Application of Cryptosporidium cgd3_4260 protein as marker protein for the outer wall of oocyst wall

Abstract

The invention discloses application of Cryptosporidium cgd3_4260 protein as an oocyst wall exocyst marker protein. The inventors have found through research that a Cryptosporidium protein with an amino acid sequence as shown in SEQ ID NO.1 in the sequence table is an oocyst wall exocyst protein, which is located on the outer surface of the Cryptosporidium oocyst wall. The inventors have confirmed the feasibility of using the protein as a detection antigen. The antibody of the recombinant protein (sequence as shown in SEQ ID NO.3 and 5) can be used for immunological detection of unbroken Cryptosporidium oocysts (live Cryptosporidium oocysts), and the invention also provides a specific polypeptide of the protein.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and in particular relates to a Cryptosporidium cgd3_4260 protein for detection and an application thereof. Background Art

[0002] Cryptosporidium is a genus of parasitic protozoa under the phylum Apicomplexa, which includes multiple species that infect humans or animals. Cryptosporidium parvum ) and the human-specific "Cryptosporidium hominis" ( Cryptosporidium hominis ) are the two main pathogens causing severe and even fatal diarrhea caused by cryptosporidiosis worldwide; Cryptosporidium parvum can also infect a number of economic animals including cattle, goats and sheep, causing severe diarrhea and death in their young. Cryptosporidium is a gastrointestinal parasite that is mainly transmitted through the fecal-oral route. The host is infected after ingesting water or food contaminated by Cryptosporidium. It mainly parasitizes the epithelial cells of the small intestine and causes symptoms to the host that vary in severity, mainly manifested as moderate to severe diarrhea. In people and animals with normal immune function, cryptosporidiosis is generally self-limiting; however, in hosts with low immunity (such as AIDS patients), it is the main cause of death. Cryptosporidium oocysts are round or oval in shape, microscopic in size (for example, the diameter of Cryptosporidium parvum oocysts is about 5 microns), and the main structure includes the oocyst wall and the 4 sporozoites it encloses, which can survive in the environment for a long time. The oocyst wall has a specific structure and can resist conventional sodium hypochlorite disinfection. Therefore, Cryptosporidium is a major problem in controlling Cryptosporidium parvum contamination in food (such as vegetables, berries, etc.) and water samples (such as drinking water, recreational water, etc.). So far, there are no specific drugs and vaccines for Cryptosporidium parvum, which further increases the demand for prevention and control of Cryptosporidium parvum. At present, the detection methods for Cryptosporidium parvum in human or animal clinical samples in the environment mainly include pathogen detection, molecular biological detection and immunological detection of oocysts or parasite antigens. Among them, pathogen detection can directly observe unstained or labeled oocysts under a microscope, but this method is time-consuming and labor-intensive, with extremely low sensitivity and requires skilled technicians to operate; the existing molecular biological diagnosis has high sensitivity and specificity, but has high requirements for detection instruments; and the immunological detection method has certain sensitivity and specificity, which is suitable for clinical examinations and environmental sample monitoring, but it requires antibodies that can specifically mark the outer wall of the oocyst. In addition, the oocyst content in the environment is usually highly diluted, and the oocyst content in some clinical samples is low. The detection of such samples requires the enrichment and concentration of oocysts before using the above-mentioned diagnostic methods (non-specific physical methods: only by centrifugal sedimentation; by high-density liquid flotation combined with centrifugal sedimentation; specific immunological methods: using small particles or small magnetic beads coupled with antibodies that can mark the outer wall of Cryptosporidium oocysts to capture oocysts, and then collecting the particles or magnetic beads by centrifugal sedimentation or magnetic object precipitation).

[0003] At present, the clinical detection method of Cryptosporidium in China mainly relies on acid-fast staining and other methods to detect oocysts. This method has low specificity and poor sensitivity. At present, there is a diagnostic kit for fluorescent antibody labeling of Cryptosporidium oocyst wall abroad. It uses an oocyst wall protein with unknown specific genetic information as an antigen (only one protein) to make an antibody to fluorescently label the oocyst wall for microscopic observation and detection. This antibody is also used for immunological enrichment of Cryptosporidium oocysts in samples. The detection kit based on this antibody is expensive and not easy to use on a large scale. In addition, there is a blank in the domestic method of using indirect immunofluorescence (IFA) to detect Cryptosporidium in environmental water samples or clinical samples. The main reason is that there is still no protein on the outer wall of the Cryptosporidium oocyst wall that can be used to develop specific antibodies to label the outer wall of the oocyst in the field. Therefore, finding the marker protein of the outer wall of Cryptosporidium oocysts, preparing specific antibodies against the outer wall of oocysts, and establishing relevant immunological detection methods and sample enrichment methods are of great significance for the monitoring of Cryptosporidium in water samples, the detection and diagnosis of clinical cryptosporidiosis, the epidemiological investigation of Cryptosporidium infection in humans and animals, and the prevention and control of Cryptosporidium in zoonotic diseases. Summary of the invention

[0004] The purpose of the present invention is to solve the above problems and provide the use of Cryptosporidium cgd3_4260 protein as an oocyst wall outer wall marker protein.

[0005] Cryptosporidium cgd3_4260 protein, the amino acid sequence of which is shown in SEQ ID NO.1, 3 or 5 in the sequence listing;

[0006] Cryptosporidium cgd3_4260 protein, the nucleotide sequence of which is shown in SEQ ID NO.1, 3 or 5 in the sequence listing;

[0007] The Cryptosporidium marker protein is distributed on the outer surface of the outer wall of the oocyst wall.

[0008] The specific polypeptide of Cryptosporidium cgd3_4260 protein has an amino sequence of: CTYDFDWKKNYIE.

[0009] Anti-Cryptosporidium cgd3_4260 protein antibody, which can specifically bind to the outer surface of the outer wall of the Cryptosporidium oocyst wall.

[0010] An anti-Cryptosporidium cgd3_4260 protein-specific polypeptide antibody, which is an antibody prepared using the protein of the oocyst wall protein-specific polypeptide;

[0011] Application of anti-Cryptosporidium cgd3_4260 protein antibody or Cryptosporidium cgd3_4260 specific polypeptide antibody in detecting Cryptosporidium;

[0012] The Cryptosporidium detected is the Cryptosporidium oocysts that have not been broken.

[0013] The present invention provides an application of a Cryptosporidium cgd3_4260 protein as an oocyst wall exocyst marker protein. The present inventors have found through research that a Cryptosporidium protein having an amino acid sequence as shown in SEQ ID NO.1 in the sequence table is an oocyst wall exocyst protein, which is located on the outer surface of the Cryptosporidium oocyst wall. The present inventors have confirmed the feasibility of using the protein as a detection antigen. The antibody of the recombinant protein (sequence as shown in SEQ ID NO.3 and 5) can be used for immunological detection of unbroken Cryptosporidium oocysts (live Cryptosporidium oocysts), and the present invention also provides a specific polypeptide of the protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Amplification of the target fragments of cgd3_4260-1 and cgd3_4260-2;

[0015] Figure 2 The antibodies against two different recombinant proteins of the protein proved that it was the outer wall protein of the oocyst wall;

[0016] Figure 3 This is a graph for detecting the titer of specific polypeptide antibodies;

[0017] Figure 4 Specific peptide antibodies proved that the protein was the outer wall protein of the oocyst wall by IFA;

[0018] Figure 5 Specific peptide antibodies proved that the protein was the outer wall protein of the oocyst wall by immunoelectron microscopy (IEM);

[0019] Figure 6 Detection sensitivity of different titers of peptide antibodies;

[0020] Figure 7 Specificity detection diagram of different samples. DETAILED DESCRIPTION

[0021] Screening of recombinant proteins of Cryptosporidium parvum cgd3_4260 protein

[0022] (1) Search the gene number cgd3_4260 on the Cryptosporidium professional website (http: / / cryptodb.org / cryptodb / ) and download its nucleotide sequence (sequence as shown in SEQ ID N0.2) and amino acid sequence (sequence as shown in SEQ ID N0.1);

[0023] (2) Construction of prokaryotic expression vector

[0024] For the constructed prokaryotic expression vector:

[0025] The amino acids of the protein were divided into two segments (sequences shown in SEQ ID NOs. 3 and 5) and connected to the expression vector pET-28a respectively to express the cgd3_4260-1 and cgd3_4260-2 recombinant proteins.

[0026] Example 1 Expression of Cryptosporidium parvum cgd3_4260-1 and cgd3_4260-2

[0027] Primers were designed for the cgd3_4260-1 base sequence, and DNAMAN was used to select the appropriate restriction sites. The selected restriction sites were: Upstream: BamH ( CGC GGATCC), XOt ( CCG CTCGAA), the underline is the protective base of the restriction site, and the specificity of the primers was blasted and the designed primers are shown in the table:

[0028] F1: CGC GGATCCTGTATTTCATTATTAAAAAGTAAAAAATGCTAG;

[0029] R1: CCG CTCGAAGAAAAGCATGAAAAGTAAATTAAATGTAA;

[0030] F2: CGC GGATCCTTGCATATATTTGGACTTGTTTTAAC;

[0031] R2: CCG CTCGAATTATATTGCATTAAAAACATTCCACTG

[0032] The sizes of the amplified fragments were 1980 bp (sequence shown in SEQ ID N0.4), 1449 bp (sequence shown in SEQ ID N0.6), Figure 1 The designed primers were synthesized by Jilin Kumei Biological Company.

[0033] Cryptosporidium parvum DNA was extracted as a template, the above primers were added, and PCR was performed using a high-fidelity enzyme (Novozyme P515-01). The reaction system was: 2⨯Phanta Max Master Mix 25 µL, 2 µL of upstream and downstream primers, 1 µL of DNA template, 20 µL of water, and a total volume of 50 µL. The reaction procedure was: pre-denaturation: 95°C for 3 min; denaturation: 95°C, 15 s; annealing: 60°C, 30 s; extension: 72°C, 60 s; 72°C, 5 min, 35 cycles. After the PCR product was identified by nucleic acid electrophoresis, the gene fragment was recovered using a gel recovery kit, and then its concentration was measured for enzyme digestion. At the same time, the empty vector pET-28a was prepared.

[0034] The target fragment and the empty vector pET-28a were double-digested according to the enzyme instructions. The digestion system was: 1 μg plasmid; BamH I,Xho I 1 µL each; 2 µL 10× Buffer; add water to 20 µL. Enzyme digestion conditions: 37°C water bath for 1 h, then check the digestion effect, recover the target fragment by gel, and then measure its concentration. According to the instructions of Solution I (Takara), connect the vector and the fragment (the molar ratio of the fragment to the vector is 5:1) in a 16°C water bath for 30 min, then transfer to BL21 (DE3) competent cells, plate culture on a solid medium containing kanamycin resistance, PCR identification and sequencing, and inoculate the correctly identified expression strain into a K + Cultured in liquid culture medium.

[0035] 2. Expression and purification of recombinant proteins

[0036] (1) Screening and optimization of expression conditions

[0037] The strain successfully connected to the pET-28a vector (His tag) was streaked, and a single colony was picked and cultured in 5 mL liquid culture medium for 8-10 hours. Then the bacterial solution was expanded at 1:100 for about 2 hours, and when the OD value at 600 nm reached about 0.6, the expression was induced. IPTG was added with a final concentration of 0.1 mmol / L for induction, and three different induction temperatures and durations were set, namely 16℃, 12 h; 25℃, 6 h; 37℃, 3 h. At the same time, a control group without IPTG was set to determine the optimal expression conditions.

[0038] (2) Purification of His-tagged recombinant proteins

[0039] 1) After selecting appropriate induction conditions to induce protein expression, collect the bacterial culture, centrifuge at 4°C, 3500 r / min for 10 min, and discard the supernatant.

[0040] 2) Add an appropriate amount of PBS buffer to fully suspend the precipitate.

[0041] 3) Vortex the precipitate with 20 mL of 10 mM imidazole solution, add PMSF (0.5 mmol / L) and TritonX-100 (1%), mix well, place the centrifuge tube in an ice-water mixture, and disrupt the bacteria with an ultrasonic disruptor. Set the ultrasonic parameters: working time 15 min, ultrasonic 3 s, stop 3 s, power 160 W.

[0042] 4) Centrifuge the sonicated liquid at 16400 rpm / min, 4°C for 30 min and collect the supernatant.

[0043] 5) Use His GraviTrap TM Purify the recombinant protein with a column. After the 20% ethanol in the nickel column has flowed through, add 20 mL of 5 mM imidazole solution to balance the column. After the 10 mM imidazole has flowed through, slowly add the above-mentioned lysed bacterial supernatant, incubate for about 2 hours, and then let it slowly flow through the nickel column. Subsequently, add 20 mM, 40 mM, 60 mM, 80 mM, and 100 mM imidazole in sequence for washing. Finally, add 1 mL of 500 mM imidazole, incubate for 10 min, collect the effluent, and repeat 3 times. The whole process is carried out at 4°C.

[0044] 6) Precool PBS and dialyze the protein to remove imidazole. The dialysis time should not be less than 1 h to obtain cgd3_4260-1 and cgd3_4260-2 recombinant proteins. After dialysis, measure the protein concentration and identify the recombinant protein by SDS-PAGE and Western blot.

[0045] Example 2 Animal immunization and antibody preparation of Cryptosporidium parvum cgd3_4260-1 protein and indirect immunofluorescence detection

[0046] 1. Immunization procedures for experimental animals

[0047] New Zealand white rabbits were immunized with recombinant protein. For the first immunization, 300 μg / rabbit (recombinant protein) was emulsified with an equal volume of Freund's complete adjuvant and injected intradermally at multiple points. Two weeks after the first immunization, recombinant protein (150 μg / rabbit) was mixed with an equal volume of Freund's incomplete adjuvant and emulsified for booster immunization for a total of four times. Serum was collected from the ear vein blood before the first immunization and 14 days after the fourth immunization, and the serum was separated for subsequent testing.

[0048] 2. Indirect Immunofluorescence Detection

[0049] For environmental or clinical samples, use saturated saline or sucrose flotation to remove most bacteria and impurities before subsequent testing, and then follow the steps below;

[0050] (1) Treatment of coverslips: Treat the coverslips with 0.1 mg / mL poly-lysine for 30 min, rinse once with ddH2O, and air-dry at room temperature for 2 h.

[0051] (2) Fixing samples: Fix intact Cryptosporidium parvum oocysts with 4% paraformaldehyde at room temperature for 30 min, and wash away excess formaldehyde with PBS.

[0052] (3) Circle smear: Use a histochemical pen to draw a small circle in the center of the treated coverslip, take 30 μL of sporozoites and drop them in the small circle, and leave it at room temperature for 1 h;

[0053] (4) Washing: Aspirate the liquid on the coverslip and wash with PBS 3-4 times, 5 min each time;

[0054] (5) Primary antibody: dilute the antiserum 1:50 with PBS containing 3% BSA, take 50 μL and add it to the coverslip, incubate at room temperature for 1 hour or at 4°C overnight. (Note: For verification of oocyst wall exoprotein: incubate with the antibody for 15 minutes, and do not permeabilize the sample. If it can be stained with green fluorescence (the prepared antibody recognizes the protein), it proves that the protein is oocyst wall exoprotein.

[0055] (6) Secondary antibody: After washing with PBS, add Alexa Fluor® 488 goat anti-rabbit IgG (1:1000) to each well and incubate at 37°C in the dark for 1 h.

[0056] (7) Nuclear staining: Wash with PBS, add DAPI (4',6-diamidino-2-phenylindole) at a final concentration of 1 µg / mL to each well, stain the nuclei for 5 min at room temperature in the dark, and wash with PBS 3-4 times.

[0057] (8) Sealing: Add a drop of anti-fluorescence quencher sealing solution (Beyotime, P0126-5 mL), seal the slide with the sealing solution and observe under a fluorescence microscope.

[0058] The recombinant protein antibodies all proved that the protein was the outer wall protein of Cryptosporidium oocyst wall, and the fluorescence signal was strong, indicating that the protein has potential value for establishment (see Figure 2 ).

[0059] Example 5 Screening of Cryptosporidium parvum cgd3_4260-specific polypeptides

[0060] In order to more accurately confirm that it is the outer wall protein of the oocyst wall and to maximize the sensitivity and specificity of detection, we designed a peptide sequence with good specificity for further evidence.

[0061] (1) Search for gene number cgd4_4260 on the Cryptosporidium professional website (http: / / cryptodb.org / cryptodb / ) and download its amino acid sequence;

[0062] (2) Design of specific peptides

[0063] Screening for specific peptides:

[0064] The downloaded amino acid sequence of the gene was input into the website swissmodel.expasy.org to predict its spatial structure and find the polypeptide fragment of 10-14 amino acids located in the loop region. Then, the B cell epitope was analyzed using the iedb.org website and the fragment with higher prediction value was selected. Finally, the specific comparison analysis was performed using NCBI and the fragment with stronger specificity was selected for synthesis.

[0065] (3) In order to enhance the coupling efficiency of peptides with KLH and BSA, peptides containing cysteine ​​were selectively avoided when designing peptides, and a cysteine ​​was artificially added after the peptides without cysteine ​​at the N-terminus or C-terminus. The designed peptide sequence is: CTYDFDWKKNYIE, and the peptide was commissioned to be synthesized by Shanghai Qiangyao Biotechnology Co., Ltd.

[0066] (4) Coupling of peptides with KLH / BSA: First, dissolve 1 mg of KLH / BSA in 200 µL of ddH2O, dissolve 200 µg of MBS (m-maleimidobenzoyl-N-hydroxysuccinimide) in 0.04 mL of DMF (dimethylformamide) solution, add to the carrier protein solution, mix at RT for 2 h, and dialyze against PBS overnight. Dissolve 2 mg of peptide in 0.4 mL of PBS, add the dialyzed mixture overnight to two peptide solutions, act at RT for 4 h, dialyze for 12 h, and store in 20 µL aliquots at -20°C. Identify the coupled BSA-peptide using SDS-PAGE.

[0067] Example 6 Animal Immunization and Preparation and Titer Determination of Polyclonal Antibodies

[0068] 1. Immunization procedures for experimental animals

[0069] New Zealand white rabbits were immunized with peptide (CTYDFDWKKNYIE)-KLH after successful peptide coupling. For the first immunization, the coupled peptide (300 μg / rabbit) was emulsified with an equal volume of Freund's complete adjuvant and injected intradermally at multiple points. Two weeks later, peptide-KLH (150 μg / rabbit) was mixed with an equal volume of Freund's incomplete adjuvant and emulsified as a booster immunization for a total of four times. Serum was collected from the ear vein blood before the first immunization and 14 days after the fourth immunization, and the serum was separated for the detection of antibody titer.

[0070] 2. Indirect ELISA method to detect serum antibody titer

[0071] Indirect ELISA was performed with the coupled BSA peptide as the coating antigen, the serum before immunization as the negative control, the serum after 4 immunizations as the primary antibody, and the alkaline phosphatase (AP) labeled goat anti-rabbit IgG (H+L) as the secondary antibody. The final concentration of the coating antigen was 5 μg / mL, the serum was diluted from 1:500, the secondary antibody was diluted at 1:20000, the colorimetric solution was added, and the A405 value was detected with an enzyme-labeled instrument.

[0072] (1) Antigen coating: Dilute the successfully coupled peptide-BSA 5 µg / mL with Coating Buffer (0.05 M carbonate buffer, pH 9.6), 50 µL / well, incubate at 37°C for 1 hour, then incubate at 4°C overnight; or incubate at 37°C for two hours before proceeding to the next step.

[0073] (2) Washing: Wash the plate with Washing Buffer (0.05% Tween-20, 8 g NaCl / L) and use an ELISA plate washer to wash the plate 3-4 times, with an interval of 4 min each time.

[0074] (3) Blocking: Add 100 µL / well of Blocking Buffer (3% BSA in 0.05 M carbonate buffer, pH 9.6) and incubate at 37°C for 1 h.

[0075] (4) Wash the plate: Same as step (2).

[0076] (5) Incubation with primary antibody: dilute the antibody with Tween Buffer (PBS solution containing 0.5% BSA and 0.05% Tween-20). Use the serum before the first immunization as the negative control, the serum after the last immunization as the positive antibody, and the serum before immunization as the negative control. Dilute the antibody at a dilution multiple of 1:500, 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, and 1:32000. Add 50 µL to each well and incubate at 37°C for 1 h.

[0077] (6) Washing plate: Same as (2)

[0078] (7) Incubation with enzyme-labeled secondary antibody: Use Tween Buffer, dilute alkaline phosphatase-labeled goat anti-rabbit IgG (H+L) as secondary antibody at 1:20,000, 50 µL / well, incubate at 37°C for 1 h.

[0079] (8) Washing plate: Same as (2)

[0080] (9) Color development: Use the color development buffer to prepare 1 mg / mL color development solution (PNPP substrate color development), 50 µL / well, and develop at 37°C in the dark for 10-20 min. Then use an ELISA reader to detect the A405 reading. Use the BSA-coupled peptide as the detection coating antigen and use the ELISA method to detect the antibody titer of the rabbit serum immunized with KLH-peptide. The results are shown in Figure 3 .

[0081] After four immunizations of rabbits, the effective titer of serum reached 1:32,000 and was suitable for subsequent experiments.

[0082] Example 7 Immunoelectron microscopy labeling

[0083] Specific peptides were used for immunoelectron microscopy labeling to further verify that it was the outer wall protein of the oocyst wall.

[0084] 1. Preparation of electron microscopy samples

[0085] (1) Excystation: Cryptosporidium parvum oocysts are incubated in excystation fluid (incomplete culture medium containing 0.75% sodium taurocholate) at 37°C for 1 h.

[0086] (2) Fixation: Fix with 4% paraformaldehyde-0.1% glutaraldehyde at room temperature for 2 h, and wash three times with maleate buffer (containing 0.5 mM maleate), each time for 30 min.

[0087] (3) Block staining: Incubate the sample with maleate buffer containing 0.5% uranyl acetate at 20°C for 30 min. Wash three times with maleate buffer for 15 min each time.

[0088] (4) Agglutination: In a 50°C water bath, blow the fixed parasites evenly with completely dissolved 2% low-melting point agarose, leave at room temperature for 30 min until it is fully solidified, and then cut into 0.5 mm 3 of small pieces.

[0089] 2. Dehydration and soaking of samples

[0090] (1) Ethanol gradient dehydration: 30% alcohol at 4°C for 30 min; 50% alcohol at 4°C for 1 h; 70%, 80%, and 90% alcohol at -20°C for 1 h each; and 100% alcohol for 1 h twice.

[0091] (2) Pre-soaking: Anhydrous ethanol: LR-White (2:1) soaking at -20℃ for 1 h; Anhydrous ethanol: LR-White (1:1) soaking at -20℃ for 1 h; Anhydrous ethanol: LR-White (1:2) soaking at -20℃ for 1 h.

[0092] (3) Soaking: The samples were soaked in LR-White at -20℃ overnight; the samples were soaked in LR-White at -20℃ for 24 h; the samples were soaked in LR-White at -20℃ for 12 h.

[0093] (4) Polymerization: Use LR-White to embed the sample. Place the sample in a gelatin capsule, fill it with LR-White, and polymerize it under UV at -15℃ for 24 h.

[0094] 3. Immunolabeling

[0095] (1) Positioning and ultrathin sectioning: Semi-thin sections are 1.5 µm thick. Ultrathin sections are performed in areas rich in parasites. The thickness of the ultrathin sections is 80 nm. The sections are picked up using a copper mesh coated with aromatic film. After passing the electron microscopy examination, the sections are picked up using a nickel mesh coated with aromatic film for subsequent gold labeling.

[0096] (2) Blocking: Place the nickel mesh upside down on PBS containing 5% skim milk and 0.01% TWEEN 20 (PBS-MT) and incubate at room temperature for 1 h.

[0097] (3) Primary antibody: dilute the antibody in PBS-MT, incubate at 4°C overnight, and wash with PBS for 2 min × 8 times.

[0098] (4) Secondary antibody: Dilute Goat anti-Rabbit IgG (10 nm Gold) 1:50 in PBS-MT, incubate at 37 °C for 1 h, wash with PBS for 1 min × 4 times, and wash with deionized water for 1 min × 4 times.

[0099] (5) Post-fixation: fix with 2% glutaraldehyde tetradehyde for 10 min, and wash with deionized water for 1 min × 4 times.

[0100] (6) Staining: Place the nickel mesh in 2% uranyl acetate and stain for 15 min. Wash with deionized water for 2 min × 8 times.

[0101] Example 8 Indirect immunofluorescence detection of samples

[0102] For environmental or clinical samples, use saturated saline or sucrose flotation to remove most bacteria and impurities before subsequent testing, and then follow the steps below;

[0103] (1) Treatment of coverslips: Treat the coverslips with 0.1 mg / mL poly-lysine for 30 min, rinse once with ddH2O, and air-dry at room temperature for 2 h.

[0104] (2) Fixing samples: Fix the intact oocysts with 4% paraformaldehyde at room temperature for 30 min and wash away the excess formaldehyde with PBS.

[0105] (3) Circle smear: Use a histochemical pen to draw a small circle in the center of the treated coverslip, take 30 μL of sporozoites and drop them in the small circle, and leave it at room temperature for 1 h;

[0106] (4) Washing: Aspirate the liquid on the coverslip and wash with PBS 3-4 times, 5 min each time;

[0107] (5) Primary antibody: dilute 1 μL of anti-peptide serum 1:50 with PBS containing 3% BSA (bovine serum albumin), take 50 μL and add it to the coverslip, incubate at room temperature for 1 hour or at 4°C overnight. (Note: For verification of oocyst wall exoprotein: incubate with antibody for 15 minutes, and do not permeabilize the sample. If it can be stained with fluorescence, it proves that the protein is oocyst wall exoprotein).

[0108] (6) Secondary antibody: After washing with PBS, add Alexa Fluor® 488 goat anti-rabbit IgG (1:1000) to each well and incubate at 37°C in the dark for 1 h.

[0109] (7) Nuclear staining: Wash with PBS, add DAPI (4',6-diamidino-2-phenylindole) at a final concentration of 1 µg / mL to each well, stain the nuclei for 5 min at room temperature in the dark, and wash with PBS 3-4 times.

[0110] (8) Sealing: Add a drop of anti-fluorescence quencher, seal the slide with sealing solution and observe under a fluorescence microscope.

[0111] like Figure 4-5 As shown, the specific polypeptide antibody can sensitively and specifically identify the Cryptosporidium oocyst wall, and the polypeptide rabbit serum antibody has good sensitivity, such as Figure 6 As shown, when the serum is diluted 1:50, the fluorescence intensity is very bright. As the antibody is continuously diluted, the fluorescence intensity gradually weakens. When the serum dilution ratio is 1:800, there is still weak fluorescence. This experiment shows that the sensitivity of serum antibodies is very good.

[0112] (Note: For the verification of the outer wall protein of the oocyst wall: the antibody is incubated for 15 minutes, and the sample is not permeabilized (tritol, SDS and other reagents), that is, the antibody can only recognize the protein on the outer wall of the oocyst wall. At this time, if the fluorescence intensity of the antibody corresponding to the protein is relatively obvious, it means that the protein recognized by the antibody is the outer wall protein of the oocyst wall).

[0113] In the detection of samples in the environment, such as Figure 7 As shown, the peptide antibody only recognizes Cryptosporidium oocysts (Cryptosporidium parvum and Cryptosporidium tyzeri in the above picture) and does not cross-react with other species (Escherichia coli, coccidia, etc.), indicating that the antibody has good specificity.

[0114] Therefore, the oocyst wall protein was selected as a candidate antigen, and it has great potential as a diagnostic reagent for detecting Cryptosporidium in environmental water samples or clinical specimens.

Claims

1. A polypeptide specific to the Cryptosporidium cgd3_4260 protein, the amino sequence of which is: CTYDFDWKKNYIE.

2. A polyclonal antibody against a Cryptosporidium cgd3_4260 protein-specific polypeptide, characterized in that: The polyclonal antibody is prepared by coupling the Cryptosporidium cgd3_4260 protein-specific polypeptide described in claim 1 with KLH / BSA.

3. Use of the polyclonal antibody against the Cryptosporidium cgd3_4260 protein-specific polypeptide according to claim 2 in the preparation of a reagent for detecting Cryptosporidium.

4. The use according to claim 3, characterized in that: The Cryptosporidium is an unbroken Cryptosporidium oocyst.

Images