A probe and primer combination for detecting human PKD1 gene variation and its application

Abstract

The present invention discloses a probe and primer combination for detecting human PKD1 gene variation and its application, belonging to the field of gene detection technology. In the field of pre-embryo implantation detection and prenatal diagnosis, due to the technical limitations of the tripping phenomenon caused by uneven amplification and the objective existence of developmental biology characteristics, the rapid development of diagnosis and treatment needs require us to be able to efficiently, conveniently and low-cost detect 0.01% PKD1 pathogenic mutations, while excluding the interference of its pseudogenes and high GC content. In response to this demand, the present invention provides a method and a kit for PKD1 true gene variation information with a sensitivity of 0.001%, which is not only suitable for the detection of conventional samples, but also more suitable for the detection of single-cell level samples, single-cell amplification samples, and free DNA samples, and provides specific primers and kits that allow selective amplification of one or more exons of the PKD1 true gene.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a probe and primer combination for detecting human PKD1 gene variation and an application thereof. Background Art

[0002] Autosomal dominant polycystic kidney disease (ADPKD) is a common late-onset systemic disease with an incidence of 1 / 1000-1 / 400. As ADPKD develops, up to 50% of patients will develop end-stage kidney disease (ESKD) by the age of 60. Therefore, ADPKD is one of the most common causes of ESKD. In the reported cases of ADPKD, pathogenic mutations were found to be PKD1 (78%), PKD2 (15%), GANAB (0.3%) and NAJB11 (0.1%), and about 7% were unknown genetic factors. The diagnosis of ADPKD is mainly determined by renal imaging, but the disease usually has no clinical symptoms in newborns, so it is estimated that less than 1 / 2 of the patients are diagnosed.

[0003] The PKD1 gene is located on chromosome 16 (16p13.3) and contains about 52,000 bp. Among them, 46 exons of 14,148 bp encode 4,304 amino acids. Due to the rearrangement of chromosome 16, 16p has produced a region highly homologous to the PKD1 gene at 16p13.1. The research of Bogdanova et al. showed that these highly homologous regions are all pseudogenes of PKD1. Recent studies have shown that although there are 6 pseudogenes with a gene sequence similarity of up to 97.7% in nearly one-fourth of the PKD1 gene region (exons 1-33), the proportion of their pseudogenes in different exon regions ranges from 14% to 33%. The complexity of the PKD1 gene structure, in addition to the highly homologous pseudogenes, the GC content of exon 1 is as high as 85%.

[0004] Due to the existence of pseudogenes and high GC regions, conventional detection methods have many obstacles for genetic detection of the PKD1 gene. At present, the mainstream analysis method is to use long-range polymerase chain reaction (Long-Range PCR, LR-PCR) combined with next-generation sequencing (Next Generation Sequencing, NGS) to detect the PKD1 gene. NGS technology has the advantages of high throughput, rapidity, and low cost, and can realize the simultaneous detection of multiple samples and multiple genes. However, NGS technology cannot obtain effective data in high GC areas. In addition, due to the short read sequence of NGS, it is difficult to distinguish the PKD1 gene from its pseudogene. At the same time, Sanger sequencing is the gold standard for determining pathogenic gene mutations. Using only NGS technology cannot provide accurate sequencing results and cannot fully meet the actual clinical needs.

[0005] The slowdown of population growth has become a reality. With the implementation of the three-child policy, the national policy of eugenics has been further strengthened. The phenomenon of an increase in the proportion of new mutations in the fetus due to factors such as the advanced age of men and women has become prominent. Assisted reproduction and prenatal diagnosis technology have become important and powerful means to solve fertility difficulties and eugenics, accounting for more than 50% of all fertility solutions. Assisted reproductive technology involves the screening of embryos and other links. It is necessary to use a single or a small number of cells and their amplified products to identify pathogenic sites. The single-cell whole genome amplification technology currently used will cause allele dropout, that is, after whole gene amplification, the heterozygous sites in the genome seriously deviate from the 50%:50% ratio and present a relationship of 0.01% to 99.99%:99.99% to 0.01%. Specifically, in the PKD1 gene, it can be described as: due to the existence of 6 pseudogenes, in the original genome sample, the proportion of pathogenic genotypes in the heterozygous sites of the PKD1 true gene is 1 / 7*50%=7%. Due to the existence of the whole gene amplification dropout phenomenon, it specifically presents a ratio of 0.01% to 99. The ratio of 99%:99.99% to 0.01% is not detectable by the traditional LR-PCR combined with NGS technology, resulting in misdiagnosis. Although another genetic linkage detection technology for single gene diseases before embryo transfer can overcome the trouble caused by the disconnection phenomenon to a certain extent, it requires the development of a haplotype family pedigree chart, which will lead to high detection costs and waste of up to half of the embryos. After the embryo screening stage, the embryo is transferred into the uterus for development. Traditional non-invasive testing cannot further determine whether the fetus contains harmful PKD1 mutations. Specifically, the maternal peripheral blood free DNA usually contains 5% to 10% of fetal free DNA, and the proportion of PKD1 true gene pathogenic genotypes decreases from 7% to 0.35% to 0.7%. At this time, the traditional LR-PCR combined with NGS technology and genetic linkage detection technology cannot be used, and amniocentesis can only be performed to further determine whether the fetus contains PKD1 true gene pathogenic mutations before delivery. Amniocentesis is a surgery with a 2%-5% risk of miscarriage, which brings great economic and mental pressure to the patient's family.

[0006] In summary, we can see that in the field of pre-embryo implantation testing and prenatal diagnosis, due to technical limitations and the objective existence of developmental biology characteristics, reality requires us to be able to efficiently, conveniently and cost-effectively detect 0.01% PKD1 pathogenic mutations while excluding the interference of its pseudogenes and high GC content. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides a kit that can stably detect 0.01% of the true gene variation information of PKD1 with a sensitivity of 0.001%, which is not only suitable for the detection of conventional samples, but also more suitable for the detection of single-cell level samples, single-cell amplified samples, and free DNA samples.

[0008] The first object of the present invention is to provide a probe and primer combination for detecting human PKD1 gene variation:

[0009] The primers are upstream primers and downstream primers for amplifying any one or more exons 1-33 of the human PKD1 gene;

[0010] The probe covers one or more PKD1 true and false gene base difference sites;

[0011] At 0.25mol / L salt concentration and 55°C:

[0012] The Gibbs free energy ΔG of the probe meets the requirement of -20.7073 kcal / mol≤ΔG≤-44.6782 kcal / mol;

[0013] The Gibbs free energy ΔG of the upstream primer meets the requirement of -15.1985 kcal / mol≤ΔG≤-19.5029 kcal / mol;

[0014] The difference ΔΔG between the Gibbs free energy of the probe and the upstream primer is within the range of -3.6107×N / Tr, wherein N is an integer of 54 to 457, and Tr is the annealing temperature of the PCR cycle.

[0015] Furthermore, the sequence of the probe is as follows:

[0016]

[0017]

[0018] Wherein X1 is one of CCC, CCCG, CGGG, CGCG, GCGG, GGCG, GGGG, CCGC, CCCC, GCGG, GGG, CGCC, GGCC, GGTT, GGC, GGT, CCG, CGC, GGGC, CCTT, and GCG.

[0019] Furthermore, the sequence of the upstream primer is as follows:

[0020]

[0021]

[0022]

[0023] Further, the sequence of the downstream primer is as follows:

[0024] Downstream primer name Sequence 5’-3’ PKD1_Exon1_RP CAGGAAACAGCTATGACCGACCTCCAGGCGTTCCTTATTTAGC PKD1_Exon2&3_RP CAGGAAACAGCTATGACCGACGATCTGGTCTCAAGCCTGGAAG PKD1_Exon4&5.1_RP CAGGAAACAGCTATGACCGACACAGGTGGGGGCAGGAG PKD1_Exon5.2_RP_rev CAGGAAACAGCTATGACCGACCAGCGCCTTCTGCTTCTCC PKD1_Exon5.3_RP CAGGAAACAGCTATGACCGACGGGTGTCAACGGTCAGTGTG PKD1_Exon6_RP_rev CAGGAAACAGCTATGACCGACGGGCAGAGCCTGGTACCC PKD1_Exon7_RP TCCTCCTCAGCCCAGGC PKD1_Exon8_RP CAGGAAACAGCTATGACCGACTGTCGCTCGAGAGGAAGACTC PKD1_Exon9_RP_rev CAGGAAACAGCTATGACCGACCCAGAGTGCAGAGAGGAAAGC PKD1_Exon10_RP CAGGAAACAGCTATGACCGACGACCCTGGGCAGCAGAC PKD1_Exon11_RP GCAGTGCTACCACTGAGAACA PKD1_Exon12_RP_rev CAGGAAACAGCTATGACCGACTGGCTGGAGAGCCGGAC PKD1_Exon13_RP CAGGAAACAGCTATGACCGACCGAGGCTCAGAAAAGCAACC PKD1_Exon14_RP CAGGAAACAGCTATGACCGACCTCCAAGTGCAGCTGCACTC PKD1_Exon15.1_RP CAGGAAACAGCTATGACCGACGAAGGTCCACGTGATGTTGTC PKD1_Exon15.2_RP CAGGAAACAGCTATGACCGACGTGTAGCGGTAGGGGAACG PKD1_Exon15.3_RP CAGGAAACAGCTATGACCGACGCTTCACCGTCACATTGAGC PKD1_Exon15.4_RP CAGGAAACAGCTATGACCGACCCTGCAGCTGTACCGTGT PKD1_Exon15.5_RP CAGGAAACAGCTATGACCGACGGTGACATGAGGGCCACG PKD1_Exon15.6_RP CAGGAAACAGCTATGACCGACACGCGGGCTGTGAAGTTC PKD1_Exon15.7_RP CAGGAAACAGCTATGACCGACGGTCAACGTGGGCCTCCA PKD1_Exon15.8_RP_(N) CAGGAAACAGCTATGACCGACCGACAAACACAAAGCAGTAGTG PKD1_Exon15.9_RP_2 CAGGAAACAGCTATGACCGACCCTGAGAGCCCCATCCAGT PKD1_Exon16_RP CAGGAAACAGCTATGACCGACGGAACTGTGGCAGGTTTGGAA PKD1_Exon17_RP CCTGTCAGCCCCACTTCTG PKD1_Exon18&19_RP_rev CAGGAAACAGCTATGACCGACAGGGCAGAGGGTTGCGC PKD1_Exon20_RP_rev CAGGAAACAGCTATGACCGACTTCAGGCCACACTTCGAGGTG PKD1_Exon21_RP CAGGAAACAGCTATGACCGACTGGGGGGCTGAACCCAG PKD1_Exon22_RP(4) CAGGAAACAGCTATGACCGACAGGGCGTGTGCAAGGAGT PKD1_Exon23_RP CCCTCATGCGCATCCTCAT PKD1_Exon24_RPrev CAGGAAACAGCTATGACCGACGCAGAGGCTCCTATGGCCT PKD1_Exon24&25_RP CAGGAAACAGCTATGACCGACGTGCAAGCTGTGCCTTCTC PKD1_Exon26_RP CAGGAAACAGCTATGACCGACCCAGCTAGGAGCTGTCCTAGT PKD1_Exon28_RP GCTTGTCAAAGAAGCCACGC PKD1_Exon29&30_RP_rev CAGGAAACAGCTATGACCGACCTCGTTCCATGTTCCCACTC PKD1_Exon31&32_RP_rev CAGGAAACAGCTATGACCGACGCTTCTCATCCCTGTCCTGAG PKD1_Exon32&33_RP CAGGAAACAGCTATGACCGACTCAGGTCTTCATCTAGAGGTACAGG PKD1_Exon32&33_RP CAGGAAACAGCTATGACCGACTCAGGTCTTCATCTAGAGGTACAGG PKD1_Exon15_RP(1) CAGGAAACAGCTATGACCGACCCAGCTACCTGTGGGATCT PKD1_Exon5_RP CAGGAAACAGCTATGACCGACAGCGATGTGGAAGGCTGCTAG PKD1_Exon24_RP CAGGAAACAGCTATGACCGACGCCCATACCCGGTCCAGT PKD1_Exon15_RP(2) CAGGAAACAGCTATGACCGACCCGAGACCCAGGCTCCTA

[0025] Furthermore, the 3′ end of the probe is modified with C3 spacer, C6 spacer, Biotin, PO3 or amino group to block the extension of the probe.

[0026] Further, the annealing temperature of the PCR cycle is degrees Celsius, preferably 60°C.

[0027] Furthermore, the molecular ratio of the upstream primer to the probe is 1:1 to 1:100.

[0028] Furthermore, the final concentration in the system is 10 μM to 300 μM, preferably 100 μM.

[0029] Furthermore, the 3' end of the upstream primer and the 5' end of the probe have 3 to 30 bases in common.

[0030] Furthermore, the locations of the true and false gene characteristic sites (i.e., true and false gene base difference sites) in the human reference genome are shown in the following table, and the probes need to cover these sites:

[0031]

[0032]

[0033] Furthermore, the length of the amplified product is 30-1500 bp, and the amplified product is preferably detected using first-generation sequencing, second-generation sequencing, third-generation sequencing, PCR, qPCR, ddPCR and other platforms.

[0034] The second object of the present invention is to provide a kit for detecting ultra-low ratio variation of human PKD1 gene, the kit comprising the above-mentioned probe and primer combination.

[0035] The third object of the present invention is to provide the use of the above probe and primer combination in the preparation of an autosomal dominant polycystic kidney disease detection reagent.

[0036] By means of the above scheme, the present invention has at least the following advantages:

[0037] The present invention is used to amplify one or more different exons of the PKD1 true gene in a sample, including one or more non-extendable oligonucleotide chains BL (i.e., probes), one or more extendable oligonucleotide chains FP (i.e., upstream primers) and one or more extendable oligonucleotide chains RP (i.e., downstream primers). This combination can detect ultra-low proportion PKD1 gene mutations and achieve a detection effect with a sensitivity of 0.01% to 0.001%.

[0038] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the following is a description of the preferred embodiments of the present invention in conjunction with detailed drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to make the contents of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings.

[0040] Figure 1 This is the fluorescence signal result of detecting the true gene of PKD1 in single-cell level samples;

[0041] Figure 2 This is the first-generation sequencing result of the qPCR product for detecting the true gene of PKD1 in single-cell level samples;

[0042] Figure 3 The reaction results of adding Blocker to blastocyst 1;

[0043] Figure 4 The reaction results of adding Blocker to blastocyst 2;

[0044] Figure 5 The reaction results of adding Blocker to blastocyst 3;

[0045] Figure 6 To detect the first-generation sequencing results of the PKD1 authentic gene in the Phi29 single-cell amplification product;

[0046] Figure 7 This is the single-blind verification result;

[0047] Figure 8 The results were verified by single-cell amplification products of blastocysts containing the PKD1 c.348_352delTTTAA mutation;

[0048] Fig. 9 This is the qPCR result of PKD1 authentic gene detection at 0.001% of PKD1 Exon5 region;

[0049] Figure 10-11 It is the result of first-generation sequencing of 0.001% of the PKD1 true gene detection in the PKD1 Exon5 region;

[0050] Fig.12 This is the qPCR result of PKD1 authentic gene detection at 0.001% of PKD1 Exon24 region;

[0051] Figure 13-14 This is the result of first-generation sequencing of 0.001% of the PKD1 true gene detection in the PKD1 Exon24 region;

[0052] Fig.15 It is the result of PKD1 true gene detection of cfDNA;

[0053] Fig.16 This is the result of detecting exons with high GC content in the PKD1 true gene;

[0054] Figure 17-18 To optimize the results of the primer and blocker concentration ratio;

[0055] Figure 19-22 The results of energy design to optimize primers and blockers;

[0056] Fig.23 is the qPCR procedure in Example 1;

[0057] Fig.24 The thermal cycle program in Example 4;

[0058] Fig.25 The thermal cycle program in Example 5;

[0059] Fig.26 This is the thermal cycle program in Example 6. DETAILED DESCRIPTION

[0060] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0061] The materials involved in the following embodiments are as follows:

[0062] Each oligonucleotide chain BL has one or more X1 cores. When the salt concentration of the oligonucleotide chain BL is 0.25 mol / L and the temperature is 55°C, the Gibbs free energy ΔG of the oligonucleotide chain BL is in the range of -20.7073 kcal / mol≤ΔG≤-44.6782 kcal / mol. The sequence of the preferred oligonucleotide chain BL is as follows:

[0063]

[0064]

[0065] The oligonucleotide chain FP needs to be used in conjunction with the corresponding oligonucleotide chain BL to achieve the corresponding technical effect: when the salt concentration of the oligonucleotide chain FP is 0.25 mol / L and the temperature is 55°C, the Gibbs free energy ΔG is in the range of -15.1985 kcal / mol≤ΔG≤-19.5029 kcal / mol; wherein the difference ΔΔG between the Gibbs free energy of BL and FP is in the range of -3.6107×N / Tr, wherein Tr is the value of the annealing temperature (degrees Celsius) of the PCR cycle, preferably 60, N is an integer in the range of 54 to 457, and ΔΔG can be fine-tuned by X1; the sequence of the preferred oligonucleotide chain FP is as follows:

[0066]

[0067]

[0068] When detecting ultra-low ratio PKD1 gene mutations, one or more oligonucleotide chains RP are required to cooperate in implementing a complete PCR reaction. The preferred oligonucleotide chain RP sequence is as follows:

[0069]

[0070]

[0071] Example 1 Detection of PKD1 authentic gene in single cell level samples

[0072] Purpose: Generally speaking, the amount of DNA template in ordinary PCR reactions is in the range of a dozen nanograms to several hundred nanograms. The less the amount of DNA template, the more difficult it is to perform PCR. The DNA of a human cell is approximately 6.67 pg, and 10 ng is approximately equivalent to the amount of DNA contained in 1,500 cells. In the specific scenarios of pre-embryo implantation detection and prenatal diagnosis, it is often necessary to detect samples of 1 to 10 cells. In this embodiment, the peripheral blood genomic DNA is diluted to a low concentration, and DNA of approximately 1.5 cells, 4.5 cells, and 9 cells is taken for detection. The purpose is to prove that the scheme and system disclosed in the present invention can directly detect the true PKD1 gene by simulating a single-cell-level DNA template.

[0073] 1. The samples and reagents that need to be prepared are:

[0074] The extracted peripheral blood genomic DNA was quantified by ddPCR and diluted appropriately to obtain 2pg / μL, 6pg / μL, 12pg / μL and 2000pg / μL standards, as well as a primer combination for PKD1 exon 15, including FP:RP:BL=1:1:10, ZoomBDA Master Mix and nuclease free water.

[0075] 2. The 30 μL qPCR reaction system is as follows:

[0076]

[0077]

[0078] 3. Mix the PCR tubes and centrifuge them, then place them in the 7500 real-time fluorescence quantitative PCR system and select " In the "Reagents" mode, set the reporter channel in define targets to "SYBR" and set the following Fig.23 qPCR program shown:

[0079] 4. Fluorescence signal results such as Figure 1 The results showed that when the DNA input was as low as 10 pg (standard in the 2 pg / μL group), a stable fluorescence signal could still be obtained.

[0080] 5. Perform first generation sequencing on the qPCR product, and the result is returned as follows Figure 2 .

[0081] The true and false gene recognition site information is TC / AA, C / T, C / T from left to right. It can be seen from the first-generation sequencing results that our public system successfully performs PCR amplification on single-cell-level DNA samples while also suppressing the PKD1 pseudogene very well. The true and false gene recognition sites show pure peaks of TC, C, and C bases in the first-generation sequencing results, indicating that only the characteristic information of the PKD1 true gene appears in the first-generation sequencing results.

[0082] Example 2 Detection of PKD1 true gene information in MALBAC single-cell amplification products

[0083] Purpose: In specific clinical application scenarios such as pre-embryo implantation detection and prenatal diagnosis, the amount of DNA in 1 to 10 cells is usually too little, so whole-genome amplification is required before downstream testing. There are many whole-genome amplification kits for single cells, but they all have the phenomenon of disconnection. This example shows that after using the MALBAC kit for single-cell whole-genome amplification, a conventional PGT-M test is first performed to obtain the site information of each embryo sample, and then a suitable primer set is selected from the primers disclosed in the present invention, and the primer set is used for single-blind verification, and finally the result is checked with the PGT-M result.

[0084] 1. The samples and reagents that need to be prepared are:

[0085] Three blastocyst single cell samples from a family were amplified by the MALBAC kit and then subjected to the corresponding clinical PGT-M test. The remaining product was diluted to 2 ng / μL for standby use. The primer combination required in this example is PKD1_Exon15_FP:-18:-1, PKD1_Exon15_B:-6:+14 and PKD1_Exon15_RP(1), where FP:RP:BL=1:1:20, and other reagents include ZoomBDA MasterMix and nuclease free water.

[0086] 2. The 30 μL qPCR reaction system is as follows:

[0087] PCR components Addition volume (μL) Forward Primer 3 Reverse primer 3 Blocker 3 DNA 5 Nuclease Free Water 1 ZoomBDA Master Mix 15

[0088] 3. Mix the PCR tubes and centrifuge them, then place them on a PCR thermal cycler. The PCR procedure is the same as in Example 1:

[0089] 4. Perform Sanger sequencing on the PCR products. After Sanger sequencing, mutations were found in blastocysts 1 and 3, but not in blastocyst 2. Our results are consistent with those of PGT-M. The sequencing results are as follows:

[0090] The reaction results of adding Blocker to blastocyst 1 ( Figure 3 ), i.e., the nucleotide BL (the same below) in the scheme of the present invention, wherein the information of the true and false gene recognition sites indicates that the sequence detected by Sanger is the sequence of the true PKD1 gene, and the mutation site information is a C / A hybrid. The entire sequencing result shows that the mutation and the characteristic site of the true PKD1 gene are on the same chain, i.e., the mutation of C>A occurs on the true PKD1 gene. In the result of the sequence without Blocker in Blastocyst 1, i.e., the result of ordinary PCR, the true and false gene recognition sites are T / C double peaks, indicating that the true and false genes are mixed together and cannot be separated, and at the same time, there is no A signal at the mutation site where mutation may occur, that is, the scheme of the present invention has achieved the technical effect of suppressing the PKD1 pseudogene and identifying the mutation on the true gene.

[0091] The interpretation of the results of blastocyst 2 is the same as that of blastocyst 1 ( Figure 4 ), but no A signal was found at the mutation site in Blastocyst 2, therefore, no C>A mutation occurred in the true PKD1 gene of Blastocyst 2.

[0092] The interpretation of the results of blastocyst 3 is the same as that of blastocyst 1 ( Figure 5), that is, a C>A mutation on the PKD1 true gene was detected in the single-cell whole genome amplification product of blastocyst 3. After unblinding, the results of PGT-M were consistent with our test results, that is, the solution of the present invention achieved the technical effect of suppressing the PKD1 pseudogene, identifying mutations on the true gene, and being consistent with the results of PGT-M technology.

[0093] Example 3 Detection of PKD1 authentic gene information in Phi29 single cell amplification products

[0094] Objective: In addition to MALBAC based on multiplex PCR technology, there is also a whole genome isothermal amplification method based on Phi29 enzyme for single-cell whole genome amplification. Isothermal amplification has better fidelity than MALBAC and amplified product length is longer, which is suitable for PKD1 true gene detection using the primer set with longer product length disclosed in the present invention.

[0095] 1. Single-blind verification of blastocyst single-cell amplification products containing PKD1 c.5014_5015del mutation

[0096] Four blastocysts from a family were subjected to PGT-M testing after single-cell whole-genome amplification by Phi29 as in Example 2. The primer sets used were PKD1_Exon15.5_FP:-17:-1, PKD1_Exon15.5_RP, and PKD1_Exon15.5_B:-6:+19. The concentration ratio was 1:1:10. The reaction conditions were the same as in the other examples. The first generation sequencing results are shown in Figure 2. Figure 6 shown.

[0097] The results showed that except for the quality problem of the single-cell whole-gene amplification product of blastocyst No. 2, no c.5014_5015del mutation on the true gene was detected in other blastocysts, indicating that these blastocysts were all good blastocysts. The red boxes in the pseudogene sequence are the characteristic sites of true and pseudogenes. It can be seen that the corresponding positions of blastocysts No. 1 / 3 / 4 are all the base information of the true gene, indicating that the PKD1 true gene sequence we amplified and performed Sanger detection, the entire result shows that no mutation occurred on the PKD1 true gene in blastocysts No. 1 / 3 / 4. The unblinding results showed that the results of this case were consistent with the PGT-M results.

[0098] 2. Single-blind validation of blastocyst single-cell amplification products containing the PKD1 c.2079_2080delinsA mutation

[0099] Four blastocysts from a family were subjected to PGT-M testing after single-cell whole-genome amplification by Phi29. The primer sets used were PKD1_Exon10_FP:-21:-3, PKD1_Exon10_RP, and PKD1_Exon10_B:-9:+10. The concentration ratio was 1:1:10. The reaction conditions were the same as those in other embodiments.

[0100] The results show that Figure 7 ), the c.2079_2080delinsA mutation was detected on the PKD1 true gene in blastocyst No. 2, and the c.2079_2080delinsA mutation was not detected on the true gene in other blastocysts, indicating that these blastocysts are all good blastocysts. The red boxes in the pseudogene sequence are the characteristic sites of true and pseudogenes. It can be seen that the corresponding positions of blastocysts No. 1 / 3 / 4 are all the base information of the true gene, indicating that the true gene sequence of PKD1 that we amplified and performed Sanger detection, the entire result shows that no mutation occurred on the true PKD1 gene in blastocysts No. 1 / 3 / 4. The unblinding results showed that the results of this case were consistent with the PGT-M test results.

[0101] 3. Verification of single-cell amplification products of blastocysts containing the PKD1 c.348_352delTTTAA mutation

[0102] Four blastocysts from a family were subjected to PGT-M testing after single-cell whole-genome amplification by Phi29. The primer sets used were PKD1_Exon2&3_FP:-26:-1, PKD1_Exon2&3_RP, and PKD1_Exon2&3_B:-10:+15. The concentration ratio was 1:15. The reaction conditions were the same as those in other embodiments.

[0103] The results show that Figure 8 ), only blastocyst No. 4 did not have the c.348_352delTTTAA mutation on the PKD1 true gene, and the other blastocysts were detected with the c.348_352delTTTAA mutation on the true gene. The unblinded results showed that the results of this case were consistent with the PGT-M test results.

[0104] Example 4: Detection of 0.001% of PKD1 true gene information

[0105] Purpose: As mentioned above, single-cell whole-genome amplification is prone to the phenomenon of disconnection, that is, if the true PKD1 gene is disconnected, the true PKD1 gene and the information it carries will be less than 14% in the whole-genome amplification product, or even less than 0.1% or 0.01%. In order to cope with this situation, the present invention also discloses a system and implementation method that can detect 0.001% of the true PKD1 gene, which can further reduce false negatives in clinical application scenarios.

[0106] 1. Achieve 0.001% detection of PKD1 Exon5 region

[0107] Preparation method of standard: First, according to the gene sequence of PKD1 exon5 pseudogene, customize the synthesis of plasmid corresponding to the region of primer combination. After the plasmid arrives, prepare 3×10 8 The mother solution was then diluted to 3×10 4 copies / μL, 3×10 5 copies / μL and 3×10 6 The genomic DNA was accurately quantified to 8000 copies / μL using ddPCR. In the range of exon5, there is 1 true gene and 7 highly homologous genes, that is, the true gene accounts for 12.500%. According to this original ratio, the standard is configured according to the table below.

[0108]

[0109]

[0110] Primer combination: PKD1_Exon5_FP:-25:-9, PKD1_Exon5_RP, PKD1_Exon5_B:-13:8 and PKD1_Exon5_MGB (Cy5-CCTCCTTTGCCTGC-MGB), wherein FP:RP:BL=1:1:5.

[0111] Thermal cycle program Fig.24 As shown. :

[0112] qPCR results are shown in Fig. 9 , we can see that the 0.000% sample is a straight line, which means there is no non-specific signal, and the 0.001% has a clear peak, which has good specificity. Similarly, we perform first-generation sequencing on the PCR product, and from the sequencing results we can see the inhibitory effect on 99.999% background.

[0113] From the first generation sequencing results, we can see that Figure 10-11), from left to right, the characteristic recognition sites of true and false genes are A / C, T / C and A / G. In the first-generation sequencing results of 0.000% samples, these three recognition sites are C, C and G, indicating that they are the sequences of false genes, that is, for the test, the detected is a true negative. In the first-generation sequencing results of 0.001% to 0.011% samples, the characteristic recognition sites of true and false genes are the heterozygous peaks of A / C, T / C and A / G, indicating that positive signals are detected. At the same time, the trend can also be seen, that is, as the proportion of PKD1 true genes increases, the signal of the base information on the true gene becomes stronger. All the signals of true genes are seen in samples above 0.11%, which means that most of the false genes are suppressed, showing excellent background signal suppression ability and excellent specificity.

[0114] 2. Achieve 0.001% detection of PKD1 Exon24 region

[0115] Because there are also 7 high-throughput homologous genes in the Exon24 region, the standard preparation process and scheme and qPCR conditions are the same as those in Example 4. PKD1_Exon24_FP:-26:-10, PKD1_Exon24_RP, PKD1_Exon24_B-14:+7 and PKD1_Exon24_MGB (Cy5-CAGAGTCACTCCAGG-MGB), wherein FP:RP:BL=1:1:1.

[0116] qPCR results Fig.12 We can see that the 0.000% sample is a straight line, which means there is no non-specific signal, and the 0.001% has a clear peak, which has good specificity. Similarly, we perform first-generation sequencing on the PCR product, and from the sequencing results we can see the inhibitory effect on 99.89% background.

[0117] The first generation sequencing results are shown in Figure 13-14 . From the first-generation sequencing results, we can see that from left to right, the characteristic recognition sites of true and false genes are T / C, A / G, T / C and T / C. In the PCR products of 0.000% samples, we see the characteristic information of pseudogenes, which is in line with expectations. Starting from 0.001% samples, the characteristic information of true genes gradually increased. In the sequencing results of PCR products of 0.110% samples, we saw that most of the base information of PKD1 true gene was in the true and false gene recognition sites. In samples above 0.532%, all of them were true gene signals, indicating that the primer set and reaction conditions of Exon24 are similar to Exon5 in suppressing pseudogene background, and both have achieved good results, and can obtain good pseudogene suppression and true gene enrichment effects on qPCR and first-generation sequencing platforms.

[0118] Example 5 Detection of PKD1 True Gene Information in Peripheral Blood Free DNA (cfDNA)

[0119] Purpose: cfDNA fragments are about 140+~160+bp. In the application scenario of prenatal diagnosis, it is necessary to detect the true gene information of PKD1 from the fetus. The application scenario of cfDNA requires us to be able to effectively amplify the 140+~160+bp template, and also requires that the amplicon contains more than one true and false gene recognition site to facilitate the identification of the true gene sequence. In this example, we achieved the detection of the true gene information of PKD1 in cfDNA samples.

[0120] The cfDNA samples were from the peripheral blood cfDNA of 4 volunteers. The DNA input for each reaction was 20 ng. The primer combination was: PKD1_Exon15_FP:-27:-10, PKD1_Exon15_RP(2) and PKD1_Exon15_B:-15:+7, among which FP:RP:BL=1:1:10.

[0121] Thermal cycle program Fig.25 shown.

[0122] The PCR product was sent for first generation sequencing, and the sequence comparison results were as follows Fig.15 : In the first-generation sequencing results, we can see the true and false gene recognition sites T / C. If no blocker is added, it is a common PCR, and the first-generation sequencing results of this site are double peaks of T / C, indicating that the product is a mixture of true and false gene sequences. In samples 1 to 4, our disclosed system suppressed the false genes very well, and the recognition site information is the homozygous peak of the true gene T. This example shows that we can suppress the false genes and identify the true PKD1 gene in a short fragment template such as cfDNA.

[0123] Example 6 Detection of exons with high GC content in the PKD1 true gene

[0124] Purpose: The GC content of exon 1 of PKD1 gene is as high as 85%. At present, most detection methods are to obtain the true gene information of exon 1 of PKD1 gene by LongRange PCR combined with NestedPCR. Although this method can design primers without targeting high GC regions, it takes a long time and cannot completely eliminate the interference of pseudogenes of PKD1 gene. This example shows that the system we disclosed can obtain a 1048bp target sequence including PKD1 true gene Exon1 and realize the amplification of short products in high GC regions.

[0125] The samples and reagents that need to be prepared include: peripheral blood genomic DNA samples from three different volunteers, primer combination of PKD1 exon 1, where FP (PKD1_Exon1_FP:-25:-6): RP (PKD1_Exon1_RP): BL (PKD1_Exon1_B:-13:+9) = 1:1:10, and TaKaRa LA with GC Buffer and nuclease free water. The 30μL PCR reaction system is as follows:

[0126] PCR reaction components Addition volume (μL) 2×GC Buffer II 15 TaKaRa LA Taq 0.3 dNTP Mixture 4.8 PKD1_Exon1_FP:-25:-6 2 PKD1_Exon1_RP 2 PKD1_Exon1_B:-13:+9 2 DNA samples 3 nuclease free water 0.9 Total 30

[0127] PCR thermal cycler program as Fig.26 shown.

[0128] The PCR product of more than 1000 bases is sequenced for the first generation, and the result is returned as follows Fig.16 :The results show that when BL is not added to the reaction premix, the expected technical effect is not shown due to the influence of pseudogenes, and the first-generation sequencing signal shows a chaotic peak appearance due to the presence of true and false gene characteristics - / CGCGGGC. In contrast, the reaction product containing BL obtains a clean sequencing result with only true gene exon 1. This example shows that the system disclosed in the present invention can amplify GC-rich fragments while suppressing the interference of PKD1 pseudogenes, and has better convenience and specificity than Long PCR.

[0129] Example 7 Method for obtaining the best technical effect by optimizing the concentration ratio of primers and blockers

[0130] Purpose: This example discloses the optimization strategy and process of primers and blockers, with the purpose of explaining that the optimal detection results cannot be obtained immediately after the primers and blockers are designed. In particular, for the detection purpose of less than 0.1%, the best effect of primers and blockers still needs careful exploration to obtain. Taking Example 4 as an example, the optimization method of the concentration ratio of primers and blockers is demonstrated.

[0131] In order to explore the optimal concentration ratio, the following primer and blocker concentration combinations were prepared: 1:0, 1:1, 1:5, 1:10, 1:25, 1:50 and 1:100. The same qPCR reaction system and thermal cycle program as in Example 4 were used to conduct the experiment.

[0132] First, the first step of screening is performed based on the fluorescence signal results of SYBR.

[0133] In the qPCR results ( Fig.17), we can see that when no blocker is added, the Ct value is 21. As the blocker concentration increases, the Ct value gradually increases. When the concentration ratio of primer to blocker increases to 1:100, no signal is generated. We believe that the blocker has the best effect when the Ct is in the range of 25 to 28. The results show that when the concentration ratio is 1:5 and 1:10, the Ct value is 26. Therefore, these two concentration ratios will be used as alternative concentrations. After that, the second step of screening is carried out according to the signal of the MGB probe.

[0134] like Fig.18 The qPCR results showed that when the concentration ratios were 1:1, 1:5 and 1:10, the Ct values ​​were all 29, but the fluorescence signal at 1:5 was stronger than that at 1:10. Therefore, a concentration ratio of 1:5 was determined to be the optimal solution.

[0135] Example 8 Method for obtaining the best technical effect by optimizing the energy design of primers and blockers

[0136] Purpose: Example 7 demonstrates how to obtain the optimal technical effect by adjusting the relative concentration between primers and blockers. However, sometimes the optimal technical effect cannot be obtained by adjusting the concentration. It is necessary to adjust the size of Gibbs free energy by increasing or decreasing the number of bases of primers and blockers according to the experimental situation to obtain the best technical effect. This example shows the technical effects of several sets of suboptimal primers and blockers to illustrate this method.

[0137] Similar to Example 7, the first step of screening was performed based on the fluorescence signal results of SYBR.

[0138] As shown in the qPCR results ( Fig.19 ), when the concentration ratio was 1:50, the Ct value was 26.7, which was within the qualified concentration ratio range. Therefore, the second step of screening was carried out based on the signal of the MGB probe.

[0139] However, the qPCR results of the MGB probe showed that ( Fig. 20 ), at a concentration ratio of 1:50, a fluorescent signal was generated, but its intensity was too weak. Therefore, it was shown that the original design result was not good, and the Gibbs free energy of the blocker needed to be increased and / or the Gibbs free energy of the primer needed to be reduced, that is, the number of bases at the 3' end of the blocker needed to be increased and / or the number of bases at the 5' end of the primer needed to be reduced.

[0140] According to the above principles, after redesigning the primers and blockers, the same screening steps were performed again.

[0141] After redesigning the primers and blockers ( Fig.21 ), the Ct values ​​of the concentration ratios of 1:1, 1:5, and 1:10 were 25.1, 26.3, and 27.5, respectively. Therefore, further screening was required based on the information results of the MGB probe.

[0142] The results of the MGB probe showed that ( Fig. 22 ), when the concentration ratio is 1:1, the fluorescence signal of the MGB probe is the strongest. Therefore, the newly designed primer and blocker combination is determined to be the optimal combination when the concentration ratio is 1:1.

[0143] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A probe and primer combination for detecting human PKD1 gene variation, characterized in that: The primers are upstream primers and downstream primers for amplifying any one or more exons 1-33 of the human PKD1 gene; The probe covers one or more PKD1 true and false gene base difference sites; The molecular ratio of the upstream primer to the probe is 1:1 to 1:20; The sequence of the probe is as follows: wherein X1 is one of CCC, CCCG, CGGG, CGCG, GCGG, GGCG, GGGG, CCGC, CCCC, GCGG, GGG, CGCC, GGCC, GGTT, GGC, GGT, CCG, CGC, GGGC, CCTT, and GCG, The sequence of the upstream primer is as follows: The sequence of the downstream primer is as follows:

2. The probe and primer combination according to claim 1, characterized in that: The 3′ end of the probe is modified with C3 spacer, C6 spacer, Biotin, phosphate group or amino group.

3. The probe and primer combination according to claim 1, characterized in that: The 3' end of the upstream primer and the 5' end of the probe have 3 to 30 bases in common.

4. The probe and primer combination according to claim 1, characterized in that The PKD1 true and false gene base difference sites are shown in the following table:

5. A kit for detecting human PKD1 gene mutation, characterized in that: The kit comprises the probe and primer combination according to any one of claims 1 to 4.

6. Use of the probe and primer combination according to any one of claims 1 to 4 in the preparation of a reagent for detecting autosomal dominant polycystic kidney disease.

Images