A nucleic acid aptamer and application thereof in detecting brown algae

Abstract

The application provides a nucleic acid aptamer and application thereof in detection of brown algae. The nucleic acid aptamer for detecting brown algae comprises a nucleotide sequence as shown in SEQ ID:1 or a derivative thereof. The nucleic acid aptamer is screened by SELEX technology, and has high affinity and specificity to brown algae. Compared with existing protein antibodies, the nucleic acid aptamer has the advantages of high affinity, low cost, stable performance, easy chemical synthesis, easy labeling and the like. Therefore, when the nucleic acid aptamer is used to detect brown algae, the operation is simple and fast, and high accuracy and sensitivity can be achieved.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of bioengineering technology, and particularly relates to a nucleic acid aptamer and application thereof in detection of Phaeocystis globosa. BACKGROUND

[0002] Phaeocystis globosa Scherffel belongs to Haptophyceae or Prymnesiophyceae and Prymnesiales, is a kind of eurythermic and euryhaline plankton, and is widely distributed in the near shore and open ocean in the world. It frequently causes large-scale red tide phenomenon under eutrophic conditions. The occurrence of red tide not only seriously endangers the water ecology, but also causes serious economic losses due to the death of aquatic economic animals such as fish caused by hemolytic toxins and cell toxins produced by the red tide, and seriously endangers the coastal marine environment due to the production of toxic and harmful substances such as methylpropanesulfonic acid and dimethyl sulfide. At present, the diagnosis methods for Phaeocystis globosa mainly include morphological observation method and molecular biology detection method, mainly including microscopic observation, PCR technology and the like. The microscopic observation result is not accurate enough; the PCR technology detection result is accurate and reliable, but has the disadvantages of complicated operation, long time consumption, expensive instruments and reagents, and the like, and cannot meet the requirements of on-site rapid and accurate detection and diagnosis. Therefore, efforts should be made to develop rapid detection technology and functional products of Phaeocystis globosa which are convenient to operate, low in cost, short in time consumption, high in accuracy and can be used on site, which is crucial for early detection and determination of pathogens, and then formulating treatment programs to control the spread of Phaeocystis globosa and reduce losses.

[0003] The nucleic acid aptamer is a single-stranded oligonucleotide with high specificity for recognizing target substances, which is obtained by using the Systematic evolution of ligands by exponential enrichment (SELEX) technology through multiple rounds of strict screening in vitro. The nucleic acid aptamer has the advantages of stable structure, easy chemical synthesis and modification, many targets, low cost and the like. Based on the biological characteristics that the nucleic acid aptamer can recognize pathogenic microorganisms or diseased cells with high specificity, the nucleic acid aptamer has been widely applied to the development of detection technology and the construction of biosensors, and can realize accurate detection and diagnosis of pathogens or diseases. Therefore, the nucleic acid aptamer has broad application prospects in various biological fields such as diagnosis of pathogens or diseases, virus infection mechanism and drug targeting delivery system. SUMMARY

[0004] In order to improve the detection level of Phaeocystis globosa, the present application aims to provide a nucleic acid aptamer and application thereof in detection of Phaeocystis globosa.

[0005] According to one aspect of the present application, there is provided a nucleic acid aptamer, the nucleotide sequence of which is shown in SEQ ID: 1.

[0006] Preferably, at least one base on the nucleotide sequence is phosphorylated, sulfhydrylated, methylated, aminated or isotopically labeled.

[0007] Preferably, the secondary structure thereof is as follows:

[0008]

[0009] Preferably, at least one base on the nucleotide sequence is phosphorylated, sulfhydrylated, methylated, aminated or isotopically labeled.

[0010] Preferably, a functional group is attached to the nucleotide sequence, the functional group being selected from one or more of a biotin label, a luminescent label and an enzyme label.

[0011] Preferably, the nucleic acid aptamer of any one of the above is used in the preparation of a product for detecting Phaeocystis globosa, the use not including use in disease diagnosis.

[0012] Preferably, the product is a fluorescent molecular probe, and the nucleic acid aptamer has a luminescent label attached thereto.

[0013] According to a third aspect of the present application, there is provided a method for constructing the nucleic acid aptamer for detecting Phaeocystis globosa, comprising the following steps: step one, providing a first ssDNA library and a pair of PCR primers, the first ssDNA library comprising a single-stranded DNA sequence as follows: 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC, and the PCR primers comprising an upstream primer and a downstream primer, the upstream primer comprising a DNA sequence as shown in SEQ ID: 2, and the downstream primer comprising a DNA sequence as shown in SEQ ID: 3; step two, incubating the random ssDNA library with Phaeocystis globosa cells to obtain a second ssDNA library that specifically recognizes Phaeocystis globosa through screening; step three, using the second ssDNA library as a template and using the PCR primers to perform PCR amplification to obtain a dsDNA library; step four, incubating the dsDNA library with magnetic beads labeled with streptavidin, separating the magnetic beads after incubation, and then purifying and separating a third ssDNA library that specifically recognizes Phaeocystis globosa and is bound to the magnetic beads to obtain the nucleic acid aptamer for detecting Phaeocystis globosa. In the single-stranded DNA sequence of the first ssDNA library, the two ends are fixed sequences, and the "50N" in the middle represents a random sequence of 50 nucleotides in length.

[0014] Preferably, in step three, PCR amplification is performed according to the following procedure: 92℃ for 5 minutes, 92℃ for 1 minute, 60℃ for 30 seconds, 72℃ for 1 minute, for 25 cycles; 72℃ for 5 minutes.

[0015] The nucleotide sequence SEQ ID: 1 is screened by the SELEX technology, and the nucleic acid aptamer corresponding to the nucleotide sequence SEQ ID: 1 can be combined with the spherical brown cyst by the van der Waals force and the electrostatic action between the charged groups, that is, the nucleic acid aptamer provided by the application has high affinity and specificity for the spherical brown cyst. Compared with the existing protein antibodies, the nucleic acid aptamer provided by the application has the advantages of high affinity, low cost, stable performance, easy chemical synthesis, easy labeling and the like. Therefore, when the nucleic acid aptamer provided by the application is used to detect the spherical brown cyst, not only the operation is simple and fast, but also high accuracy and sensitivity can be achieved. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 is a secondary structure prediction diagram of the nucleic acid aptamer with the nucleotide sequence SEQ ID: 1;

[0017] Figure 2 is a flow cytometry detection of the combination of the hydroxyfluorescein (FAM) labeled SEQ ID: 1 and the spherical brown cyst cells in test example 1;

[0018] Figure 3 is the intensity of the mutual combination of the FAM labeled SEQ ID: 1 and the spherical brown cyst cells in test example 1. DETAILED DESCRIPTION

[0019] In order for those skilled in the art to better understand the technical solutions in the present application, the technical solutions of the present application will be described clearly and completely in combination with the drawings of the embodiments and examples of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor should belong to the scope of protection of the present application.

[0020] Embodiment 1

[0021] 1. Screening and preparation of nucleic acid aptamer for detecting spherical brown cyst

[0022] S1. Construction of first ssDNA library and synthesis of primer

[0023] A first ssDNA library Library 50 was designed and synthesized, and the nucleotide sequence thereof was as follows: 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC, wherein the two ends were fixed sequences, and the middle 50 nucleotides were random sequences.

[0024] The upstream primer comprised a nucleotide sequence as shown in SEQ ID: 2, and was labeled with hydroxyfluorescein (FAM), and the specific sequence was: 5'-FAM-GACGCTTACTCAGGTGTGACTCG-3'.

[0025] The downstream primer comprised a nucleotide sequence as shown in SEQ ID: 3, and was labeled with biotin (Biotin), and the specific sequence was: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3'.

[0026] The first ssDNA library and the primer were both synthesized by Shanghai Sangon Biological Co., Ltd.

[0027] S2. SELEX screening to obtain a nucleic acid aptamer specifically recognizing Phaeocystis globosa (positive screening)

[0028] S2.1. 10 nmol of the above first ssDNA library was dissolved in 500 μL of PBS, and then incubated in an ice bath for 10 min after being inserted into an ice bath for 5 min at 92°C. The treated first ssDNA library was then incubated with Phaeocystis globosa cells on ice for 1 h.

[0029] S2.2. After the incubation and combination were completed, the supernatant was removed by centrifugation, and the Phaeocystis globosa cells were washed with 10 mL of PBS. The cells were then incubated in a water bath at 92°C for 10 min, and the supernatant was collected by centrifugation at 12000g, thereby obtaining a second ssDNA library of the Phaeocystis globosa cells.

[0030] S3. PCR amplification

[0031] 100 μL of the second ssDNA library obtained by screening was taken, and subjected to PCR amplification with the upstream primer and the downstream primer. The PCR reaction system was as follows (1000 μL): 10×Buffer 100 μL, dNTP Mix (2.5 mM) 80 μL, upstream primer 40 μL, downstream primer 40 μL, second ssDNA library 100 μL, rTaq enzyme 12.5 μL, and ddH2O 627.5 μL. The PCR amplification was performed according to the following program: 92°C for 5 min, 92°C for 1 min, 60°C for 30 s, 72°C for 1 min, 25 cycles, and 72°C for 5 min. The supernatant obtained after the first cycle of screening was used for subsequent PCR amplification, thereby obtaining a dsDNA library after amplification.

[0032] S4. Preparation of the third ssDNA library

[0033] 100 μL streptavidin-labeled magnetic beads were incubated with the dsDNA library at room temperature for 20 min. The dsDNA library was combined to the surface of the magnetic beads by the affinity between the biotin on the dsDNA library and the streptavidin on the magnetic beads. The supernatant was removed by magnetic separation. The magnetic beads were washed twice with PBS buffer. Then, 200 μL NaOH solution (200 mM) was added to the EP tube. The dsDNA library was denatured and dissociated by incubation at room temperature for 15 min. The single strand with biotin was combined to the magnetic beads by the streptavidin. The magnetic beads were separated, and the supernatant was collected. The forward ssDNA in the supernatant was purified by a PCR purification recovery kit. The collected solution was used for the next round of screening.

[0034] S5. Repeated screening

[0035] The third ssDNA library obtained in S4 was used to replace the first ssDNA library. The positive screening process, PCR amplification and preparation of the single-stranded DNA library shown in S2-S4 were repeated 9 times.

[0036] S6. Negative screening

[0037] In the second round and the rounds after the second round of screening in S5, the ssDNA library obtained after the screening in S5 was subjected to negative screening with Skeletonema costatum cells as a control to improve the screening efficiency. The specific negative screening process was as follows: the ssDNA library obtained by screening was dissolved, and incubated with Skeletonema costatum cells on ice at 92°C for 1 h. After the incubation, the supernatant was collected by centrifugation, which was the ssDNA library subjected to negative screening.

[0038] S7. 9 rounds of screening

[0039] The supernatant containing the ssDNA library collected in S6 was subjected to PCR amplification in S3 and preparation of the ssDNA library in S4. Then, the processes of S6, S2, S3 and S4 were repeated in turn. The change in the recognition ability of the obtained ssDNA library to Phaeocystis globosa cells was detected by a flow cytometer. The screening was repeated for 9 rounds. At this time, the recognition ability of the obtained ssDNA library to Phaeocystis globosa cells reached the strongest. After the amplification product was cloned and sequenced, the aptamer for detecting Phaeocystis globosa cells in this example was finally obtained. The nucleotide sequence of the aptamer was as follows:

[0040] TCGGTCGGGTGGTTGGGGTGGGTGGTCGGTTTCTCTCTGCGCTGGCTT GGTGTGGTTGGATC (SEQ ID: 1).

[0041] The secondary structure of SEQ ID: 1 was predicted online by MFOLD software (http: / / mfold.rna.albany.edu / ?q=mfold / DNA-Folding-Form), and the prediction result is shown in Figure 1 As shown in the figure, the nucleic acid aptamer with the nucleotide sequence of SEQ ID: 1 forms special stem-loop structure and hairpin structure.

[0042] Test Example 1

[0043] 1. Test object

[0044] The nucleic acid aptamer constructed in Example 1, which has the nucleotide sequence of SEQ ID: 1, was used, wherein the spherical brown cyst algae cells not incubated with the nucleic acid aptamer were used as a control group, and the spherical brown cyst algae cells incubated with the FAM-labeled nucleic acid aptamer of SEQ ID: 1 were used as an experimental group.

[0045] 2. Test method

[0046] (1) The binding effect of the FAM-labeled nucleic acid aptamer to the spherical brown cyst algae cells and its specificity were detected by flow cytometry;

[0047] (2) The mutual binding strength of the FAM-labeled nucleic acid aptamer to the spherical brown cyst algae cells was analyzed by flow cytometry and Sigmaplot software, and the specific steps of the test are as follows: solutions of the nucleic acid aptamer SEQ ID: 1 with different concentrations (0-1000 nM) were prepared in parallel. The nucleic acid aptamer was labeled with FAM, and the labeled nucleic acid aptamer was dissolved in 500 μL of PBS to prepare solutions with concentrations of 62.5, 125, 250, and 1000 nmol / L, respectively. The solutions were incubated at 92°C for 5 min, then quickly inserted into ice for 10 min, and then the treated nucleic acid aptamer was incubated with the spherical brown cyst algae cells on ice for 1 h. After the incubation and binding were completed, the cells were washed 3 times by centrifugation, resuspended with 300 μL of PBS buffer, and the cell suspension was obtained. The fluorescence average value of the above cell suspension was detected by flow cytometry, and then the dissociation equilibrium constant (Kd) of the nucleic acid aptamer SEQ ID: 1 binding to the target cells was calculated by using Sigmaplot software.

[0048] 3. Test results and analysis

[0049] The incubation and binding process of the aptamer and the Phaeocystis globosa cells is shown in Example 1. From the FAM-labeled results detected by the flow cytometry, the aptamer corresponding to SEQ ID: 1 has high specific recognition ability to the Phaeocystis globosa cells. In the test of the recognition ability of the aptamer provided by the present application to the Phaeocystis globosa cells, the difference between the control group and the experimental group is that an equal amount of PBS solution is selected instead of the aptamer in the incubation process. The binding of SEQ ID: 1 to the Phaeocystis globosa cells is shown in Figure 2 .

[0050] Subsequently, the flow cytometry detects the fluorescence average value of the specific binding of the aptamer to the Phaeocystis globosa cells, and then the Sigmaplot software is used to calculate the dissociation equilibrium constant (Kd) of the aptamer with the nucleotide sequence of SEQ ID: 1 binding to the target cells. The results confirm that the affinity of the aptamer with the nucleotide sequence of SEQ ID: 1 binding to the target Phaeocystis globosa is 652.43 nmol / L. The dissociation equilibrium constant results of the target cells binding to SEQ ID: 1 are shown in Figure 3 .

[0051] The above examples are only used to illustrate the technical solutions of the present application and not to limit the protection scope of the present application. Although the present application has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present application can be modified or replaced equivalently without departing from the essence and scope of the technical solutions of the present application.

Claims

1. A nucleic acid aptamer, characterized in that: The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID:

1.

2. The nucleic acid aptamer as described in claim 1, characterized in that: At least one base on the nucleotide sequence is phosphorylated, thiolated, methylated, aminoized, or isotopized.

3. The nucleic acid aptamer as described in claim 1, characterized in that, Its secondary structure is as follows:

4. The nucleic acid aptamer according to any one of claims 1 to 3, characterized in that: The nucleotide sequence is attached to a functional group, which is selected from one or more of biotinylate markers, luminescent markers, and enzyme markers.

5. The use of the nucleic acid aptamer according to any one of claims 1 to 3 in the preparation of a product for detecting *Phaeocystis globosa*, wherein the use does not include its use in disease diagnosis.

6. The application as described in claim 5, characterized in that: The product is a fluorescent molecular probe, and the nucleic acid aptamer is attached with a luminescent marker.

Images