A kind of African clawed frog oocyte expression vector pGXBG

Abstract

The present invention relates to an African clawed frog oocyte expression vector pGXBG. X.lavies oocytes are widely used for protein expression and ion transporter identification in structural biology, developmental biology, electrophysiology and neurobiology. However, the vector cRNA translation efficiency of the existing restriction enzyme ligation or Gateway cloning method is not stable enough, and experiments cannot be strictly repeated. The present invention improves the translation efficiency by updating the Kozak sequence in the vector pGEMHE and creating a new X.lavies oocyte expression vector pGXBG series. Further TEVC experiments in X.lavies oocytes prove that the vector of the present invention provides a more stable and higher cRNA translation efficiency by expressing channel proteins in X.lavies oocytes to record larger and more stable current amplitudes.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to an African clawed frog oocyte expression vector pGXBG And the construction method of the expression vector. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] X. lavies Oocytes are important tools for studying ion channels and transporters, aquaporins, protein expression, mRNA localization, genome editing, cytoskeleton, cell growth and meiosis. It was first demonstrated in 1971 that it has the ability to translate exogenous mRNA. Subsequent studies have shown that the cell has the advantages of large single-cell volume, large energy and protein storage, strong ability to synthesize protein, low background activity, and very high signal-to-noise ratio, making it particularly suitable for heterologous protein expression and electrophysiological analysis. These functions can only be achieved with the injection and translation of target gene cRNA produced by in vitro transcription of the target gene's cDNA. Oocyte expression vector pGEMHE It is one of the most widely used vectors for cRNA production and oocyte expression. + Electrophysiological analysis of the KV1.1 channel. In the following 29 years, this vector was disseminated to almost all research groups involved in heterologous expression in oocytes and widely adapted with different tags for different purposes, such as for protein subcellular localization. pGEMHE-mCherry and pGEMHE-EGFP as well as pGEMHE- YFP N and pGEMHE-YFP C For these reasons, pGEMHE The vectors and their modifications have made great contributions to structural biology, developmental biology, electrophysiology, and neurobiology. pGEMHEIt has brought great achievements to biology, but it does not provide a very stable system for protein expression in oocytes. Taking the TEVC current size recording of channel proteins expressed in oocytes as an example, the current recorded under the same conditions for the same channel shows significant differences in different batches of experiments. For example, the conductance size of the S-type anion channel SLAC1 activated by the Arabidopsis kinase OST1 can vary by more than two times in different frog eggs; in addition, the data of its current in oocytes in different experimental batches in the same paper also vary greatly; and the Arabidopsis K + The absolute value of the potassium current mediated by the channel AKT1 in oocytes has orders of magnitude differences in different graphs in the same document. The above-mentioned unstable channel current phenomenon appears in many documents. At the same time, the inventor's research also found that after injecting the same amount of cRNA into different frog eggs in the same batch, the current size recorded by TEVC of each individual cell was very different, and some even had no channel activity. The expression efficiency of oocyte expression experiments is unstable. After a series of hard work such as cRNA in vitro transcription, surgery and oocyte collection, and cRNA injection, the researchers are powerless and can only hope to obtain good expression results. Summary of the invention

[0004] In view of the poor stability of oocyte expression experiments, the present invention constructs a new expression vector pGXBG The expression vector has a higher and more stable protein expression efficiency and can effectively improve X. lavies Success rate of heterologous protein expression in oocytes.

[0005] Based on the above technical effects, the present invention provides the following technical solutions:

[0006] In a first aspect, the present invention provides an African clawed frog oocyte expression vector pGXBG , the expression vector consists of pGEMHE The vector skeleton is modified. Compared with the vector before modification, pGXBG The sequence between the endonuclease KpnⅠ and BsmFⅠ sites is replaced, and the replaced sequence at least includes the following Xenopus globin 5'-UTR, STP and Xenopus globin 3'-UTR sequences;

[0007] Xenopus globin 5'-UTR: cttgttctttttgcagaagctcagaataaacgctcaactttggcc (SEQ ID NO: 1)

[0008] STP: catggctgatcaacccgatcaacggtagatc(SEQ ID NO:2)

[0009] Xenopus globin 3'-UTR: taaaccagcctcaagaacacccgaatggagtctctaagctacataataccaacttacactttacaaaatgttgtcccccaaaatgtagccattcgtatctgctcctaataaaaagaaagtttcttcacattct (SEQ ID NO: 3).

[0010] The Kozak sequence is a nucleic acid sequence located after the 5' end of mRNA and plays an important role in the initiation of the translation process. The Kozak sequence in vertebrates is GCCA(G)CCAUGG, especially the -3 (A or G) and +4 nucleotides, which are more important than other positions. In order to improve the protein expression efficiency in oocytes, the inventors checked the sequences of existing African clawed frog oocyte expression vectors and found that the Kozak sequence in the traditional vector would be destroyed during the construction of the restriction enzyme ligation or Gateway cloning method, so that other nucleotides were added between 5'UTR and ATG, affecting the protein expression efficiency. As shown in Figure 1A, pGEMHE After the vector was constructed, the GGCC at the end of the 5'-UTR was interrupted by AGATCAATTC, which may be the cause of unstable or inefficient gene translation. In order to obtain a more efficient and stable expression vector in African clawed frogs, the present invention uses the Gibson assembly method to achieve seamless cloning repair pGEMHE Kozak sequence in the vector pGXBG In this way, no sequence will be inserted between 5'UTR and ATG. Its structure and important sequences are as follows Figure 1 As shown in B, the present invention creates two restriction sites (XhoⅠ and BglⅡ) and STP between the two restriction sites, making it more suitable for molecular cloning. pGXBG When assembled by the Gibson assembly method, -4G, -3G, -2C, -1C (after 5'-UTR, Figure 1 A) Combined with the AUG codon of the gene to form a complete conservative X. laevis In order to expand the application of the vector, the present invention also prepared another pair of expression protein-YFP N and protein-YFP C The carrier ( Figure 1 C), digested with XhoⅠ / NcoⅠ pGXBG , linkers and YFP N / C The formation mechanism of the Kozak sequence is the same as mentioned above.pGXBG-YFP N and pGXBG-YFP C It can be used in the Xenopus laevis BiFC system to achieve efficient and stable expression of target genes.

[0011] The above expression vector pGXBG In the present invention, a site is designed between the STP sequence and the 3'-UTR of the African clawed frog globin protein to insert other fusion proteins, wherein the fusion proteins include but are not limited to detectable markers, cytotoxins, radioactive isotopes, biologically active proteins, targeting molecules or a combination thereof; in particular, fluorescent proteins, such as green fluorescent protein (GFP) or yellow fluorescent protein (YFP).

[0012] In the above preferred embodiment, there is a linker between the marker protein gene and the STP sequence, and the sequence of the linker is as follows: ggattaaacctcagcctgggtagcggtggacat (SEQ ID NO: 4).

[0013] The expression vector of the present invention pGXBG The replaced sequence is the African clawed frog globin 5'-UTR, STP and African clawed frog globin 3'-UTR sequence connected in sequence from 5' to 3', that is, replaced with the f3RD sequence; in this series of embodiments, the expression vector pGXBG The sequence is shown in SEQ ID NO:5.

[0014] The present invention verifies the pGXBG-YFP N and pGXBG-YFP N The replaced sequence is the African clawed frog globin 5'-UTR, STP, Linker, marker gene and African clawed frog globin 3'-UTR sequence connected in sequence from 5' to 3', wherein the marker gene is YFP protein, including N-terminal tag (YFP N ) and C-terminus (YFP C ) labeling method; among them, the expression vector with YFP N terminus is named pGXBG-YFP N , the expression vector pGXBG-YFP N The sequence of is shown in SEQ ID NO:6; the expression vector with YFP C-terminus is named pGXBG-YFP C , the expression vector pGXBG-YFP C The sequence is shown in SEQ ID NO:7.

[0015] The second aspect of the present invention is pGXBGA method for constructing a vector, wherein the method constructs the target fragment into the expression vector described in the first aspect pGXBG For protein expression in Xenopus laevis oocytes.

[0016] The specific steps of the expression method are as follows: obtaining the nucleic acid sequence of the target protein and amplifying it to obtain the target gene fragment, using BglⅡ and XhoⅠ restriction endonucleases to cleave the expression vector described in the first aspect. pGXBG Double enzyme digestion was performed, and the expression vector after double enzyme digestion was mixed with the target gene fragment by Gibson assembly method to obtain a recombinant vector, and the recombinant vector was transferred into competent cells for culture and then positive clones were screened.

[0017] The above-mentioned Gibson assembly method is also called the Gibson isothermal one-step assembly method, which utilizes the synergistic action of T5 exonuclease, DNA polymerase and ligase to assemble multiple DNA fragments with terminal overlapping sequences in vitro. The assembly process can be achieved based on conventional means in the art, such as assembly based on commercially available kits.

[0018] The beneficial effects of one or more of the above technical solutions are:

[0019] X. lavies Heterologous protein expression in oocytes has a wide range of uses in biochemistry, cell biology and physiological research. However, the experiment has a high failure rate and is difficult to repeat stably. People have always attributed the failure of oocyte protein expression to the poor condition of experimental animals and oocytes. In this study, the inventors found that the damage to the vector kozak sequence by enzyme cutting and GATEway method construction is another limiting factor for protein expression efficiency and stability. In addition, the present invention repairs the kozak sequence by modifying the expression vector sequence and construction method, thereby improving the expression efficiency of the system. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0021] Figure 1 pGXBG Schematic diagram of the structure and sequence of the series of vectors;

[0022] in, Figure 1 A is pGXBG and pGEMHE comparison and sequence details;

[0023] Figure 1 B is pGXBG The structure of the vector;

[0024] Figure 1 C is pGXBG-YFP N and pGXBG-YFP C The structure of the vector;

[0025] Figure 2 for pGXBG Enhanced K + Expression of channel KAT1;

[0026] in, Figure 2 A is the whole-cell two-electrode voltage clamp recording of potassium current in African clawed frog oocytes. The two groups of oocytes were injected with pGXBG and pGEMHE KAT1 cRNA transcribed from two vectors;

[0027] Figure 2 B is the current-voltage (IV) relationship of whole-cell two-electrode voltage-clamp recordings of Xenopus oocytes; data are from the recordings shown in (A) and are expressed as mean ± SD;

[0028] Figure 3 pGXBG enhanced the expression of the OST1 kinase-activated anion channel SLAC1;

[0029] in, Figure 3 A shows whole-cell two-electrode voltage clamp anion current recordings of Xenopus oocytes expressing OST1-YN and SLAC1-YC. cRNAs were respectively obtained from vectors pGXBG and pGEMHE Transcription;

[0030] Figure 3 B is the current-voltage (IV) relationship of whole-cell two-electrode voltage clamp recordings of Xenopus oocytes; data are from the recordings shown in (A) and are expressed as mean ± SD;

[0031] Figure 3 C is injected from pGXBG and pGEMHE BiFC interaction between OST1-YN and SLAC1-YC in oocytes transcribed cRNA;

[0032] Figure 4 For the present invention pGXBG Maps of the series of vectors;

[0033] in, Figure 4 A is pGXBG Vector map;

[0034] Figure 4 B is pGXBG-YFP CVector map;

[0035] Figure 4 C is pGXBG-YFP N Vector map;

[0036] Figure 4 D is pGXBG-KAT1 Vector map. DETAILED DESCRIPTION

[0037] It should be noted that the following detailed descriptions are all illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0038] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0039] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0040] Example 1

[0041] Materials and methods

[0042] Strains and culture media

[0043] The plasmids were maintained in the E. coli strain DH5α and cultured in LB medium containing ampicillin as required for plasmid maintenance.

[0044] Plasmid construction

[0045] Encoding Xenopus laevis globin 5'-UTR, STP , Linker , YFP N / YFP C Xenopus laevis globin 3'-UTR The DNA fragments were synthesized by Sangon Biotech (Shanghai, China). pGXBG-YFP N is through fragYFP N DNA fragments (including Xenopus globin 5'-UTR, STP, Linker, YFP N Xenopus laevis globin3'-UTR ) cloned into KpnⅠ / BsmfⅠ-digested pGEMHE By placing a DNA fragment f3RD (including Xenopus laevis globin 5'-UTR, STP Xenopus laevis globin 3'-UTR ) were cloned into pGEMHE digested with KpnⅠ / BsmfⅠ to create the vector pGXBG. All DNA fragments were assembled into the vector using a one-step cloning kit (Vazyme Biotech Co., Ltd). pGEMHE In plasmid.

[0046] pGXBG-OST1-YFP N and pGXBG-SLAC1-YFP C In OST1 and SLAC1 The gene was originally derived from Arabidopsis thaliana and was isolated from a plasmid OST1-YFP N and SLAC1-YFP C (based on pGEMHE The vector was amplified from 1:1 vector and provided by Professor Rainer Hedrich of the University of Würzburg, Germany. pGXBG-KAT1 In KAT1 The gene was originally derived from Arabidopsis thaliana and was isolated from a plasmid pGEMHE-KAT1 The plasmid was amplified pGEMHE-KAT1 All genes were assembled into XhoⅠ / BglⅡ digested pGXBG or XhoⅠ / NcoⅠ digested pGXBG-YFP N / pGXBGYFP C The restriction enzymes used in this example were purchased from New England Biolabs.

[0047] 1. Construction of pGXBG vector

[0048] Experimental Materials: PrimeSTAR Max DNA Polymerase Kit was purchased from TaKaRa, AxyPrep DNA gel recovery kit was purchased from AXYGEN, KpnⅠ and BsmFⅠ restriction endonuclease kits were purchased from NEB, ClonExpress II One Step Cloning Kit and DH5α Escherichia coli competent cells were purchased from Novazonics.

[0049] Experimental steps: Whole gene synthesis optimized fragments 1) Design optimization pGEMHEThe sequence of the vector was synthesized by whole gene synthesis method, and the fragment f3RD included the African clawed frog globin 5’-UTR , STP and Xenopus globin 3’-UTR , synthesized by Shanghai Sangon Biotechnology Co., Ltd. and purified by PAGE.

[0050] >f3RD, the sequence is shown in SEQ ID NO:8.

[0051] 2) The amplification primers of f3RD sequence were designed and synthesized by Shanghai Sangon Biotechnology Co., Ltd. and purified by PAGE.

[0052]

[0053] 3) Using TaKaRa's PrimeSTAR Max DNA Polymerase Kit, add the following components to a 200 μL PCR tube to prepare a 40 μL reaction system.

[0054]

[0055] 4) Set up the PCR amplification reaction program according to the instructions of the PrimeSTAR Max DNA Polymerase Kit.

[0056] 5) Perform agarose gel electrophoresis on the PCR amplification product and detect the target band in a UV gel imaging system. Cut the target band and recover the target fragment.

[0057] 2.2 pGEMHE Enzyme digestion and recovery of plasmid vector

[0058] 1) Use restriction endonucleases KpnⅠ and BsmFⅠ to pGEMHE The plasmid was double-digested and the following components were added to a 200 μL PCR tube to prepare a 50 μL reaction system.

[0059]

[0060] Mix the above reaction system, and then place the reaction system in a 37℃ incubator for 30 min, and then place the system in a 65℃ incubator for 30 min. pGEMHE Linearization of plasmids;

[0061] 2) Linearize pGEMHE The plasmid was detected by agarose gel electrophoresis, and then the target band was detected in a UV gel imaging system. The target band was cut from the gel and the target fragment was recovered.

[0062] 2.3 ReorganizationpGXBG Vector ligation transformation

[0063] 1) The recovered f3RD product is mixed with pGEMHE The vector product was recombined using the ClonExpress II One Step Cloning Kit from Novozymes. The following components were added to a 200 μL PCR tube to prepare a 20 μL reaction system.

[0064]

[0065] Mix the above reaction system and keep it in a 37℃ incubator for 30 min. pGXBG Connection of carrier.

[0066] 2) Will reorganize pGXBG The vector was transformed into DH5α E. coli competent cells, cultured overnight and single clones were picked for sequencing.

[0067] Experimental results Sequencing results showed that the recombinant pGXBG The vector contains the complete f3RD gene sequence. pGXBG The base sequence is shown in SEQ ID NO.5.

[0068] 3.1 X. lavies cRNA synthesis and TEVC recording in oocytes

[0069] cRNA was synthesized using RiboMAX™ Large Scale RNA Production System-T7 (Promega), and Xenopus laevis was purchased from Professor Shen Wanhua of Hangzhou Normal University. The amplifier used for the two-electrode voltage clamp recording of Xenopus laevis oocytes was MultiClamp™ 700B, the recording software was Axon Clampex 11, and the digital-to-analog converter was Digidata 1550 (Molecular Devices, San Jose, CA, USA). Oocytes were injected with 46 ng of cRNA and incubated in ND96 solution for 2 days. Then the current was recorded using a two-electrode voltage clamp.

[0070] 3.2 pairs pGXBG Modification of series vectors

[0071] 2. With YFP N YFP C Gene expression vector pGXBG-YFP N and pGXBG-YFP C Construction

[0072] The experimental materials are the same as those in 3.1 above.

[0073] Experimental steps: Whole gene synthesis of fragYFPn and fragYFPc fragments and cloning 1) Whole gene synthesis was used to synthesize the fragments fragYFPn and fragYFPc, which included the 5'-UTR, STP, Linker, YFP, and 5'-UTR of African Xenopus globin. N / C and Xenopus laevis globin 3′-UTR, synthesized by Shanghai Sangon Biotechnology Co., Ltd., and purified by PAGE.

[0074] >fragYFPn, the sequence of which is shown in SEQ ID NO:11;

[0075] >fragYFPc, the sequence of which is shown in SEQ ID NO:12.

[0076] The amplification primers of fragYFPn and fragYFPc sequences were designed and synthesized by Shanghai Sangon Biotechnology Co., Ltd. The purification method was PAGE.

[0077] 3. Vector construction

[0078] The method and steps of vector construction are the same as those in 3.1 above. pGXBG-YFP N and pGXBG-YFP C The sequences are shown in SEQ ID NO.6 and 7 respectively.

[0079] 3. Arabidopsis thaliana Arabidopsis thaliana ) Protein kinase OST1 Gene expression vector pGXBG-OST1- YFP N Construction

[0080] The experimental materials are the same as those in 3.1 above.

[0081] Experimental procedures OST1

[0082] Cloning of gene coding region base sequence 1) Download Arabidopsis thaliana from NCBI website OST1 The nucleic acid sequence of the gene was synthesized by Shanghai Sangon Biotechnology Co., Ltd. and purified by PAGE.

[0083]

[0084] 2) pGEMHE-YFP N -OST1 Vector as template for cloning OST1Gene, cloning steps are the same as above 3.1.

[0085] 2.2 pGXBG-YFP N -OST1 Plasmid vector construction

[0086] The process of constructing vector recombinantly is the same as that in 3.1 above.

[0087] 4. Arabidopsis thaliana ( Arabidopsis thaliana ) SLAC1 Gene expression vector pGXBG-SLAC1-YFP C Construction

[0088] The experimental materials are the same as those in 3.1 above.

[0089] Experimental Procedure 2.1 SLAC1 Cloning of the base sequence of the gene coding region

[0090] 1) Download Arabidopsis thaliana from NCBI website SLAC1 The nucleic acid sequence of the gene was synthesized by Shanghai Sangon Biotechnology Co., Ltd. and purified by PAGE.

[0091]

[0092] 2) pGEMHE-YFP C -SLAC1 Vector as template for cloning SLAC1 Gene, cloning steps are the same as above 3.1.

[0093] 2.2 pGXBG-YFP C -SLAC1 Plasmid vector construction

[0094] The process of constructing vector recombinantly is the same as that in 3.1 above.

[0095] 5. Arabidopsis thaliana ( Arabidopsis thaliana ) KAT1 Gene expression vector pGXBG-KAT1 Construction

[0096] The experimental materials are the same as those in 3.1 above.

[0097] Experimental Procedure 2.1 KAT1 Cloning of the base sequence of the gene coding region

[0098] 1) Download Arabidopsis thaliana from NCBI website KAT1 The nucleic acid sequence of the gene was synthesized by Shanghai Sangon Biotechnology Co., Ltd. and purified by PAGE.

[0099]

[0100] 2) pGEMHE-KAT1 Vector as template for cloning KAT1 Gene, cloning steps are the same as above 3.1.

[0101] 2.2 pGEMHE-KAT1 Plasmid vector construction

[0102] The vector recombination construction process is the same as in 3.1 above, and the vector map is as follows Figure 4 As shown in D.

[0103] 6. Arabidopsis thaliana Arabidopsis thaliana ) OST1 , SLAC1 and KAT1 Gene Expression in Xenopus laevis Oocytes

[0104] Experimental MaterialsRiboMAX TM Large Scale RNA Production System-T7 and Ribo m 7 G CapAnalog kit was purchased from Promega.

[0105] Experimental procedure 2.1 In vitro synthesis of cRNA

[0106] Promega's RiboMAX TM cRNA was synthesized in vitro using the Large Scale RNA Production System-T7 kit and stored in a -80°C ultra-low temperature refrigerator for future use.

[0107] 2.2 Acquisition of Xenopus oocytes and injection of cRNA

[0108] Experimental Results 3.1 pGXBG The carrier does improve X. lavies Expression efficiency and stability in oocytes

[0109] For testing pGXBG The improvement of oocyte expression efficiency and stability by a series of vectors is compared in this example. pGXBG or pGEMHE First, this example examined the presence of a cRNA localized to the plasma membrane of Arabidopsis guard cells. Shaker family potassium channel KAT1. TEVC recordings showed that injection from pGXBG-KAT1 The current of oocytes transcribed cRNA is stronger than pGEMHE-KAT1 (Figure 1). Then we examined the slow anion channel SLAC1 located in the plasma membrane of Arabidopsis guard cells, which requires the co-expression of the kinase OST1 to be active. pGXBG-YFP N and pGXBG-YFP C As shown in Figure 3, from pGXBG-YFP N and pGXBG-YFP C OST1-YFP N + SLAC1-YFP C The current amplitude is pGEMHE The vector was twice as large as that of the control vector, and both systems showed interaction signals of bimolecular fluorescence complementation in oocytes. In addition, the current amplitude greater than -10μA at -160 mV was defined as "effective expression" in oocytes. pGXBG-YFP N and pGXBG- YFP C The system efficiency is 100%, and pGEMHE The system's efficiency is 45.82%. In short, pGXBG The vectors were more stable and efficient in oocyte expression, whether cation or anion channels, and channels expressed alone or together with activator proteins.

[0110] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An African clawed frog oocyte expression vector ikB , characterized in that, The expression vector is pGEMHE The vector skeleton is modified. Compared with the vector before modification, ikB Endonuclease Kpn Ⅰ and Bf The sequence between the I sites is replaced, and the replaced sequence at least includes the following African clawed frog globin 5'-UTR, STP and African clawed frog globin 3'-UTR sequences; the expression vector ikB The replaced sequence is the African clawed frog globin 5'-UTR, STP and African clawed frog globin 3'-UTR sequence connected in sequence from 5' to 3' direction, and the expression vector ikB The sequence is shown in SEQ ID NO:

5.

2. The African clawed frog oocyte expression vector as claimed in claim 1 ikB , characterized in that, The expression vector ikB In the method, there is also a functional molecule between the STP sequence and the 3'-UTR of the African clawed frog globin protein, wherein the functional molecule includes but is not limited to a detectable marker, a cytotoxin, a radioactive isotope, a biologically active protein, a targeting molecule or a combination thereof.

3. The African clawed frog oocyte expression vector as claimed in claim 2 ikB , characterized in that, The functional molecule is a marker protein gene, and the marker protein is a fluorescent protein.

4. The African clawed frog oocyte expression vector as claimed in claim 3 ikB , characterized in that, The fluorescent protein is green fluorescent protein or yellow fluorescent protein.

5. The African clawed frog oocyte expression vector as claimed in claim 3 ikB , characterized in that, There is also a linker between the marker protein gene and the STP sequence, and the sequence is shown in SEQ ID NO:

4.

6. An African clawed frog oocyte expression vector pGXBG, characterized in that: Said ikB The replaced sequences of African clawed frog globin 5'-UTR, STP, Linker, marker gene and African clawed frog globin 3'-UTR sequence are sequentially connected from 5' to 3', and the marker gene is YFP protein, including N-terminal labeling and C-terminal labeling; wherein the expression vector with YFP N-terminus is named pGXBG-YFP N , the expression vector pGXBG-YFP N The sequence of is shown in SEQ ID NO:6; the expression vector with YFP C-terminus is named pGXBG-YFP C , the expression vector pGXBG-YFP C The sequence is shown in SEQ ID NO:

7.

7. A method for expressing a heterologous protein, characterized in that: The expression method comprises using the Xenopus laevis oocyte expression vector according to any one of claims 1 to 5 ikB Construct a target protein expression system; the specific steps of the expression method are as follows: obtain the nucleic acid sequence of the target protein and amplify it to obtain the target gene fragment, XOt Ⅰ and Bgl II restriction endonuclease for the expression vector according to any one of claims 1 to 5 ikB Perform double enzyme digestion, and mix and incubate the expression vector after double enzyme digestion with the target gene fragment using the Gibson assembly method to obtain a recombinant vector; Or, the expression method comprises using the expression vector according to claim 6 pGXBG-YFP N or pGXBG-YFP C Construct a target protein expression system; the specific steps of the expression method are as follows: obtain the nucleic acid sequence of the target protein and amplify it to obtain the target gene fragment, XOt Ⅰ and Nco I restriction endonuclease for the expression vector according to claim 6 pGXBG-YFP N or pGXBG-YFP C Double enzyme digestion was performed, and the expression vector after double enzyme digestion was mixed and incubated with the target gene fragment using the Gibson assembly method to obtain a recombinant vector.

8. The method for expressing heterologous protein according to claim 7, characterized in that: The expression method further comprises transferring the recombinant vector into competent cells, culturing them and then screening positive clones.

Images