Framework nucleic acid nanocapture device that can specifically remove target molecules

Abstract

The present invention discloses a framework nucleic acid nano-capture device that can specifically remove target molecules. The present invention utilizes DNA origami structures such as DNA nano-barrels, regular icosahedrons or truncated regular icosahedrons (soccer balls), to modify the removal elements that specifically bind to the target molecules, thereby obtaining a framework nucleic acid nano-capture device that can specifically remove target molecules. The nucleic acid nano-capture device can efficiently remove target molecules in vitro and in vivo, thereby affecting downstream biological effects. It can be specifically used to enhance cellular immune function, and to prepare anti-tumor functional products in combination with existing anti-tumor drugs. Biological experimental results show that the framework nucleic acid nano-capture device that targets and removes TGF-β1 protein in combination with immune checkpoint inhibitors has good anti-tumor effects and is safe and non-toxic in vivo. The framework nucleic acid nano-capture device of the present invention shows good medical prospects.

Description

Technical Field

[0001] The present invention relates to a framework nucleic acid nanocapture device capable of specifically clearing target molecules, and in particular to a DNA nanoframework (DNF) that clears target molecules with biological activity in vivo and in vitro, thereby regulating downstream biological signals, and belongs to the field of DNA nanotechnology. Background Art

[0002] Numerous trace but crucial effector molecules exist within organisms, performing diverse functions within the complex biological environment. Examples include low-density lipoproteins (LDLs), which transport lipids; various cytokines and neurotransmitters, which function as signaling agents; and coagulation factors involved in blood coagulation. When these effector molecules are in equilibrium, the body's physiological processes function normally. However, when imbalanced, homeostasis is disrupted, leading to the onset of various pathological processes. By regulating these imbalanced effector molecules and restoring them to equilibrium, a series of downstream pathophysiological states are restructured.

[0003] Take cytokines, for example. Cytokines are generally produced by stimulated cells, primarily immune cells. Cytokines are highly effective, acting at micromolar or even picomolar levels. They exert powerful immunomodulatory effects and are crucial to human physiological and pathological changes. As molecular messengers, cytokines allow immune system cells to communicate with each other to coordinate responses to target antigens, and they have regulatory and effector functions in many diseases. However, in clinical practice, the development of cytokine therapeutic drugs is hampered by a variety of issues. Currently, cytokine therapy faces the following major challenges: 1) the widespread cellular pleiotropy of cytokines, which causes systemic inflammatory responses in the body; 2) cytokine toxicity due to off-target effects; and 3) a relatively short half-life.

[0004] DNA nanotechnology enables precise manipulation of molecules at the nanometer scale. Micromolar or picomolar effector molecules in vivo fit perfectly within the precise manipulation range of DNA nanotechnology, allowing them to be adjusted within a safe range and avoiding systemic toxic reactions caused by drastic adjustments. Furthermore, customized external modifications can be made to DNA framework nucleic acid nanostructures to enhance their locational targeting, thereby reducing the toxic effects of small molecule inhibitors or monoclonal antibodies. Therefore, utilizing DNA nanotechnology to construct DNA nanoscavenger devices for the regulation of target molecules is feasible and highly meaningful. Summary of the Invention

[0005] The technical problem to be solved by the present invention is: in order to solve the problem of systemic inflammatory response and high toxicity caused by cytokine therapy, the present invention provides a class of DNA framework nucleic acid nanostructures for quantitatively clearing cytokines that have a negative immunoregulatory effect in the circulation, thereby achieving the purpose of regulating the body's immune response.

[0006] In order to solve the above technical problems, the present invention provides a framework nucleic acid nanocapture device that can specifically clear target molecules. The nucleic acid nanocapture device is a DNA origami structure modified with a clearance element; the clearance element is any one of a nucleic acid aptamer, a polypeptide, and an antibody that can specifically bind to the target molecule; the target molecule is an immunosuppressive cytokine (a cytokine that has a negative immune regulatory effect);

[0007] The DNA origami structure is a DNA nanobarrel, icosahedron or truncated icosahedron (football-shaped) structure constructed using DNA origami technology. It is assembled by hybridizing a long circular sequence of recombinant M13 phage genomic DNA single strand (p7560) and a short sequence of staple chains and a capture staple chain (anchor sequence) used to modify the clearance element according to the principle of base complementary pairing.

[0008] All the "staple chains" on the sides of the three-dimensional structure can be selected as modification sites, and the selected modification sites extend an anchor sequence inside or outside the structure to carry the clearance element. The molecular weight of the DNA origami structure is about 5×10 6 Dalton, with an external sphere diameter greater than 30 nanometers, and the interior and exterior of the structure clearly distinguishable. Compared to previous framework structures composed of several single chains, such as regular tetrahedrons and cuboids, origami structures are larger in size and have more modifiable sites, allowing for precise modification with controlled quantity and position.

[0009] Preferably, the target molecule is any one of transforming growth factor (TGF-β1), vascular endothelial growth factor (VEGF), interleukin 6 (IL-6), interleukin 10 (IL-10), oxidized low-density lipoprotein (ox-LDL) and lipopolysaccharide (LPS).

[0010] The present invention also provides a method for preparing the framework nucleic acid nanocapture device capable of specifically removing target molecules, comprising: constructing a DNA origami structure using DNA origami technology, assembling a nucleic acid aptamer, a polypeptide or an antibody onto a complementary sequence of an anchor sequence, and performing internal modification on the DNA origami structure to remove motifs;

[0011] The assembly method of the nucleic acid aptamer includes: directly adding the nucleic acid sequence to be modified to the end of the complementary sequence, and using molecular hybridization to bind the complementary sequence to the anchor sequence to fix the nucleic acid molecule to be assembled inside the structure;

[0012] The method for assembling the polypeptide or antibody comprises: connecting the protein or polypeptide with a complementary sequence by using a bioorthogonal reaction, a chemical reaction or a protein coupling reaction, and fixing the polypeptide or antibody inside the structure by combining the complementary sequence with an anchor sequence by using a molecular hybridization method.

[0013] The bioorthogonal reaction includes but is not limited to click chemistry reaction; the chemical reaction includes but is not limited to chemical reactions such as maleimide-thiol Michael addition reaction; the coupling reaction includes but is not limited to coupling using biotin-streptavidin, Ni-NTA-Histag, antibody-antigen, nucleic acid aptamer-protein, DNA binding protein (such as zinc finger protein), SPDP, Sulfo-SMCC, SNAP-tag, and Hag-tag.

[0014] The present invention also provides the use of the framework nucleic acid nano-capture device capable of specifically clearing target molecules in clearing target molecules in vitro.

[0015] The present invention also provides the use of the framework nucleic acid nanocapture device capable of specifically clearing target molecules in the preparation of a product for enhancing the immune function of immune cells.

[0016] The present invention also provides a framework nucleic acid nanocapture device for targeted removal of TGF-β1 protein, which is a DNA origami structure modified with a nucleic acid aptamer T8-1-3; the nucleic acid aptamer T8-1-3 can specifically bind to the TGF-β1 protein;

[0017] The DNA origami structure is a DNA nanobarrel, icosahedron or truncated icosahedron (football-shaped) structure constructed using DNA origami technology. It is assembled by hybridizing a long circular sequence of recombinant M13 phage genomic DNA single strand (p7560) and a short sequence of staple chains and a capture staple chain (anchor sequence) used to modify the clearance element according to the principle of base complementary pairing.

[0018] The present invention also provides the use of the framework nucleic acid nanocapture device for targeted clearance of TGF-β1 protein in the preparation of a product for enhancing the immune function of immune cells.

[0019] The present invention also provides the use of the above-mentioned framework nucleic acid nanocapture for targeted clearance of TGF-β1 protein in combination with the immune checkpoint inhibitor aPD-L1 in the preparation of anti-tumor products.

[0020] Preferably, the framework nucleic acid nanocapture device is a DNA nanobarrel origami structure modified with nucleic acid aptamer T8-1-3.

[0021] Preferably, the tumor includes any one of lung cancer, colorectal cancer, gastric cancer, melanoma, renal cell carcinoma and Hodgkin's lymphoma.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] (1) The framework nucleic acid nanocapture provided by the present invention, which can specifically remove target molecules, is based on a specific DNA origami structure and can carry different numbers of removal elements such as aptamers, peptides, and antibodies. It has a high degree of designability and quantitative removal ability for target proteins. In addition, the removal elements are anchored and modified within the framework, which can achieve a high local concentration within a confined space and protect the internal molecules. It is an excellent nanomaterial for biomedical applications.

[0024] (2) The nucleic acid nanocapture device of the present invention can successfully induce downstream biological effects at both the cellular and animal levels. After clearing the target molecules in the body, it will not cause systemic inflammation and toxicity, thereby effectively improving the toxic reactions caused by traditional small molecule inhibitors. The results of biological experiments show that the nucleic acid nanocapture device of the present invention combined with immune checkpoint inhibitors to treat tumor-bearing mice has a significant tumor inhibition effect, the tumor volume is significantly reduced, and the tumor weight after dissection is significantly reduced. The nucleic acid nanocapture device shows good medical prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 A schematic diagram of the structure of the DNA nanoframe used in the present invention and a list of its different features;

[0026] Figure 2 This is a list of annealing procedures for modifying the clearance element onto three different DNA nanoframe structures according to an embodiment of the present invention;

[0027] Figure 3 is a list of target molecules that can be specifically removed by the framework nucleic acid nanocapture device of the present invention;

[0028] Figure 4 Schematic diagram and electron micrograph of the nucleic acid nanocapture device constructed in an embodiment of the present invention and its captured protein;

[0029] Figure 5 Schematic diagram of in vitro and in vivo clearance of the immunosuppressive cytokine transforming growth factor TGF-β1 using a nucleic acid nanocapture constructed by modifying three DNA nanoframe structures with nucleic acid aptamers T8-1-3 as an example;

[0030] Figure 6Figure 1 shows the experimental results of the nucleic acid nanocapture constructed by modifying the nucleic acid aptamer T8-1-3 with three DNA nanoframe structures in an embodiment of the present invention, which enhanced the immune cell killing function after scavenging TGF-β1 in an in vitro cell culture system; a: confocal micrograph; b: flow cytometric analysis of the proportion of dead tumor cells in each group after co-incubation with the target molecule; c: flow cytometric analysis of the proportion of dead tumor cells in each group after treatment in the PBMC system; d: flow cytometric analysis of the proportion of dead tumor cells in each group after treatment in the T cell system; *: p < 0.05, **: p < 0.01; ns: no significant difference;

[0031] Figure 7 Figure 1 shows the efficiency of TGF-β1 removal in tumor-bearing mice by using a nucleic acid nanocapture device constructed using three DNA nanoframework-modified nucleic acid aptamers T8-1-3 in an embodiment of the present invention; a: TGF-β1 content in blood at different time points after intravenous injection of BA; b: Comparison of the removal of target TGF-β1 by the three DNA nanocage devices; *: p < 0.05, **: p < 0.01; ns: no significant difference.

[0032] Figure 8 Figure 3. Results of a tumor inhibition experiment in tumor-bearing mice using a nucleic acid nanocapture device constructed with a nanobarrel structure-modified nucleic acid aptamer T8-1-3 according to an embodiment of the present invention in combination with an immune checkpoint inhibitor; a: schematic diagram of the mouse dosing regimen; b: tumor volume growth curve of mice in each treatment group; c: tumor mass of mice in each treatment group; d: image of tumor tissue in each treatment group; e: weight of mice in each treatment group; f: determination of TGF-β1 protein content in tumor tissue of each treatment group; *: p<0.05, **: p<0.01; ***: p<0.001; ns: no significant difference. DETAILED DESCRIPTION

[0033] To make the present invention more clearly understood, preferred embodiments are described in detail below with reference to the accompanying drawings.

[0034] The present invention relates to a framework nucleic acid nanocapture device constructed based on a DNA origami framework structure. By carrying aptamers, peptides, antibodies and other clearance elements inside the DNA origami framework structure, a complete framework nucleic acid nanocapture device that can specifically clear target molecules is constructed, which can clear specific target molecules in the environment at the in vivo and in vitro levels and produce downstream biological effects.

[0035] Example Construction of a framework nucleic acid nanocapture (DNA nanocatch device) capable of specifically removing target molecules

[0036] The DNA nano-clearing device is based on a type of DNA nanoframe structure, which is a self-enclosed three-dimensional structure with internal and external topological properties. It includes DNA nanobarrels, icosahedrons, and truncated icosahedrons (soccer balls). Specifically, it includes the following steps:

[0037] Step 1: Construct a DNA framework structure, such as a DNA nanobarrel, icosahedron, or soccer ball. This step can be performed using a 2D / 3D image to visualize the structure. The framework DNA is then designed using the specialized DNA nanostructure design software Tiamat and caDNAno. Following Step 1, the following steps are included: inputting the recombinant M13 bacteriophage p7560 genome sequence (derived from the NCBI database), exporting the software-generated staple strand sequence, and performing sequence synthesis.

[0038] Step 2: Based on step 1, further construct variants of the DNA framework structure and establish internal modifiable sites;

[0039] Step 3: The DNA framework structure constructed in step 2 is assembled and purified, and the structural monomer is obtained by ultracentrifugation and ultrafiltration concentration to remove unbound staple chains and impurities such as dimers and polymers;

[0040] After the DNA framework is assembled, agarose gel electrophoresis is used to preliminarily identify the structure. Transmission electron microscopy and atomic force microscopy are also used to evaluate the size, integrity, and conformity of the structure to the design.

[0041] Ultracentrifugation is a method for separating, preparing, and analyzing substances using powerful centrifugal forces in an ultracentrifuge. Separation is achieved by separating particles by placing them in a series of zones within a density gradient layer, based on their varying sedimentation velocities within the gradient. Sedimentation velocity is related to both the size and density of the molecules, as well as the molecular density and viscosity of the solution and the shape of the molecules. The most commonly used methods are sedimentation velocity and sedimentation equilibrium.

[0042] Ultrafiltration is a membrane separation method that utilizes the microporous structure of a semipermeable membrane to achieve selective separation and recovery of substances. Ultrafiltration retains particles with a diameter between 0.002 and 0.1 μm, the molecular weight cutoff for the pore size of the ultrafiltration membrane ranges from 1,000 to 500,000, and the operating pressure for ultrafiltration is generally between 0.1 and 0.6 MPa. When a solution flows at a certain flow rate through the surface of an ultrafiltration membrane with a certain pore size, under the action of external pressure, the ultrafiltration allows small molecules, inorganic salts, and solutes with a molecular weight smaller than the cutoff to pass through, forming a filtrate (referred to as the filtrate), while retaining substances with a molecular weight larger than the membrane cutoff, such as colloids, proteins, microorganisms, and macromolecular organic matter, to form a concentrated solution, achieving the purpose of a concentrated structure.

[0043] Agarose gel electrophoresis is a fundamental technique in genetic engineering. It is simple and rapid, and is now widely used in nucleic acid research. DNA molecules carry a negative charge in solutions with a pH above their isoelectric point and migrate toward the positive electrode in an electric field. Due to the repetitive nature of the sugar-phosphate backbone, equal amounts of double-stranded DNA have nearly equal net charge, resulting in them migrating toward the positive electrode at the same rate.

[0044] Negative staining is a technique for producing electron microscopic images of samples with complex contrast. It is used to observe particulate matter or biomacromolecules within a sample. The sample, spread on a grid, is stained with a metal salt, so that the entire grid is covered with a layer of heavy metal salt, while areas with protruding particles remain free of dye. After staining, the object being observed appears bright, while the background appears dark, when observed under the electron microscope.

[0045] Figure 1 The following is a schematic diagram of the structure of the DNA nanoframe structure involved in the embodiment and its physical properties are shown; in the embodiment, three DNA framework nucleic acid nanostructures were designed and synthesized: DNA barrel framework (DBF), DNA soccerframework (DSF), DNA icosahedron The three structures all use the recombinant M13 phage p7560 as the framework long chain (template chain). The double strands formed after the staple chain binds to the template chain overlap with each other. The three structures have their own characteristics in different dimensions. DBF is composed of 12 double-stranded DNAs and can extend 150 anchor sequences inward or outward. DBF has the largest window diameter and internal carrying capacity, which is conducive to the binding and release of substances; each side of DSF is composed of two double strands and can extend 90 anchor sequences inward or outward. It has the largest internal space and moderate window diameter, which is conducive to the loading of internal substances; each side of DIF is composed of four double strands and can extend 30 anchor sequences inward or outward. It has the strongest rigidity and is not easy to deform. It has been confirmed by our subsequent experiments that it has good fluid stability.

[0046] The nucleic acid aptamer, peptide, antibody and other clearance elements are assembled on the complementary sequence of the anchor sequence, and the staple chain at the specific position of the origami structure (the selected modification site) is used to extend the corresponding anchor sequence into the structure. The anchor sequence inside the three structures and the complementary sequence equipped with the clearance element are subjected to different annealing procedures (such as Figure 2As shown in the figure, we connected the aptamer and other clearance elements that can specifically bind to the target molecule. We successfully synthesized three structures and characterized them by agarose gel electrophoresis and transmission electron microscopy. The three structures showed a single band on the agarose gel with different migration rates. The electron microscopy results showed that the grown structure was completely consistent with our design.

[0047] The anchor sequences and complementary sequences of the three DNA nanoframe structures in this embodiment are shown in the following SEQ ID NOs: 1 to 2:

[0048] Anchor sequence (SEQ ID NO: 1): CTTCACACCACACTCCATCTA;

[0049] Complementary sequence of the anchor sequence (SEQ ID NO: 2): TAGATGGAGTGTGGTGTGAAG.

[0050] Figure 3 This is a list of target molecules that can be specifically removed by the DNA nano-clearing device. By loading different capture elements, a variety of different target molecules can be cleared, including but not limited to the target molecules shown in the figure.

[0051] Figure 4 The following is a schematic diagram and electron micrograph of a DNA nanoparticle removal device constructed using three DNA framework-modified aptamers T8-1-3 that specifically bind to the TGF-β1 protein, and the device after protein capture. The DNA nanoparticle removal device consists of two components: a carrier platform (DNA framework, DONs) and a removal element. This example uses the three distinct DONs described above as the carrier platform and the aptamer T8-1-3, which specifically binds to the TGF-β1 protein, as the removal element. Alternatively, the removal element can be an antibody or peptide that specifically binds to the target molecule, such as the peptide ESKHDC (SEQ ID NO: 3) that specifically binds to vascular endothelial growth factor (VEGF) or the peptide KRIWFIPRSS (SEQ ID NO: 4) that specifically binds to interleukin-10 (IL-10). After confirming the affinity and specificity of T8-1-3, it was incorporated into the structure. We found that the three DONs exhibited different behaviors after binding to proteins. The capture sequence is left inside the DONs. The complementary sequence of the capture sequence extending from the 5' end of the T8-1-3 sequence can be assembled into the DONs through base pairing. The DNA nano-cleaning device constructed with a nano-barrel framework is marked as BA, the DNA nano-cleaning device constructed with an icosahedral framework is marked as IA, and the DNA nano-cleaning device constructed with a soccer ball-shaped framework is marked as SA. We used electron microscopy to directly observe the state of the structure, such as Figure 3As shown, the DBF, due to its large window diameter, allows us to directly observe the presence of high-density proteins within the barrel wall, including a ring of high-density proteins within the barrel wall. Under the electron microscope, the DSF structure appears contracted overall, with a dense interior. The DIF also shows a dense interior, but the size and shape of the structure remain unchanged. Therefore, due to their different physical properties, the three structures exhibit different states after incubation with TGF-β1 protein.

[0052] Example 2 Application of DNA nano-clearing device to clear target molecules in vivo and in vitro

[0053] (1) Application of DNA nanoscavenger devices to regulate target molecules at the cellular level and influence downstream biological signals

[0054] Step 1: In the embodiment of the present invention, taking targeted elimination of TGF-β1 protein as an example, cell lines with high expression of target protein are screened, and human peripheral blood mononuclear cells (PBMCs) are extracted;

[0055] Step 2: After controlling the peripheral target molecule levels using a DNA nanoparticle removal device, the changes in internal biological signal expression in immune cells and screened cell lines were examined;

[0056] Step 3: After completing step 2, further investigate the biological function of the cells; in this embodiment of the present invention, after using the DNA nano-clearing device to remove TGF-β1 in the environment, observe the changes in the killing effect of PBMC on the tumor cell line A375 cells;

[0057] Figure 5 Schematic diagram of in vivo and in vitro clearance of the immunosuppressive cytokine transforming growth factor TGF-β1 by using a nucleic acid nanocapture constructed by modifying nucleic acid aptamers T8-1-3 with three DNA nanoframe structures as an example in the embodiment of the present invention.

[0058] Figure 6 This is a diagram of the experimental results of the nucleic acid nanocapture constructed by modifying the nucleic acid aptamer T8-1-3 with three DNA nanoframe structures in the embodiment of the present invention to enhance the killing function of immune cells after clearing TGF-β1 in an in vitro cell culture system. We first need to pre-treat the PBMC and divide it into 5 parallel groups: untreated group, group with extra TGF-b1, group with extra TGF-b and BA, group with extra TGF-b and SA, and group with extra TGF-b and IA. The purpose of adding extra TGF-b is to simulate the higher blood TGF-b level in tumor patients and to stimulate immune cells in the circulation and lymphoid tissues. After pre-treatment, PBMC were added to the A375 cells prepared in advance and incubated for 8 hours for confocal and flow cytometry observation; the confocal micrograph is shown in the figure. Figure 6 As shown in a, the flow cytometry quantitative results are shown in Figure 6 As shown in bc (including the results of simple co-incubation with target molecules and the results in the PBMC system), the number of dead tumor cells was significantly reduced after the addition of extra TGF-b. However, when BA / SA / IA was added to clear TGF-b, the proportion of immune cells with the ability to kill tumor cells in PBMC increased, the ability to kill tumor cells was restored, and the number of dead tumor cells increased. Tumor cell killing caused by PBMC is non-specific killing. In order to verify that TGF-b in the clearing environment is also effective in restoring the specific killing of the immune system, we used T cells (TCR-T) that specifically express tumor cell antigen-related T cell chimeric receptors (TCR) on the membrane surface to perform the above experiments. We also found that after using the DNA nano-clearing device, the tumor killing ability of TCR-T cells was significantly restored, and the addition of BA significantly improved the tumor killing ability of TCR-T compared with the control group. Figure 6 As shown in d.

[0059] (2) Application of DNA nano-scavenging devices in clearing circulating cytokines to regulate immune responses in model animals

[0060] This experiment uses the DNA nano-clearing device to clear the transforming growth factor TGF-β1 protein in MC38 tumor-bearing mice as an example. We injected different drugs into the tail vein of the mice and then took blood to measure the TGF-β1 protein level to evaluate the in vivo capture efficiency of the DNA nano-clearing device. Figure 7 As shown, we used BA to measure TGF-β1 levels in the blood at different time points after intravenous injection. We found that circulating TGF-β1 protein levels decreased continuously after injection, stabilized at a minimum around 2 hours, and began to rise around 8 hours. We also compared the capture and clearance capabilities of three DNA nanoparticle removal devices. While maintaining the same number of capture elements, blood was collected for ELISA two hours after tail vein injection of different DNA nanoparticle removal devices. Compared with the PBS and free aptamer groups, the TGF-β1 protein level in mice injected with the DNA nanoparticle removal device was significantly lower, with BA being the most effective.

[0061] Example 3 Application of DNA Nano-Clearing Device Combined with Immune Checkpoint Inhibitors

[0062] To verify the effect of decreased circulating immunosuppressive cytokine levels on the body's immune response, we combined the immune checkpoint inhibitor aPD-L1 for anti-tumor treatment. For in vivo tumor inhibition evaluation, we constructed a subcutaneous tumor model in MC38 mice. All mice were randomly divided into 5 groups: PBS group, Free T8-1-3 group, BA group, aPD-L1 group, and BA+aPD-L1 group. When the tumor volume reached 150 mm, the mice were randomly divided into 5 groups: PBS group, Free T8-1-3 group, BA group, aPD-L1 group, and BA+aPD-L1 group. 3 Dosing was performed every other day for a total of seven doses. In the aPD-L1 treatment group, aPD-L1 was administered twice. The overall schedule is shown in the figure. Tumor size and body weight were monitored before each dose, and all mice were euthanized 24 hours after the last treatment. Before the experiment, circulating TGF-β levels in tumor-bearing and healthy mice were measured. BA was added based on the difference between the two levels to regulate circulating TGF-β levels in tumor-bearing mice to levels found in healthy mice.

[0063] like Figure 8 As shown in the figure, compared with the control PBS group, the Free T8-1-3 group had no effect on the tumor volume of mice. The BA group and the aPD-L1 group showed a weak tumor inhibition effect, but the tumor inhibition effect did not increase over time, and the tumor growth was still very rapid. However, the BA and aPD-L1 combination group showed a significant tumor inhibition effect, with a significant reduction in tumor volume and tumor weight after dissection. We extracted interstitial fluid from the intact tumor tissue and tested the TGF-β1 protein content, as shown in the figure. Figure 7 As shown, both groups injected with DNA Nano-scavengers showed significant reductions in TGF-β1 protein levels. However, the group injected with aPD-L1 alone showed a slight tumor suppression effect but no reduction in TGF-β1 protein levels. Therefore, we conclude that BA successfully normalized TGF-β1 levels in tumor-bearing mice and, combined with immune checkpoint therapy, inhibited tumor proliferation. Furthermore, the mice's body weight remained stable during the dosing period, and HE staining revealed normal liver and kidney tissue structure, demonstrating the safety and non-toxicity of the DNA Nano-scavenger device in vivo.

[0064] The above experiments fully demonstrate that the DNA nano-clearing device constructed based on the DNA framework structure of the present invention can specifically clear target molecules and effectively induce downstream biological effects, and has good medical prospects when used in combination with drugs.

[0065] The above embodiments are only preferred embodiments of the present invention and are not intended to limit the present invention in any form or substance. It should be noted that ordinary technicians in this technical field can make several improvements and supplements without departing from the present invention, and these improvements and supplements should also be regarded as the scope of protection of the present invention.

Claims

1. Application of a framework nucleic acid nanocapture device capable of specifically removing target molecules in the preparation of a product for enhancing the immune function of immune cells, characterized in that: The nucleic acid nanocapture device is a DNA origami structure modified with a clearance element; the clearance element is any one of a nucleic acid aptamer, a polypeptide, and an antibody that can specifically bind to a target molecule; the target molecule is an immunosuppressive cytokine; The DNA origami structure is a DNA nanobarrel, icosahedron or truncated icosahedron structure constructed using DNA origami technology, which is assembled by hybridization of a long circular sequence of recombinant M13 phage genomic DNA single strand, a short sequence of staple chains, and a capture staple chain used to modify the clearance element according to the principle of base complementary pairing; The preparation method of the framework nucleic acid nanocapture device includes: using DNA origami technology to build a DNA origami structure, assembling nucleic acid aptamers, polypeptides or antibodies on the complementary sequence of the anchor sequence, and performing internal modification on the DNA origami structure to remove elements.

2. The use according to claim 1, characterized in that The target molecule is any one of transforming growth factor, vascular endothelial growth factor, interleukin 6, interleukin 10, oxidized low-density lipoprotein and lipopolysaccharide.

3. The use according to claim 1, wherein The assembly method of the nucleic acid aptamer includes: directly adding the nucleic acid sequence to be modified to the end of the complementary sequence, and using molecular hybridization to bind the complementary sequence to the anchor sequence to fix the nucleic acid molecule to be assembled inside the structure; The method for assembling the polypeptide or antibody comprises: connecting the protein or polypeptide with a complementary sequence by using a bioorthogonal reaction, a chemical reaction or a protein coupling reaction, and fixing the polypeptide or antibody inside the structure by combining the complementary sequence with an anchor sequence by using a molecular hybridization method.

4. The use according to claim 1, wherein The framework nucleic acid nanocapture is a framework nucleic acid nanocapture that targets and eliminates TGF-β1 protein, and is a DNA origami structure modified with a nucleic acid aptamer; the nucleic acid aptamer can specifically bind to the TGF-β1 protein.

5. The use according to claim 4, characterized in that The application also includes: the application of the framework nucleic acid nanocapture for targeted clearance of TGF-β1 protein combined with the immune checkpoint inhibitor aPD-L1 in the preparation of anti-tumor products.

6. The use according to claim 5, characterized in that The DNA origami structure is a DNA nanobarrel origami structure.

Images