 10 min and 4°C for 10 min.

[0052] In this example, the homologous donor DNA fragments consisted of upstream and downstream homologous fragments of the target genes Mtspr-14, AncreA, and Anap3m, the geneticin (G418) resistance gene expression cassette PtrpC-neo fragment, the hygromycin resistance gene expression cassette PtrpC-neo fragment, or the stop codon TAA. These fragments were ligated into the plasmid pUC118 linearized with the restriction endonucleases BamHI and HindIII using the Gibson Assembly method to construct the donor DNA fragments donor-Mtspr-14, donor-AncreA, and donor-Anap3m. The required PCR primer sequences are shown in Table 1.

[0053] sgRNA and homologous donor DNA expression vectors for other target genes are shown in the CRISPR-Cas9 editing elements (Liu Q, Zhang Y, Li F, Li J, Sun W, Tian C: Upgrading of efficient and scalable CRISPR-Cas-mediated technology for genetic engineering in thermophilic fungus Myceliophthora thermophila. Biotechnol Biofuels 2019, 12: 293.).

[0054] C. Protoplast transformation of Myceliophthora thermophila

[0055] Mature Myceliophthora spores were collected with 0.05% Tween-80 sterile water, filtered through lens paper to remove the mycelia, and then spread onto a glass paper-lined MM plate and incubated at 45°C for 16 hours. The mycelia were then placed in 30 mL of lysis solution (formula: 0.15 g lyase, aseptically added to 30 mL of Solution A, sterilized by filtration; Solution A: 1.0361 g potassium dihydrogen phosphate, 21.864 g sorbitol, dissolved in 90 mL of deionized water, adjusted to pH 5.6 with potassium hydroxide, quantitatively made up to 100 mL, and sterilized at high temperature) and lysed at 30°C for 2 hours, gently shaking every 20 minutes. After filtering through cellophane, centrifuge at 2000 rpm at 4°C for 10 minutes. Discard the supernatant and add 4 mL of Solution B (0.735 g calcium chloride, 18.22 g sorbitol, 1 mL Tris-HCl 1 M pH 7.5, dissolved in 90 mL deionized water, adjusted to pH 7.6 with hydrochloric acid, volume to 100 mL, and autoclave). Centrifuge at 2000 rpm at 4°C for 10 minutes. Discard the supernatant and add a volume of Solution B at a rate of 200 μL / plasmid. To a pre-chilled 15 mL centrifuge tube, add 50 μL of pre-chilled PEG (12.5 g PEG 6000, 0.368 g calcium chloride, 500 μL Tris-HCl 1 M pH 7.5). Add the transformed DNA fragment to 200 μL of protoplasts. Place on ice for 20 minutes, then add 2 mL of pre-chilled PEG. Allow to stand at room temperature for 5 minutes. Then, add 4 mL of Solution B and mix gently. Take 3 mL of the above solution and add 12 mL of melted MM liquid medium containing the corresponding antibiotics and added with 1 mol / L sorbitol, place it at 35 ° C for regeneration and germination for 9 hours, and after germination, short mycelium of no more than 70 μm is formed. The maximum detection range of the flow cytometer used is 70 μm, and it is ready for subsequent sorting (such as Figure 3 (as shown in A in the figure).

[0056] 3. Directly sort transformants into deep-well plates by flow cytometry

[0057] The transformants to be sorted were centrifuged at 4000 rpm and 4°C for 10 min, the supernatant was discarded, and 3 mL of 0.05% Tween 80 solution was added. The resuspended transformant suspension was filtered through a 70 μm pore size white cell mesh and then loaded onto a flow cytometer (MoFlo TM XDP) analysis. According to the fluorescence emitted by green fluorescent protein, the FL1 channel was selected for detection. By adjusting and optimizing the FSC, SSC, and FL1-log-Height parameters, the transformant areas that were regenerated, germinated, and fluorescent were correctly distinguished. The most concentrated part of the fluorescent area that grew and germinated was designed as a gate and sorted into a high-throughput well plate filled with liquid culture medium. Summit 5.2 software was used for analysis, and the FL1 channel (528 / 29nm) was used for detection. The voltage of the fluorescence channel was 500. With FSC-Width as the horizontal axis and FSC-Height as the vertical axis, the part with the most concentrated regeneration and germination of short hyphae was set as the gate. At the same time, with FL1-Log-Height as the horizontal axis and SSC-Log-Height as the vertical axis, the part with the most concentrated fluorescence was set as the gate. Through the setting of these two gates, the transformants with fluorescent, growing, germinating, and short hyphae were sorted into the prepared 24-deep-well plates for 2% soluble starch culture and fermentation (such as Figure 3 Each well was set to sort single, double, or triple transformants, with 4 mL of fermentation medium in each well, the fermentation speed was 700 rpm, and the fermentation temperature was 45 degrees.

[0058] 4. Rapid phenotypic identification after 3 days of deep-well plate fermentation

[0059] After 3 days of deep-well plate fermentation, a total of 79 transformants were obtained (such as Figure 3 As shown in A), the culture medium in the well plate was centrifuged at 10000rpm and 4℃ for 10min, and the supernatant was used to detect its protein concentration using the Bio-Rad Bradford Protein Rapid Test Kit to analyze and compare the protein content secreted by these transformants. The results are shown in Figure 4 As shown in Figure A, compared with the wild type, the protein production of 55 mutants was significantly increased (≥1.5 times), among which the protein production of 14 mutants was significantly increased by 2 times, and 6 triple-gene mutant recombinant strains MtYM3 (OE-TeglaAΔMtalp-1) were obtained.

[0060] The above results indicate that the present invention has successfully constructed a flow cytometry-based plate-free method for transforming filamentous fungi strains, and has successfully applied it to the production of Myceliophthora thermophila saccharifying enzyme.

[0061] Example 2: Phenotypic Analysis of the Recombinant Strain MtYM3 Producing Glucoamylase from Myceliophthora thermophila

[0062] 1. The recombinant strain was cultured in starch induction medium

[0063] The six recombinant strains MtYM3 and the wild-type strain MtWT obtained in Example 1 were induced to produce saccharifying enzymes. The induction culture conditions were: culturing in 2% (2g / 100mL) water-soluble starch medium (formula: 50×Vogel's salts 2mL, water-soluble starch 2g, yeast extract 0.75g, volume adjusted to 100mL, and autoclaved) at 45°C and 150rpm for 4 days. After culturing for 2 days, mycelia were collected and observed under a fluorescence microscope. After culturing for 4 days, the samples were centrifuged and the supernatant was collected for Western blot, SDS-PAGE electrophoresis analysis, and determination of protein concentration and saccharifying enzyme activity.

[0064] 2. Detection of fusion protein TeGlaA-9×His-2A-eGFP

[0065] Fluorescence microscopy was used to observe the expression of GFP in conidia and mycelium of the recombinant strain MtYM3. Figure 4 As shown in B, the spores and hyphae of the recombinant strain showed strong green fluorescence. After 4 days of culture, the supernatant was subjected to Western blot and SDS-PAGE electrophoresis analysis to detect the recombinant protein TeGlaA-9×His. The primary antibody used was His-Tag rabbit monoclonal antibody and the secondary antibody was rabbit anti-IgG HRP antibody. The results are shown in Figure 4 As shown in Figures C and D, the recombinant protein TeGlaA-9×His was successfully expressed and secreted, with a size of approximately 65 kD, and the molecular size was consistent with the expected result, indicating that the fusion protein TeGlaA-9×His-2A-eGFP was successfully expressed in the recombinant strain.

[0066] 3. Determination of secretory protein concentration and saccharifying enzyme activity

[0067] Determination of secretory protein concentration: The protein concentration in the supernatant was determined using the Bio-Rad Bradford Protein Rapid Test Kit.

[0068] Glycoamylase activity assay: Dilute the crude enzyme solution with 0.05M sodium acetate buffer (pH 4.8) to a final volume of 0.25 mL. Preheat the solution in a 50°C waterbath. Add 0.25 mL of 1% soluble starch (Difco) substrate solution, preheated in a 50°C waterbath, mix thoroughly, and react at 50°C for 10 min. Terminate the reaction with 0.5 mL of DNS solution, boil for 10 min, cool on ice, and dilute to 2.5 mL with distilled water. Shake well. The amount of glucose released is determined by DNS by measuring the OD at 540 nm. A blank control is used with inactivated enzyme solution. Glycoamylase activity is defined as the amount of enzyme that hydrolyzes soluble starch to produce 1 μmol of glucose per min at 50°C and pH 4.8 per mL of enzyme solution.

[0069] The results are as follows Figure 4 As shown in Figure E, compared with the wild type, under water-soluble starch growth conditions, the protein secretion level and saccharification enzyme activity of the recombinant strain MtYM3 were significantly improved, and its protein yield and enzyme activity were increased by ∼3.5 and ∼4.1 times compared with the wild type.

[0070] Example 3: Construction of a high-yield saccharifying enzyme TeGlaA engineered strain of Myceliophthora thermophila based on a plate-free operation technology system

[0071] 1. Combine CRISPR-Cas9-mediated multi-round editing system to construct high-yield strains through plate-free operation technology

[0072] The thermophilic myceliophthora recombinant strain MtYM3 obtained above was genetically engineered using a plate-free technique. Using a multi-round editing system mediated by CRISPR-Cas9 editing technology, MtYM3 was subjected to two consecutive rounds of editing to knock out the Mtspr-14, neo, bar, Mtcre-1, and Mtexo-1 genes in the recombinant strain genome. After the target gene CRISPR-Cas9 editing elements were co-transformed into MtYM3 protoplast cells, the protoplast transformation step was consistent with the corresponding method of the above-mentioned embodiment one. Cas9, under the mediation of sgRNA, recognizes the target site for cutting by pairing the protospacer with the DNA chain of the target gene on the host cell genome. Subsequently, the donor DNA fragment undergoes homologous recombination with the sequences on both sides of the target site, and the transformed protoplasts are screened and cultured by adding PPT or G418 to the liquid culture medium. After 9 hours of culture, the transformants were directly sorted by flow cytometry into 24 deep-well plates for fermentation culture, and the sorting step was consistent with the corresponding method of the above-mentioned embodiment one.

[0073] 2. Phenotypic analysis of the recombinant strain of Myceliophthora thermophila with high saccharifying enzyme production

[0074] like Figure 5 As shown in Figures AC, after 3 days of deep-well plate fermentation in the second round of editing, a total of 89 transformants were obtained. The secretion levels of these transformants were compared by measuring the protein concentration in the culture supernatant. Compared with the starting strain MtYM3, the protein production of 33 transformants was significantly increased by 1.5 times, and 20 four-gene mutant strains MtYM4 (OE-TeglaAΔMtalp-1ΔMtspr-14Δneo) were obtained. The third round of editing was carried out on the recombinant strain MtYM4, and 97 transformants were obtained by flow cytometry sorting into 24 deep-well plates for fermentation culture (as shown in Figures AC). Figure 5 Compared with the starting strain MtYM4, the protein yield of 46 transformants was significantly increased by 2.0 times, and 10 six-gene mutant strains MtYM6 (OE-TeglaAΔMtalp-1ΔMtspr-14ΔneoΔMtcre-1ΔMtexo-1Δbar) were obtained.

[0075] The recombinant strains MtYM3, MtYM4 and MtYM6 obtained by three consecutive rounds of editing and the wild-type strain MtWT were induced to produce saccharifying enzymes. The induction culture conditions were consistent with the corresponding method in Example 2 above. After 5 days of culture, the sample was centrifuged and the supernatant was taken for SDS-PAGE electrophoresis analysis, protein concentration, and saccharifying enzyme activity determination. The concentration determination of secreted protein and saccharifying enzyme activity were consistent with the corresponding methods in Example 2 above. The results are shown in Figure 2. Figure 5 As shown in Figures G and H, compared with the wild type, the protein production of all recombinant strains was significantly improved under water-soluble starch growth conditions, especially the MtYM6 recombinant strain, whose protein production was as high as 17.3 times that of the wild type, and the enzymatic activity of saccharifying enzyme was significantly increased by 25.1 times that of the wild type.

[0076] 3. Analysis of expression patterns of key amylase genes and transcription factors in high-yielding strains of saccharifying enzymes

[0077] The recombinant strain MtYM6 and the wild-type strain MtWT were inoculated into liquid MM culture medium and cultured at 45°C with shaking at a shaker speed of 150 rpm. After 16 h of culture, the mycelium was collected and washed three times with sterile water. The mycelium was then transferred to 2% soluble starch for induction culture for 4 h. The mycelium was then filtered and RNA was extracted to detect the expression levels of the two main amylase genes (Mycth_72393 and Mycth_2300079) and the regulatory factor MtamyR.

[0078] RNA extraction method: Quickly grind the mycelial sample with liquid nitrogen and transfer it to a screw-cap tube. Use a MiniBead Beater at maximum speed for 30 seconds, repeat twice. Place on a shaker and gently shake for 5 minutes at room temperature to remove nucleosomes. Add 200 μL of chloroform and shake for 15 seconds using a MiniBead Beater at maximum speed. Place the tube on a shaker and gently shake for 2 minutes. Centrifuge at 12,000 × g at 4°C for 15 minutes. Remove the supernatant and transfer it to a new RNase-free 1.5 mL centrifuge tube. Add 500 μL of isopropanol to the tube, mix thoroughly, gently shake at room temperature for 10 minutes, centrifuge at 12,000 × g at 4°C for 10 minutes, and discard the supernatant. Wash the pellet with 1 mL of 75% ethanol, centrifuge at 10,000 × g at 4°C for 5 minutes, discard the supernatant, and let it stand at room temperature for approximately 10 minutes to remove any residual ethanol. Add 50 μL of DEPC water to dissolve the RNA. The obtained sample was purified using a commercial RNeasy Mini Kit, and the purified RNA was reverse transcribed using the ReverTra Ace qPCR RT Kit (TOYOBO).

[0079] RT-qPCR method: The Mtactin gene was selected as the internal reference gene, and the reaction system was operated according to the instructions of SYBR Green Realtime PCR Master Mix. The corresponding gene expression abundance of the wild-type strain was used as a control. The primers used are shown in Table 1.

[0080] The results are as follows Figure 5 As shown in Figure 1, in the six-gene recombinant strain MtYM6, the transcription levels of two key amylase genes, Mycth_72393 and Mycth_2300079, and the key amylase regulator MtamyR, were significantly upregulated. The transcription levels of Mycth_72393 and Mycth_2300079 were increased by 51-fold and 37-fold, respectively.

[0081] The above results indicate that the present invention successfully and continuously applied the constructed plate-free operation strain modification method to the production of Myceliophthora thermophila saccharifying enzyme, and ultimately obtained the engineered strain MtYM6 with significantly improved saccharifying enzyme production.

[0082] Example 4: Application of a flow cytometry-based plate-free operation technology system in the production of saccharifying enzymes by Aspergillus niger

[0083] 1. Microscopic observation of the regeneration and germination of Aspergillus niger protoplasts

[0084] The protoplasts of the industrial strain N1 of Aspergillus niger were placed in MM liquid medium supplemented with 1 mol / L sorbitol and placed at 30°C for regeneration culture. Microscopic observation was performed at different culture time periods of 0, 12, and 18 hours. Figure 6 As shown in Figure A, after 18 h of culture without selection pressure, the protoplasts regenerated and germinated into short mycelia no larger than 70 μm, which could be used for subsequent flow cytometric sorting.

[0085] 2. Genetic transformation and flow cytometry sorting of Aspergillus niger strain N1

[0086] The genome of Aspergillus niger strain N1 was genetically modified using the CRISPR-Cas9 system and 2A peptide co-expression. The Aspergillus niger strain N1 was knocked out using CRISPR-Cas9 editing technology, and the Anap3m and AncreA genes in the genome of the N1 strain were knocked out. After the above-mentioned target gene CRISPR-Cas9 editing element and the linearized recombinant expression vector pAN52-AnPtef1-TeGlaA were co-transformed into the protoplast cells of the strain N1, the protoplast transformation step was consistent with the corresponding method of the above-mentioned embodiment 1. After culturing for 18 hours, the transformants were directly sorted by flow cytometry into 24 deep-well plates for fermentation culture. Each well was filled with 4 mL of fermentation culture medium, the fermentation speed was 700 rpm, and the fermentation temperature was 30 degrees (such as Figure 6 The separation steps are the same as those in the above Example 1. The Aspergillus niger fermentation culture formula is: 3% soybean meal, 3% corn steep liquor, 10% glucose, and sterilized by high pressure.

[0087] 3. Biological phenotype analysis of Aspergillus niger engineered strain producing saccharifying enzyme

[0088] like Figure 6 As shown in Figure C, 52 transformants were obtained after four days of fermentation in a 24-deep-well plate. After centrifugation at 10,000 rpm and 4°C for 10 minutes, the supernatant was collected and analyzed for protein concentration using a Bio-Rad Bradford Protein Rapid Assay Kit. Compared to the starting strain N1, all 18 mutants showed significant increases in protein production (≥1.2-fold), including five triple-mutant recombinant strains, AnLM3 (E-TeglaA-gfpΔAnap3mΔAncreA).

[0089] The recombinant strain AnLM3 and the starting strain N1 were rescreened and verified by shake flask liquid fermentation. The induction culture conditions were: culture at 30°C and 250rpm in fermentation medium (formula: 3% soybean meal, 3% corn steep liquor, 10% glucose, constant volume to 50mL, and autoclaved). After culturing for 2 days, the mycelia were collected for fluorescence microscopy observation. After culturing for 6 days, the samples were centrifuged and the supernatant was taken to determine the secreted protein concentration and saccharifying enzyme activity. The protein concentration determination and saccharifying enzyme activity determination were consistent with the corresponding methods in Example 2 above. Microscopic observation results of GFP expression of the mutant strain, as shown in Figure 6 As shown in Figure E, both the spores and hyphae of the recombinant strain AnLM3 showed strong green fluorescence. Compared with the starting strain N1, the protein secretion level and saccharification enzyme activity of the recombinant strain AnLM3 were significantly improved. Its protein yield and enzyme activity were increased by 1.2 and 1.3 times respectively compared with the host strain N1 (as shown in Figure E). Figure 6 (as shown in F in the figure).

[0090] The above results show that the flow cytometry-based plate-free operation strain modification method constructed by the present invention can be successfully applied to the production of saccharifying enzyme by the industrial strain Aspergillus niger, and can effectively increase the yield of saccharifying enzyme in a short time, and has high application value. <110> Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences <120> A method and application of strain engineering modification based on flow cytometry without plate-coating operation <130> <160> 38 <170> PatentIn version 3.5 <210> 1 <211> 65 <212> DNA <213> Artificial sequence <400> 1 TGACTTGAAGTAATCTCTGCAGATCTTTAATTAACTCGAGTCTGGCCATGTTCCGCATCTATCTA 65 <210> 2 <211> 60 <212> DNA <213> Artificial sequence <400> 2 GAGCGCCAGCAACGAGGGACGCCATACTAGTTCTGAAGAACGAAACTGGCGACTTGCGCT 60 <210> 3 <211> 60 <212> DNA <213> Artificial sequence <400> 3 AGCGCAAGTCGCCAGTTTCGTTCTTCAGAACTAGTATGGCGTCCCTCGTTTGCTGGCGCTC 60 <210> 4 <211> 66 <212> DNA <213> Artificial sequence <400> 4 GCTGTTTGATGATTTCAGTAACGTTAAGTGGATCCCTATTACTTGTACAGTCCGTCCATGCCGAGA 66 <210> 5 <211> 56 <212> DNA <213> Artificial sequence <400> 5 TTGGCTGACTTGAAGTAATCTCTGCAGATCTTTCTGGTACGGTACCAAATCTTGAG 56 <210> 6 <211> 50 <212> DNA <213> Artificial sequence <400> 6 GAGCGCCAGCAACGAGGGACGCCATGATGACGGTTGTGAATGAACTCGAA 50 <210> 7 <211> 25 <212> DNA <213> Artificial sequence <400> 7 AGGATCGGTGGAGTGAAGTTCGGAA 25 <210> 8 <211> 52 <212> DNA <213> Artificial sequence <400> 8 GCTCTAAAACAGCAGCACTGTGGAGGCTGCGAGGAAAGAAAGAAAAGAAGAG 52 <210> 9 <211> 53 <212> DNA <213> Artificial sequence <400> 9 GCTCTAAAACTGTTGGAGTTCGACTGTGTACGAGGAAAGAAAGAAAAGAAGAG 53 <210> 10 <211> 52 <212> DNA <213> Artificial sequence <400> 10 GCTCTAAAACCTCATGATGGCGAAGGCAACGAGGAAAGAAAGAAAAGAAGAG 52 <210> 11 <211> 52 <212> DNA <213> Artificial sequence <400> 11 TTCTTTCCTCGCAGCCTCCACAGTGCTGCTGTTTTAGAGCTAGAAATAGCAA 52 <210> 12 <211> 53 <212> DNA <213> Artificial sequence <400> 12 TTCTTTCCTCGTACACAGTCGAACTCCAACAGTTTTAGAGCTAGAAATAGCAA 53 <210> 13 <211> 52 <212> DNA <213> Artificial sequence <400> 13 TTCTTTCCTCGTTGCCTTCGCCATCATGAGGTTTTAGAGCTAGAAATAGCAA 52 <210> 14 <211> 27 <212> DNA <213> Artificial sequence <400> 14 AAAAAAAGCACCGACTCGGTGCCACTT 27 <210> 15 <211> 61 <212> DNA <213> Artificial sequence <400> 15 ACAGGAAACAGCTATGACCATGATTACGAATTCAGCGGCGATCTGCCGCTAATCATCCGAT 61 <210> 16 <211> 50 <212> DNA <213> Artificial sequence <400> 16 GCTCCTTCAATATCAGTTAACGTCGTCATCGCGGACGTAGTTCAGACAAT 50 <210> 17 <211> 50 <212> DNA <213> Artificial sequence <400> 17 ATTGTCTGAACTACGTCCGCGATGACGACGTTAACTGATATTGAAGGAGC 50 <210> 18 <211> 50 <212> DNA <213> Artificial sequence <400> 18 ATCGGCGCCCTTGACGACATGGTCCTCAAATCTCGGTGACGGGCAGGACC 50 <210> 19 <211> 50 <212> DNA <213> Artificial sequence <400> 19 GGTCCTGCCCGTCACCGAGATTTGAGGACCATGTCGTCAAGGGCGCCGAT 50 <210> 20 <211> 58 <212> DNA <213> Artificial sequence <400> 20 CGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGATAGCCACCCTCTCCGCAAGCCAT 58 <210> twenty one <211> 59 <212> DNA <213> Artificial sequence <400> twenty one CACAGGAAACAGCTATGACCATGATTACGAATTCTGGGCCACGGATCATTTTTCCTAAG 59 <210> twenty two <211> 58 <212> DNA <213> Artificial sequence <400> twenty two AATTCCAGGGCAAGCAGCGGTTCCGTTAGATGGCGAAGGCAACCTATCCCGACCGGTG 58 <210> twenty three <211> 58 <212> DNA <213> Artificial sequence <400> twenty three CACCGGTCGGGATAGGTTGCCTTCGCCATCTAACGGAACCGCTGCTTGCCCTGGAATT 58 <210> twenty four <211> 58 <212> DNA <213> Artificial sequence <400> twenty four CGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGATCGGGACGCTCACCACAACCTCT 58 <210> 25 <211> 59 <212> DNA <213> Artificial sequence <400> 25 CACAGGAAACAGCTATGACCATGATTACGAATTCTTCGCGTTCCCATTCTGCTCTCCGA 59 <210> 26 <211> 50 <212> DNA <213> Artificial sequence <400> 26 AATGCTCCTTCAATATCATCTTCTGTTCGACTGTGTACTGGACCGGAGTAG 50 <210> 27 <211> 50 <212> DNA <213> Artificial sequence <400> 27 CTACTCCGTCCAGTACACAGTCGAACAGAAGATGATATTGAAGGAGCATT 50 <210> 28 <211> 50 <212> DNA <213> Artificial sequence <400> 28 TGTTGCTGCGCCTCGAGTTAGGGTTCTATTCCTTTGCCCTCGGACGAGTG 50 <210> 29 <211> 50 <212> DNA <213> Artificial sequence <400> 29 CACTCGTCCGAGGGCAAAGGAATAGAACCCTAACTCGAGGCGCAGCAACA 50 <210> 30 <211> 58 <212> DNA <213> Artificial sequence <400> 30 CGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGGTGGAGCGACAAATGACGGATAGA 58 <210> 31 <211> 18 <212> DNA <213> Artificial sequence <400> 31 AACGCTCCTGCCTTCTAC 18 <210> 32 <211> 20 <212> DNA <213> Artificial sequence <400> 32 GTAACACCATCACCAGAGTC 20 <210> 33 <211> 20 <212> DNA <213> Artificial sequence <400> 33 CACCGTTGCGTCGTATCTTC 20 <210> 34 <211> 20 <212> DNA <213> Artificial sequence <400> 34 GTAGTCACCACCACCAGAGG 20 <210> 35 <211> 18 <212> DNA <213> Artificial sequence <400> 35 GAGACCGAGACGCCTATC 18 <210> 36 <211> twenty one <212> DNA <213> Artificial sequence <400> 36 AGTCCAGGTGTAGAAGTAGTC 21 <210> 37 <211> 19 <212> DNA <213> Artificial sequence <400> 37 CTCCAACAACCAGCACTTG 19 <210> 38 <211> 18 <212> DNA <213> Artificial sequence <400> 38 AGCCATTCCGAGCCATTG 18

Claims

1. A method for engineering filamentous fungi based on flow cytometry without plate operation, characterized in that: The steps include: (1) Transforming a sequence containing a screening marker and target DNA into the genome of the target filamentous fungus protoplast; the screening marker is a selective marker gene or a gene containing an auxotrophic gene; (2) The protoplasts obtained after transformation are regenerated and germinated in a culture medium containing a selective substance corresponding to the selective marker gene, wherein the regeneration and germination culture refers to culturing for 8-16 hours to obtain transformants with short hyphae morphology for subsequent screening, and the short hyphae morphology refers to short hyphae not exceeding 70 μm; (3) Using flow cytometry to detect the transformants obtained in step (2), the transformants are directly sorted into deep-well plates for fermentation culture. The deep-well plates are culture vessels with high-throughput screening functions; (4) Analyze and detect the transformants sorted into deep-well plate fermentation culture in step (3), remove the supernatant from the deep-well plate after centrifugation, and perform protein determination to compare the relative levels of secreted target proteins to obtain mutant strains that have been successfully transformed by genetic engineering; The filamentous fungus is Myceliophthora thermophila or Aspergillus niger.

2. The method according to claim 1, wherein The following steps are also included: (5) The mutant strain obtained in the previous step is selected for re-screening in shake flasks, and the mutant strain with high target protein production is re-engineered using the method described in steps (1-4).

3. The method according to claim 1, wherein The sorting in step (3) is set to sort single to ten transformants per well; the deep-well plate is a 96-deep-well plate, a 48-deep-well plate, a 24-deep-well plate, or a 12-deep-well plate.

4. The method according to claim 1, wherein The transformants obtained in the flow cytometer detection step (2) are directly sorted into deep-well plates. Specifically, the transformant suspension is filtered through a mesh and then analyzed on a flow cytometer. By adjusting and optimizing the FSC, SSC, and FL1-log-Height parameters, the transformants that have regenerated, germinated, and successfully expressed the target protein are correctly distinguished and sorted into high-throughput well plates filled with liquid culture medium.

5. The method according to claim 1, wherein The selective marker gene refers to a gene used to screen transformant cells during genetic transformation; the auxotrophic gene refers to a gene used to screen transformant cells during genetic transformation.

6. The method according to claim 5, wherein: The selective marker gene is a hygromycin resistance gene, a chlorpyrifos sulfamethoxazole, a G418 resistance gene, or a glufosinate resistance gene; The nutritional deficiency genes are uracil deficiency genes, tryptophan deficiency genes, arginine nutritional deficiency genes, histidine nutritional deficiency genes, amdS nitrogen source nutritional screening genes, and niaD nitrogen source nutritional screening genes.

7. The method according to claim 1, wherein The transformation also includes a co-transformed fluorescent protein gene; correspondingly, in step (4), the transformants are screened by observing fluorescence under a fluorescence microscope.

8. The method according to claim 7, wherein The fluorescent protein gene is green fluorescent protein GFP. In step (4), green fluorescence is observed under a fluorescence microscope to screen transformants, and colony PCR is used to identify the transformation of the target DNA.

9. The method according to claim 8, wherein The conversion described in step (1) is to include 2A peptide-mediated saccharification enzyme TeglaA and green fluorescent protein GFP recombinant expression vector and CRISPR-Cas9 mediated gene editing system; step (4) also includes observing the GFP expression of the transformants under a fluorescence microscope and identifying the editing efficiency of the target DNA by colony PCR.

10. An engineered filamentous fungus for improving the production of saccharifying enzymes, characterized in that: The method of any one of claims 1 to 9 is used to engineer a filamentous fungus, wherein the target DNA is a gene encoding a saccharifying enzyme, and the saccharifying enzyme production capacity of the engineered filamentous fungus is improved by the engineering method; The filamentous fungus is Myceliophthora thermophila, and the engineering modification includes transforming Myceliophthora thermophila with a TeglaA recombinant expression vector and performing multiple rounds of editing on the Myceliophthora thermophila genome based on CRISPR-Cas9 technology to knock out the protease. Mtalp-1 and Mtspr-14 , carbon catabolite repressor effector Mtcre-1 and F-box proteins Mtexo-1 ;or The filamentous fungus is Aspergillus niger, and the engineering modification includes transforming Aspergillus niger with a TeglaA recombinant expression vector and editing the Aspergillus niger genome based on CRISPR-Cas9 technology to knock out the carbon catabolite repression effector transcription factor AncreA and adaptor protein subunits Anap3m .

11. A method for producing saccharifying enzymes by the engineered filamentous fungus according to claim 10.

12. The method according to claim 11, wherein The engineered filamentous fungus according to claim 10 is cultured in the presence of a starch raw material or a starch inducer to hydrolyze starch.

Images