Chitosanase, its encoding gene, recombinant vector, recombinant strain, starter and enzyme preparation, and their applications

Abstract

The present invention relates to genetic engineering technology, and discloses a chitosanase, its encoding gene, recombinant vector, recombinant strain, fermenting agent and enzyme preparation, as well as their applications. The pure enzyme activity of this chitosanase is high, and it has obvious acid stability. When stored overnight under the condition that the optimal pH is 5.0, the enzyme activity only decreases by 8%. When stored overnight in the pH range of 3.0 - 6.0, the remaining enzyme activity is above 60%. It has high acid resistance and a large acid-resistant range, and has great application potential in the industrial production of chito-oligosaccharide. The recombinant strain provided by the present invention can efficiently produce chitosanase through high-density fermentation, and has prospects for industrial application.

Description

Technical Field

[0001] This invention relates to genetic engineering technology, specifically to a chitosanase and its encoding gene, a recombinant vector, a recombinant strain, a fermentation agent, a method for preparing chitosanase, an enzyme preparation, and their applications in the degradation of chitosan. Background Technology

[0002] Chitosan oligosaccharide is a non-toxic, environmentally friendly, and biodegradable new marine biomaterial. It is obtained by degrading chitosan, a product of chitin deacetylation, with a degree of polymerization typically between 2 and 10. Chitosan oligosaccharide is the only naturally occurring alkaline oligosaccharide in nature, possessing biological activities such as antibacterial, antitumor, immunomodulatory, and improved glucose and lipid metabolism. Therefore, it has the potential to promote food quality and human health, and has broad application prospects in the food, agriculture, and pharmaceutical fields. Industrially, chitosan oligosaccharide is mainly prepared by decalcifying and deproteinizing shrimp and crab shells with concentrated hydrochloric acid and sodium hydroxide to obtain chitosan, followed by chemical, physical, or enzymatic hydrolysis. Traditional chitosan oligosaccharide preparation processes require large amounts of strong acids and alkalis, resulting in high energy consumption and severe environmental pollution, placing enormous environmental pressure on subsequent processing.

[0003] Chitosanase (EC 3.2.1.132, chitosan N-acetylglucosamine hydrolase) is a glycoside hydrolase that specifically hydrolyzes chitosan, typically cleaving β-1,4-glycosidic bonds via an endolytic process to generate chitosan oligosaccharides. Enzymatic hydrolysis for chitosan oligosaccharide preparation offers advantages such as specificity, high efficiency, and environmental friendliness, possessing significant potential for industrial applications. Currently, several chitosanase genes derived from bacteria and fungi have been cloned, expressed, and molecularly modified, resulting in significant improvements in enzymatic properties and fermentation condition optimization. However, the predominantly acidic catalytic environment in industrial chitosan oligosaccharide preparation significantly limits the catalytic efficiency of chitosanase and the yield of chitosan oligosaccharides.

[0004] Current research on acid-resistant chitosanases is limited. Li Tian et al. screened an acid-resistant chitosanase-producing Bacillus strain CLT08 from mud samples in Haizhou Bay, Lianyungang. This strain produced chitosanase with an activity of 3.17 U / mL, an optimal pH of 4.0, and after incubation at different pH values ​​for 2 hours, the residual enzyme activity remained above 70% at pH 3.0-5.0, but decreased sharply at pH > 5. This strain exhibits low chitosanase activity and a narrow acid-resistant range, limiting its potential application in the chitosan oligosaccharide preparation industry. Therefore, obtaining chitosanases with high activity and strong acid stability remains crucial for fully realizing their application in the chitosan oligosaccharide preparation industry. Summary of the Invention

[0005] The purpose of this invention is to overcome the problems existing in the prior art and provide a chitosanase and its encoding gene, a recombinant vector, a recombinant strain, a fermentation agent, a method for preparing chitosanase, an enzyme preparation, and their application in the degradation of chitosan. This chitosanase can be expressed by bacteria and has the advantages of high enzyme activity and strong acid resistance.

[0006] To achieve the above objectives, the first aspect of the present invention provides a chitosanase, wherein the chitosanase is any one of (a)-(e) as described in:

[0007] (a) An enzyme having the amino acid sequence shown in SEQ ID NO: 2;

[0008] (b) An enzyme whose amino acid sequence shown in SEQ ID NO: 2 has been substituted, deleted or added one or more amino acid residues and still has chitosanase activity.

[0009] (c) An enzyme having more than 80% homology with the amino acid sequence shown in SEQ ID NO: 2 and having chitosanase activity;

[0010] (d) An enzyme having a tagged amino acid sequence attached to the amino-terminus and / or carboxyl-terminus of the amino acid sequence described in (a), (b) or (c);

[0011] (e) An enzyme having a signal sequence attached to the amino terminus of the amino acid sequence described in (a), (b) or (c).

[0012] Preferably, the chitosanase is an enzyme with an amino acid sequence that has more than 90%, preferably more than 95%, homology to the amino acid sequence shown in SEQ ID NO: 2 and has chitosanase activity.

[0013] A second aspect of the present invention provides a gene encoding chitosanase, the gene having a nucleotide sequence encoding chitosanase as described above.

[0014] Preferably, the gene has a nucleotide sequence encoding an enzyme having the amino acid sequence shown in SEQ ID NO: 2.

[0015] More preferably, the gene has the nucleotide sequence shown in SEQ ID NO: 1.

[0016] A third aspect of the present invention provides a recombinant vector containing the genes described above.

[0017] Preferably, the expression vector of the recombinant vector is the pET28a plasmid.

[0018] A fourth aspect of the present invention provides a recombinant strain containing the gene described above or the recombinant vector described above.

[0019] Preferably, the recombinant strain is Escherichia coli and / or Bacillus subtilis.

[0020] More preferably, the recombinant strain originates from Escherichia coli BL21(DE3).

[0021] A fifth aspect of the present invention provides a fermentation agent containing the recombinant strain described above.

[0022] Preferably, the content of the recombinant strain is 10 per gram of the fermenting agent. 7 -10 9 CFU.

[0023] The sixth aspect of the present invention provides a method for preparing chitosanase, the method comprising: inoculating the recombinant strain and / or the fermenting agent as described above into a fermentation medium for fermentation, separating and purifying the fermentation product to obtain chitosanase.

[0024] Preferably, the fermentation medium contains: 10-15 g / L peptone, 20-30 g / L yeast extract, 8-12 g / L glycerol, 1-3 g / L KH2PO4, 3-8 g / L K2HPO4, and 40-60 mg / L kanamycin;

[0025] The fermentation process includes: transferring the seed culture to the fermentation medium at an inoculum rate of 8-10% by volume, and culturing it at a temperature of 30-45°C and a rotation speed of 150-200 rpm until OD (dose retardation). 600 The concentration of lactose was 0.6-0.8, and then lactose was added to the culture medium until the final concentration was 8-10 g / L. The culture was then induced for 8-10 h at a temperature of 28-30℃ and a rotation speed of 140-180 rpm.

[0026] A seventh aspect of the present invention provides an enzyme preparation containing chitosanase prepared by the method described above.

[0027] The eighth aspect of the present invention provides the use of at least one of the chitosanase described above, the gene described above, the recombinant vector described above, the recombinant strain described above, the fermenting agent described above, the chitosanase prepared by the method described above, and the enzyme preparation described above in the degradation of chitosan.

[0028] The beneficial effects of the present invention through the above technical solution are as follows:

[0029] The chitosanase provided by this invention has a pure enzyme activity as high as 1200 U / mg and exhibits significant acid stability. When stored overnight at the optimal pH of 5.0, the enzyme activity decreases by only 8%. When stored overnight at a pH range of 3.0-6.0, the remaining enzyme activity is above 60%. This chitosanase has high acid resistance and a wide acid resistance range, and has great application potential in the chitosan oligosaccharide preparation industry.

[0030] The recombinant strain provided by this invention can produce chitosanase efficiently through high-density fermentation. The enzyme activity of chitosanase in the fermentation broth can reach 957 U / mL, which has the potential for industrial application. Attached Figure Description

[0031] Figure 1 This is an SDS-PAGE electrophoresis result of the chitosanase BTc01 induced expression and purification in Example 2;

[0032] Figure 2 This is the optimal pH curve of chitosanase BTc01 in Example 2;

[0033] Figure 3 This is the pH tolerance curve of chitosanase BTc01 in Example 2. Detailed Implementation

[0034] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0035] In this invention, unless otherwise stated, the term "enzyme activity" refers to the amount of enzyme content, expressed in enzyme activity units, i.e., enzyme units (U). In this invention, an enzyme unit is defined as the amount of enzyme required to hydrolyze 1 mg of pure protein per minute to form 1 μmol of glucosamine. "Specific activity" represents the catalytic ability of a unit mass of protein, reflecting the level of enzyme activity; a higher value indicates higher enzyme activity. The formula for calculating specific activity is: Specific activity (U / mg) = Total enzyme activity units / mg total protein; the unit M represents mol / L.

[0036] The first aspect of this invention provides a chitosanase, wherein the chitosanase is any one of (a)-(e) of the following enzymes:

[0037] (a) An enzyme having the amino acid sequence shown in SEQ ID NO: 2;

[0038] (b) An enzyme whose amino acid sequence shown in SEQ ID NO: 2 has been substituted, deleted or added one or more amino acid residues and still has chitosanase activity.

[0039] (c) An enzyme having more than 80% homology with the amino acid sequence shown in SEQ ID NO: 2 and having chitosanase activity;

[0040] (d) An enzyme having a tagged amino acid sequence attached to the amino-terminus and / or carboxyl-terminus of the amino acid sequence described in (a), (b) or (c);

[0041] (e) An enzyme having a signal sequence attached to the amino terminus of the amino acid sequence described in (a), (b) or (c).

[0042] The 20 amino acid residues that make up proteins can be divided into four categories according to side chain polarity: nonpolar amino acids, polar uncharged amino acids, positively charged amino acids, and negatively charged amino acids (see "Biochemistry" (Second Edition), Volume 1, Shen Tong and Wang Jingyan, pp. 82-83, Higher Education Press, December 1990). If amino acid residues belonging to the same category are substituted in a protein, such as arginine (Arg) replacing lysine (Lys) or leucine (Leu) replacing isoleucine (Ile), the function of these residues in the protein's structural domains (e.g., providing positive charge or forming hydrophobic pocket structures) remains unchanged, and the protein can still perform its function. Such substitutions of amino acid residues belonging to the same category can occur at any amino acid residue position in the aforementioned chitosanase.

[0043] In addition to the amino acid residue substitutions described above, the chitosanase provided by the present invention also includes proteins in which one or more amino acid residues are deleted or added, or both, at any position of the amino acid residues compared to the amino acid sequence shown in SEQ ID NO: 2.

[0044] As mentioned above, the chitosanase provided by this invention can also be modified or mutated to obtain derived proteins. Derived proteins refer to chitosanases that differ in amino acid sequence from those having the above-described amino acid sequence, and may also differ in modification forms that do not affect the sequence, or both. Modifications (usually without altering the primary structure, i.e., without changing the amino acid sequence) include: chemically derived forms of proteins in vivo or in vitro, such as acetylation or carboxylation; glycosylation forms, such as proteins produced by glycosylation modifications during protein synthesis and processing or further processing steps; sequences containing phosphorylated amino acid residues (such as phosphotyrosine, phosphotyserine, phosphotythreonine), etc.

[0045] In this invention, the enzyme may also be an enzyme having an amino acid sequence that has more than 80% homology with the amino acid sequence shown in SEQ ID NO: 2 and has chitosanase activity. Preferably, the chitosanase is an enzyme having an amino acid sequence that has more than 90%, more preferably more than 95%, and even more preferably more than 98% homology with the amino acid sequence shown in SEQ ID NO: 2 and has chitosanase activity.

[0046] To facilitate purification, (a), (b), or (c) can be modified using tags commonly used in the art. For example, it can be obtained by attaching a tagged amino acid sequence (e.g., at least one of Poly-Arg, Poly-His, FLAG, Strep-tagⅡ, and c-myc) to the amino terminus and / or carboxyl terminus of (a). The tag does not affect the activity of the chitosanase of this invention, and in practical applications, the addition of a tag can be selected as needed.

[0047] In this invention, the amino terminus of the chitosanase may also be linked to a signal sequence. The signal sequence may be derived from *Escherichia coli* and / or *Bacillus subtilis*, but is not limited thereto.

[0048] In this invention, "still having enzyme activity" means that, under the same assay conditions, the enzyme derived from (a) still has enzyme activity, and the percentage (relative activity) between its enzyme activity and the enzyme activity of (a) is not less than 80% (e.g., 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100%).

[0049] The chitosanase mentioned above can be obtained artificially, or its encoding gene can be synthesized first and then obtained through biological expression.

[0050] A second aspect of the present invention provides a gene encoding chitosanase, the gene having a nucleotide sequence encoding chitosanase as described above.

[0051] According to the present invention, preferably, the gene has a nucleotide sequence encoding an enzyme having the amino acid sequence shown in SEQ ID NO: 2.

[0052] As mentioned above, correspondingly, the 5' and / or 3' ends of the nucleotide sequence can also be linked to tagged coding sequences.

[0053] According to the present invention, more preferably, the gene has the nucleotide sequence shown in SEQ ID NO: 1.

[0054] The nucleotide sequences provided by this invention can generally be obtained using polymerase chain reaction (PCR) amplification, recombination, or artificial synthesis. For example, those skilled in the art can easily obtain templates and primers based on the nucleotide sequences provided by this invention, and use PCR to amplify the relevant sequences. Once the relevant nucleotide sequences are obtained, the relevant amino acid sequences can be obtained in large quantities using recombination. Typically, the obtained nucleotide sequences are cloned into a vector, then transformed into genetically engineered bacteria, and then the relevant nucleotide sequences are isolated from the proliferated host cells using conventional methods.

[0055] In addition, known methods of artificial chemical synthesis can be used to synthesize the relevant nucleotide sequences.

[0056] A third aspect of the present invention provides a recombinant vector containing the genes described above.

[0057] The "vector" used in the recombinant vector can be any vector known in the art, such as various commercially available plasmids, granules, bacteriophages and retroviruses, etc. The preferred expression vector of the present invention is the pET28a plasmid.

[0058] Recombinant vector construction can be achieved by digesting pET28a with various endonucleases that have cleavage sites at the multiple cloning site (e.g., EcoRI, NotI, etc. for pET28a) to obtain linear plasmids, which are then ligated with gene fragments digested with the same endonuclease to obtain recombinant plasmids. In this invention, pET28a and the gene fragment ligated thereto are preferably digested with both EcoRI and NotI, and then ligated with a ligase to construct the recombinant vector pET28a-BTc01.

[0059] A fourth aspect of the present invention provides a recombinant strain containing the gene described above or the recombinant vector described above.

[0060] The recombinant vector can be transformed, transduced, or transfected into host cells (strains) using conventional methods in the art, such as heat shock transformation, calcium chloride chemical transformation, and high-voltage electric shock transformation, with heat shock transformation being preferred. The starting strain of the recombinant vector can be a prokaryotic or eukaryotic cell, preferably *Escherichia coli* and / or *Bacillus subtilis*, and more preferably, the starting strain is *Escherichia coli*, such as *Escherichia coli* BL21(DE3).

[0061] A fifth aspect of the present invention provides a fermentation agent containing the recombinant strain described above.

[0062] The fermenting agent may exist in liquid or solid form. The fermenting agent may contain excipients conventionally added during the preparation of microbial agents, which may be selected by those skilled in the art as needed.

[0063] According to the present invention, preferably, the content of the recombinant strain is 10 per gram of the fermenting agent. 7 -10 9 CFU.

[0064] The sixth aspect of the present invention provides a method for preparing chitosanase, the method comprising: inoculating the recombinant strain and / or the fermenting agent as described above into a fermentation medium for fermentation, separating and purifying the fermentation product to obtain chitosanase.

[0065] In this invention, the fermentation conditions can adopt a conventional culture process. Preferably, the recombinant strain and / or fermentation agent are first inoculated into an activation medium for activation culture to obtain an activation solution, then the activation solution is inoculated into a seed culture medium for seed culture to obtain a seed liquid, and finally the seed liquid is inoculated into a fermentation medium for fermentation culture.

[0066] In this invention, the activation culture medium and seed culture medium contain the nutrients required for the growth of the recombinant strain, enabling the recombinant strain to be activated and reproduce. Preferably, the activation culture medium contains: 8-12 g / L peptone, 3-8 g / L yeast extract, 8-12 g / L NaCl, and 40-60 mg / L kanamycin; the seed culture medium contains: 10-15 g / L peptone, 20-30 g / L yeast extract, 0.2-1 g / L glucose, 3-8 g / L glycerol, 40-60 mg / L kanamycin, 1-3 g / L KH₂PO₄, and 10-15 g / L K₂HPO₄.

[0067] In this invention, the temperature, time, and other conditions for activation culture and seed culture are set to meet the growth requirements of the recombinant strain. Preferably, the activation culture conditions include at least the following: temperature of 30-45℃, rotation speed of 160-180 rpm, and time of 10-14 h; the seed culture conditions include at least the following: temperature of 30-45℃, rotation speed of 180-200 rpm, and time of 8-10 h.

[0068] According to the present invention, the fermentation medium contains the nutrients required for the growth of the recombinant strain, enabling the recombinant strain to multiply in large quantities. Preferably, the fermentation medium contains: 10-15 g / L peptone, 20-30 g / L yeast extract, 8-12 g / L glycerol, 1-3 g / L KH₂PO₄, 3-8 g / L K₂HPO₄, and 40-60 mg / L kanamycin.

[0069] According to the present invention, preferably, the fermentation process includes: transferring the seed culture into the fermentation medium at an inoculum volume of 8-10% (v / v), and culturing it at a temperature of 30-45°C and a rotation speed of 150-200 rpm until OD (dose retardation). 600The concentration of lactose was 0.6-0.8, and then lactose was added to the culture medium until the final concentration was 8-10 g / L. The culture was then induced for 8-10 h at a temperature of 28-30℃ and a rotation speed of 140-180 rpm.

[0070] Because the recombinant strain provided by this invention contains a gene encoding chitosanase, it can efficiently express chitosanase. After cultivation, high-purity chitosanase can be obtained through separation and purification. Separation and purification can be performed using methods known to those skilled in the art, which will not be elaborated upon here.

[0071] A seventh aspect of the present invention provides an enzyme preparation comprising chitosanase prepared by the method described above.

[0072] The enzyme preparation may exist in solid, semi-solid or liquid form, and may contain excipients or additives for preparing the enzyme preparation. Those skilled in the art can choose according to their needs, which will not be elaborated here.

[0073] Based on the activity and acid stability of the chitosanase in this invention, the eighth aspect of this invention provides the use of at least one of the chitosanase as described above, the gene as described above, the recombinant vector as described above, the recombinant strain as described above, the fermentation agent as described above, the chitosanase prepared by the method as described above, and the enzyme preparation as described above in the degradation of chitosan.

[0074] The method for degrading chitosan can be a conventional degradation method in the art. Specifically, at least one of the chitosanase, gene, recombinant vector, recombinant strain, fermentation agent, chitosanase prepared by the method described above, and enzyme preparation described above can be contacted with chitosan. The contact conditions can be suitable for the chitosanase. Preferably, the contact conditions include: pH 2-8, more preferably 3-6; and temperature 35-55°C, more preferably 40-50°C.

[0075] The amount of chitosanase used per gram of chitosan sample can be 50-100 μg.

[0076] The present invention will be described in detail below through embodiments.

[0077] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0078] Chitosan was purchased from Zhejiang Jinke Pharmaceutical Co., Ltd., with product number M-PK-2108001.

[0079] In the following examples, the preparation process of the activation culture medium is as follows: 1% peptone, 0.5% yeast extract, 1% NaCl, pH 7.0, sterilized at 121°C for 20 min, cooled to below 60°C, and the antibiotic kanamycin was added to a final concentration of 50 μg / mL.

[0080] The seed culture medium was prepared as follows: 1.2% peptone, 2.4% yeast extract, 0.05% glucose, 0.5% glycerol, sterilized at 115℃ for 20 min, cooled to below 60℃, kanamycin was added to a final concentration of 50 μg / mL, and phosphate buffer (17 mM KH2PO4, 72 mM K2HPO4) was added after high-temperature sterilization and cooling.

[0081] The fermentation medium was prepared as follows: 1.2% peptone, 2.4% yeast extract, 1.0% glycerol, 0.2% KH2PO4, 0.5% K2HPO4, sterilized at 121℃ for 20 min, cooled to below 60℃, and kanamycin was added to a final concentration of 50 μg / mL.

[0082] Example 1: Cloning of the acid-resistant chitosanase gene

[0083] 1. Obtaining the partial coding gene for chitosanase BTc01

[0084] Based on the acid-resistant chitosanase-producing strain ZWT-8, screened from intertidal mud samples along the coast of Taizhou, this strain was identified as *Bacillus cereus* and deposited on July 21, 2021, at the China General Microbiological Culture Collection Center (Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, 100101, China), with accession number CGMCC No. 22932. According to the chitosanase-encoding gene sequence of *Bacillus cereus* published in the NCBI database, upstream primer BTc-F1 (nucleotide sequence shown in SEQ ID NO: 3) and downstream primer BTc-R1 (nucleotide sequence shown in SEQ ID NO: 4) were designed. Using the genomic DNA of strain ZWT-8 as a template, a partial coding gene for chitosanase BTc01 was cloned, and its nucleotide sequence information is shown in SEQ ID NO: 5.

[0085] BTc-F1: 5'-CASARGGTCWAGRATNTG-3' (SEQ ID NO: 3),

[0086] BTc-R1: 5'-TCCMATCCSWAYCRCTRT-3' (SEQ ID NO: 4),

[0087] Partial coding gene of chitosanase BTc01 (SEQ ID NO: 5): cagaaggtcaaggatatgcgatgcgcacgacagtattaatggctggttatgattcgaatgctcaaaaaatctatgacggtttatttaaaacagcaagaacttttaaaagctctcaaaatcctaatttaatgggatgggttgtcgcagatagtaaaaaagcacaaggtcattttgattctgctactgatggggctttcgatcttccgaattctcttcttcttgctcataagcagtggggatctcatggaacagttaattatttgaaagaagcacaagacatgattacaaaaggtattaaagctagtaatgttacaaataataaccgactaaatttaggagattgggattctaaaagttcacttgatacgagaccatctgattggatgatgtcacaccttagagcattttatgaatttacaggtgataaaacttggcttactgttattaataatttgtacgatgtttatacgcaatttagtaataagtactctccaaatacaggacttatttcagatttcgttgtaaaaaacccaccacaacccgcacctaaagacttcttagatgagtcagaatatacaaatgcatattattataatgctagtcgagtacatttaagaattgtaatggactatgcgatgtacggcgagaagcgaagtaaagtcatttctgataaagtctcttcatggattcaaaataaaacgaatggaaatccttctaaaattgtggatggttatcaattaactggatccgctagtggtagtcatccaactgctgtatttgtttcaccgtttattgctgcaagtataacgagtagcaataatcaaacgtgggtacatagtggttgggattgga。

[0088] 2. Obtaining the complete coding gene of chitosanase BTc01

[0089] Based on the sequencing results of the partial coding gene of BTc01, two sets of three specific primers, SP1-3 and SP4-6, with high annealing temperatures were designed. Degenerate primers LAD1 and LAD2 were designed based on the codon preference of the bacterial strain. Flanking sequences were amplified using thermal asymmetric TAIL-PCR. The three rounds of PCR reaction were performed in 20 μL volumes: 10×PCR Buffer 2 μL, 2 mM dNTPs 2 μL, template 1 μL, Taq DNA polymerase 0.2 μL, 10 μmM SP 1 μL, 10 μmM LAD 4 μL, and ddH2O was added to make up the volume. For amplification of the 5' unknown sequence, the first round template was the genomic DNA of strain ZWT-8, with specific primer SP1 (nucleotide sequence as shown in SEQ ID NO: 6). The second round template was the product of the first round PCR diluted 30-fold, with specific primer SP2 (nucleotide sequence as shown in SEQ ID NO: 6). The template for the third round was the product of the second round PCR diluted 30 times. The specific primer was SP3 (nucleotide sequence as shown in SEQ ID NO: 8), and the degenerate primer was LAD1 (nucleotide sequence as shown in SEQ ID NO: 9).

[0090] The 3' unknown sequence was amplified. The first round template was the genomic DNA of strain ZWT-8, and the specific primer was SP4 (nucleotide sequence as shown in SEQ ID NO: 10). The second round template was the product of the first round PCR diluted 30 times, and the specific primer was SP5 (nucleotide sequence as shown in SEQ ID NO: 11). The third round template was the product of the second round PCR diluted 30 times, and the specific primer was SP6 (nucleotide sequence as shown in SEQ ID NO: 12). The degenerate primer was LAD2 (nucleotide sequence as shown in SEQ ID NO: 13).

[0091] SP1: 5'-CGTGCGCATCGCATATCCTTG-3' (SEQ ID NO: 6),

[0092] SP2: 5'-CTATCTGCGACAACCCATCCC-3' (SEQ ID NO: 7),

[0093] SP3: 5'-GTTCCATGAGATCCCCACTGC-3' (SEQ ID NO: 8),

[0094] LAD1: 5'-VVNVNNNCCAA-3' (SEQ ID NO: 9),

[0095] SP4: 5'-CGTGGGTACATAGTGGTTGGG-3' (SEQ ID NO: 10),

[0096] SP5: 5'-CTGGATCCGCTAGTGGTAGTC-3' (SEQ ID NO: 11),

[0097] SP6: 5'-GATGTACGGCGAGAAGCGAAG-3' (SEQ ID NO: 12),

[0098] LAD2: 5'-BDNBNNCGGT-3' (SEQ ID NO: 13);

[0099] The amplified sequence was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. After splicing, the complete coding gene of chitosanase BTc01 was obtained, and its nucleotide sequence is shown in SEQ ID NO: 1. The amino acid sequence of chitosanase BTc01 is shown in SEQ ID NO: 2.

[0100] Example 2: Construction and expression of chitosanase BTc01 genetically engineered bacteria

[0101] 1. Construction of chitosanase BTc01 genetically engineered bacteria

[0102] Primers were designed based on the complete coding gene sequence of chitosanase BTc01 obtained in Example 1. The upstream primer was BTc-F2 (nucleotide sequence as shown in SEQ ID NO: 14), and the downstream primer was BTc-R2 (nucleotide sequence as shown in SEQ ID NO: 15). Using ZWT-8 strain genomic DNA as a template, the full-length fragment of the BTc01 gene (nucleotide sequence as shown in SEQ ID NO: 1) was cloned. The underlined sequences in the primers are EcoRI and NotI restriction endonuclease sites, respectively. BTc-F2: 5'-CCGGAATTCATGAATGGAACAAGCCAG-3' (SEQ ID NO: 14), BTc-R2: 5'-TT GCGGCCGC TTAACCATCGTATCCTGC-3' (SEQ ID NO: 15);

[0103] 2. Construction of the recombinant vector pET28a-BTc01

[0104] The full-length BTc01 gene fragment cloned in step 1 and the expression vector pET28a(+) were digested with restriction endonucleases EcoRI and Not I, respectively. The digestion reaction system was as follows: vector pET28a(+) or full-length BTc01 gene fragment (1 μl), restriction endonuclease EcoRI (1 μl), restriction endonuclease Not I (1 μl), 10*Buffer (1 μl), ddH2O (6 μl); the reaction conditions were 37℃, 2 h. After the digestion products were analyzed by 1% agarose gel electrophoresis, the target gene fragment and the vector fragment were recovered by gel excision.

[0105] The recovered target gene fragment and vector fragment were ligated overnight. The ligation reaction system was as follows: 1 μl vector fragment, 5 μl target gene fragment, 1 μl T4 DNA ligase (NEB), 1 μl 10* Buffer, and 2 μl ddH2O; the recombinant vector pET28a-BTc01 was obtained.

[0106] 3. Construction of chitosanase BTc01 genetically engineered bacteria

[0107] The recombinant vector pET28a-BTc01 was heat-shocked into Escherichia coli BL21(DE3) competent cells. The specific procedure was as follows: 50 μL of E. coli BL21(DE3) competent cells were thawed on ice, and the recombinant vector pET28a-BTc01 was added and gently mixed. The mixture of competent cells and recombinant vector was then placed on ice for 30 min, followed by heat shock in a 42°C water bath for 30 s. The mixture was then removed from the 42°C water bath and immediately placed on ice, and 450 μL of culture medium was added. The mixture was then placed on a shaker at 37°C and shaken at 225 rpm for 1 h to allow the cells to recover. 100 μL of bacterial culture was added to an LB agar plate, and the plate was evenly spread on the plate using a bacterial spreader. The LB plate was inverted and incubated overnight at 37°C to obtain positive clonal colonies.

[0108] Positive clones were inoculated into LB liquid medium containing kanamycin at a final concentration of 50 μg / mL and cultured at 37°C with shaking until OD. 600 The concentration reached 0.6. The recombinant plasmid pET28a-BTc01 was extracted for double enzyme digestion verification and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The genetically engineered E. coli-pET28a-BTc01 successfully transformed with chitosanase BTc01 was obtained.

[0109] 4. Inducible expression of chitosanase BTc01

[0110] The genetically engineered strain E. coli-pET28a-BTc01 was inoculated into LB liquid medium (with kanamycin added to a final concentration of 50 μg / mL) and cultured at 37°C with shaking until OD. 600The expression level was 0.6-0.8, and lactose was added to a final concentration of 8 g / L for induction. Cells were cultured at 28°C with shaking for approximately 12 hours. Cells were collected by centrifugation, and an appropriate amount of phosphate buffer (20 mM, pH 8.0) was added to fully resuspend the cells. The cells were then sonicated in an ice bath, and the supernatant from the lysate was collected as the crude enzyme solution. The expression of BTc01 was detected by SDS-PAGE electrophoresis. The results are shown below. Figure 1 The target protein expression bands are clear and of consistent size. In the figure, lane M is the protein marker, lane 1 is the crude enzyme solution induced for 10 h, lane 2 is the crude enzyme solution induced for 12 h, and the arrow indicates the target protein BTc01.

[0111] 5. Affinity chromatography of chitosanase BTc01

[0112] Affinity chromatography was performed based on the histidine tag carried by the expression vector pET28a(+). The crude BTc01 enzyme solution obtained in step 3 was added to a Ni-NTA pre-packed gravity column, and eluted using imidazole buffers of different concentration gradients (imidazole concentration 200-500mM). The collected samples were verified by SDS-PAGE electrophoresis, and the results are as follows: Figure 1 As shown, lanes 3-7 contain protein bands eluted with 200mM, 300mM, 350mM, 400mM, and 450mM imidazole, respectively, with a size of approximately 50kDa, consistent with the expected size.

[0113] 6. Determination of the enzyme activity of chitosanase BTc01

[0114] Take 100 μL of appropriately diluted pure enzyme solution (here, pure enzyme solution refers to the sample collected by elution of the crude BTc01 enzyme solution with 450 mM imidazole in affinity chromatography in step 5 of Example 2), add 200 μL of 1% (w / w) chitosan solution and 700 μL of acetate-sodium acetate buffer (pH 5.5), mix well, react in a 45°C water bath for 20 min, immediately add 2 mL of DNS reagent, mix well, place in a boiling water bath for 5 min, cool rapidly, then add water to 5 mL, and take the supernatant to measure OD. 540 Value; with inactivated enzyme solution plus DNS reagent as blank, three parallel copies were made. The amount of enzyme used to hydrolyze 1 mg of pure protein to form 1 μmol of glucosamine per minute was defined as 1 enzyme activity unit (U). The results showed that the enzyme activity of chitosanase BTc01 was as high as 1200 U / mg.

[0115] 7. Determination of the acid stability of chitosanase BTc01

[0116] Using the enzyme activity determination procedure for the pure enzyme solution described in step 6, enzymatic reactions were carried out in buffer systems with pH values ​​of 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, and 8.0, respectively. The pH at which the enzyme activity was highest was identified as the optimum pH. Using the enzyme activity at this pH as a standard, a relative percentage was calculated, and an optimum pH curve was plotted based on the relative enzyme activity. The results are shown in [Figure number missing]. Figure 2 The optimal pH for BTc01 is 5.0.

[0117] After storing the pure enzyme solution overnight (approximately 12 hours) at 45°C in different pH buffers, the enzymatic reaction was carried out. The percentage of residual enzyme activity was calculated using the enzyme activity of the untreated solution as the standard, and pH tolerance curves were plotted. The results are shown in [Figure number missing]. Figure 3 BTc01 exhibits strong acid stability; when stored overnight at the optimal pH, its enzyme activity decreases by only 8%. The enzyme also has a wide acid tolerance pH range, with remaining enzyme activity exceeding 60% within the pH range of 3.0-6.0.

[0118] Example 3

[0119] 1. The engineered bacteria E. coli-pET28a-BTc01 (preserved in glycerol tubes) obtained in Example 2 was inoculated into the activation medium and cultured with shaking at 37°C and 170 rpm for 12 h to obtain the activation solution;

[0120] 2. The activation solution was transferred to the seed culture medium at an inoculum of 5% by volume, and cultured at 37℃ and 190 rpm for 9 hours to obtain the seed culture.

[0121] 3. Transfer the seed culture to the fermentation medium at an inoculum volume of 8% (v / v), and incubate at 37°C and 180 rpm for 2.5 h to allow the OD to reach its target value. 600 When the concentration reaches 0.6-0.8, lactose is added to a final concentration of 8 g / L, and the mixture is induced and cultured at 28℃ and 160 rpm for 8 hours to obtain the fermentation broth.

[0122] The activity of chitosanase in the fermentation broth was detected by the DNS method, and the result showed that the activity of chitosanase reached 796 U / mL.

[0123] Example 4

[0124] The method of Example 3 was used to ferment the engineered strain E. coli-pET28a-BTc01 to produce chitosanase, except that step 3 was replaced with:

[0125] The seed culture was transferred to the fermentation medium at an inoculum volume of 8% and cultured at 37°C and 200 rpm for 2.5 h to allow OD to develop. 600When the concentration reaches 0.6-0.8, lactose is added to a final concentration of 9 g / L, and the mixture is induced and cultured at 30℃ and 160 rpm for 9 h to obtain the fermentation broth.

[0126] The enzyme activity of chitosanase in the fermentation broth was detected using the method described in Example 3, and the result showed that the enzyme activity of chitosanase reached 819 U / mL.

[0127] Example 5

[0128] The method of Example 3 was used to ferment the engineered strain E. coli-pET28a-BTc01 to produce chitosanase, except that step 3 was replaced with:

[0129] The seed culture was transferred to the fermentation medium at an inoculum volume of 8% and cultured at 37°C and 180 rpm for 2.5 h to allow OD to develop. 600 When the concentration reaches 0.6-0.8, lactose is added to a final concentration of 10 g / L, and the mixture is induced and cultured at 28℃ and 160 rpm for 10 h to obtain the fermentation broth.

[0130] The enzyme activity of chitosanase in the fermentation broth was detected using the method described in Example 3, and the result showed that the enzyme activity of chitosanase reached 831 U / mL.

[0131] Example 6

[0132] The method of Example 3 was used to ferment the engineered strain E. coli-pET28a-BTc01 to produce chitosanase, except that step 3 was replaced with:

[0133] The seed culture was transferred to the fermentation medium at an inoculum rate of 10% by volume and cultured at 37°C and 180 rpm for 3 hours to allow OD to develop. 600 When the concentration reaches 0.6-0.8, lactose is added to a final concentration of 8 g / L, and the mixture is induced and cultured at 28℃ and 160 rpm for 8 hours to obtain the fermentation broth.

[0134] The enzyme activity of chitosanase in the fermentation broth was detected using the method described in Example 3, and the result showed that the enzyme activity of chitosanase reached 912 U / mL.

[0135] Example 7

[0136] The method of Example 3 was used to ferment the engineered strain E. coli-pET28a-BTc01 to produce chitosanase, except that step 3 was replaced with:

[0137] The seed culture was transferred to the fermentation medium at an inoculum rate of 10% by volume and cultured at 37°C and 180 rpm for 2 hours to allow OD to develop. 600When the concentration reaches 0.6-0.8, lactose is added to a final concentration of 8 g / L, and the mixture is induced and cultured at 28℃ and 180 rpm for 10 h to obtain the fermentation broth.

[0138] The enzyme activity of chitosanase in the fermentation broth was detected using the method described in Example 3, and the result showed that the enzyme activity of chitosanase reached 957 U / mL.

[0139] Example 8

[0140] The method of Example 3 was used to ferment the engineered strain E. coli-pET28a-BTc01 to produce chitosanase, except that step 3 was replaced with:

[0141] The seed culture was transferred to the fermentation medium at an inoculum rate of 10% by volume and cultured at 30°C and 180 rpm for 2 hours to allow OD to develop. 600 When the concentration reaches 0.6-0.8, lactose is added to a final concentration of 9 g / L, and the mixture is induced and cultured at 28℃ and 160 rpm for 9 h to obtain the fermentation broth.

[0142] The enzyme activity of chitosanase in the fermentation broth was detected using the method described in Example 3, and the result showed that the enzyme activity of chitosanase reached 874 U / mL.

[0143] Example 9

[0144] The method of Example 3 was used to ferment the engineered strain E. coli-pET28a-BTc01 to produce chitosanase, except that step 3 was replaced with:

[0145] The seed culture was transferred to the fermentation medium at an inoculum rate of 10% by volume and cultured at 37°C and 180 rpm for 2 hours to allow OD to develop. 600 When the concentration reaches 0.6-0.8, lactose is added to a final concentration of 10 g / L, and the mixture is induced and cultured at 28℃ and 160 rpm for 10 h to obtain the fermentation broth.

[0146] The enzyme activity of chitosanase in the fermentation broth was detected using the method described in Example 3, and the result showed that the enzyme activity of chitosanase reached 905 U / mL.

[0147] Example 10

[0148] The method of Example 3 was used to ferment the engineered strain E. coli-pET28a-BTc01 to produce chitosanase, except that step 3 was replaced with:

[0149] The seed culture was transferred to the fermentation medium at an inoculum rate of 10% by volume and cultured at 37°C and 180 rpm to allow OD to develop. 600Once the concentration reaches 0.5, lactose is added to a final concentration of 10 g / L, and the mixture is induced and cultured at 28°C and 160 rpm for 12 h to obtain the fermentation broth.

[0150] The chitosanase activity in the fermentation broth was detected using the method described in Example 3, and the result showed that the chitosanase activity reached 754 U / mL.

[0151] Example 11

[0152] The method of Example 3 was used to ferment the engineered strain E. coli-pET28a-BTc01 to produce chitosanase, except that step 3 was replaced with:

[0153] The seed culture was transferred to the fermentation medium at an inoculum rate of 10% by volume and cultured at 37°C and 180 rpm for 2 hours to allow OD to develop. 600 When the concentration reaches 0.6-0.8, lactose is added to a final concentration of 5 g / L, and the mixture is induced and cultured at 28℃ and 160 rpm for 12 h to obtain the fermentation broth.

[0154] The chitosanase activity in the fermentation broth was detected using the method described in Example 3, and the result showed that the chitosanase activity reached 576 U / mL.

[0155] Example 12

[0156] The method of Example 3 was used to ferment the engineered strain E. coli-pET28a-BTc01 to produce chitosanase, except that step 3 was replaced with:

[0157] The seed culture was transferred to the fermentation medium at an inoculum rate of 10% by volume and cultured at 37°C and 180 rpm for 2 hours to allow OD to develop. 600 When the concentration reaches 0.6-0.8, lactose is added to a final concentration of 10 g / L, and the mixture is induced and cultured at 37℃ and 160 rpm for 10 h to obtain the fermentation broth.

[0158] The enzyme activity of chitosanase in the fermentation broth was detected using the method described in Example 3, and the result showed that the enzyme activity of chitosanase reached 749 U / mL.

[0159] The chitosanase BTc01 prepared in this invention exhibits strong enzyme activity and good acid resistance. After being left overnight at pH 3.0-6.0, the remaining enzyme activity remained above 60%. The engineered chitosanase BTc01 strain, with an inoculum of 10%, a lactose induction concentration of 8 g / L, an induction temperature of 28℃, and a fermentation time of 10 h, produced an enzyme activity of up to 957 U / mL. This provides a theoretical basis for the preparation of acid-resistant chitosanase and its application in the green preparation process of chitosan oligosaccharides.

[0160] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. A chitosanase, characterized in that, The chitosanase is as follows: an enzyme with the amino acid sequence shown in SEQ ID NO: 2; or, an enzyme with the amino acid sequence having a tag linked to the amino terminus and / or carboxyl terminus of the amino acid sequence shown in SEQ ID NO: 2; or, an enzyme with the amino acid sequence having a signal sequence linked to the amino terminus of the amino acid sequence shown in SEQ ID NO:

2.

2. A gene encoding chitosanase, characterized in that, This gene has a nucleotide sequence encoding the chitosanase described in claim 1.

3. The gene according to claim 2, wherein The gene has the nucleotide sequence shown in SEQ ID NO:

1.

4. A recombinant vector, characterized in that, The recombinant vector contains the gene described in claim 2 or 3.

5. The recombinant vector according to claim 4, wherein The expression vector of the recombinant vector is the pET28a plasmid.

6. A recombinant strain, characterized in that, The recombinant strain contains the gene described in claim 2 or 3 or the recombinant vector described in claim 4 or 5.

7. The recombinant strain according to claim 6, wherein The starting strain of the recombinant strain is Escherichia coli BL21(DE3).

8. A starter, characterized in that, The starter culture contains the recombinant strain described in claim 6 or 7.

9. The starter culture according to claim 8, characterized in that, The content of the recombinant strain is 10 7 -10 9 CFU per gram of the starter culture.

10. A method for preparing chitosanase, characterized in that, This method includes: inoculating the recombinant strain described in claim 6 or 7 and / or the starter culture described in claim 8 or 9 into a fermentation medium for fermentation, and separating and purifying the fermentation product to obtain chitosanase.

11. The preparation method according to claim 10, characterized in that, The fermentation medium contains: peptone 10 - 15 g / L, yeast extract 20 - 30 g / L, glycerol 8 - 12 g / L, KH2PO4 1 - 3 g / L, K2HPO4 3 - 8 g / L, kanamycin 40 - 60 mg / L; The fermentation process includes: transferring the seed liquid to the fermentation medium at an inoculation amount of 8-10% by volume, culturing at a temperature of 30-45 °C and a rotation speed of 150-200 rpm until OD 600 reaches 0.6-0.8, then adding lactose to the culture solution until its final concentration is 8-10 g / L, and performing induction culture for 8-10 h at a temperature of 28-30 °C and a rotation speed of 140-180 rpm.

12. An enzyme preparation, characterized in that, This enzyme preparation contains the chitosanase prepared by the method described in claim 10 or 11.

13. Use of at least one of the chitosanase described in claim 1, the gene described in claim 2 or 3, the recombinant vector described in claim 4 or 5, the recombinant strain described in claim 6 or 7, the starter culture described in claim 8 or 9, the chitosanase prepared by the method described in claim 10 or 11, and the enzyme preparation described in claim 12 in degrading chitosan.

Images