A Yarrowia lipolytica strain for increasing beta-carotene production

Abstract

The invention discloses a Yarrowia lipolytica strain for increasing the yield of beta-carotene. On the basis of introducing a synthetic pathway, the production of beta-carotene is effectively enhanced by increasing the copy number of crtB, crtI, and crtY genes and overexpression of genes GGS1 and HMG related to the mevalonic acid (MVA) pathway, as well as the optimization of the promoter. The Yarrowia lipolytica strain of the invention accumulates about 507.7 mg / L beta-carotene in a shake flask culture, and the yield of beta-carotene obtained in a 5L fermenter reaches 5.5 g / L.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a Yarrowia lipolytica strain capable of increasing beta-carotene production. Background Art

[0002] β-Carotene is a safe natural product. Due to its excellent coloring ability, it is used to color food, beverages and tablet sugar coatings. When added to animal food as a feed additive, it has certain specific functions for animals. For example, laying hens that eat feed rich in β-carotene can increase egg production and reduce symptoms of unprovoked fever. β-Carotene also has the activity of vitamin A and is a precursor of vitamin A synthesis in the body. It plays an important role in human life activities. Therefore, moderate intake can effectively improve vision loss, delay skin aging, enhance the body's immune function, and play an important role in preventing cancer, tumors and cardiovascular diseases. It has been approved for use in more than 50 countries and regions around the world. According to statistics, its annual demand has exceeded 1,500 tons, and the consumption amount is as high as 500 million US dollars, which is still rising every year. In my country, β-carotene is basically obtained by import. Therefore, natural β-carotene has a very broad market prospect.

[0003] At present, the main way to obtain β-carotene is chemical synthesis, which is a method of synthesizing β-carotene through chemical reactions using β-ionone or vitamin A and its derivatives as raw materials. This method is inevitably accompanied by the production of some toxicity, and excessive intake can lead to cancer. With the rapid development of synthetic biology, heterologous expression of genes related to the synthesis of β-carotene in the mother strain of Yarrowia lipolytica that efficiently expresses exogenous proteins has made it possible to synthesize β-carotene by microbial methods.

[0004] Introducing an exogenous β-carotene synthesis module into Yarrowia lipolytica can enable it to heterologously synthesize β-carotene. In the prior art, there is a recombinant Yarrowia lipolytica producing β-carotene by genetically modifying Yarrowia lipolytica. For example, patent CN115029257A discloses a recombinant Yarrowia lipolytica producing β-carotene strain, which is obtained by introducing expression cassettes of geranylgeranyl diphosphate synthase CrtE, phytoene synthase / lycopene cyclase CrtYB, phytoene desaturase CrtI, 3-hydroxy-3-methylglutaryl CoA reductase tHMGR and acetyl-CoA carboxylase ACC into Yarrowia lipolytica. The genetically engineered bacteria in patent CN111321087A are constructed by knocking carRP and carB genes into uracil and leucine auxotrophic Yarrowia lipolytica, then knocking in GGS1 gene, HMG gene, two copies of carRP gene, one copy of carB gene, ERG13 gene, and finally complementing the two uracil and leucine auxotrophic screening markers. However, the strain constructed by the above method still has limited β-carotene production, which limits its application in large-scale industry. Summary of the invention

[0005] To solve the above problems, the present invention starts with wild-type Yarrowia lipolytica, introduces three genes, crtB, crtI, and crtY, through the CRISPR / Cas9 strategy, and the strain successfully produces a detectable amount of β-carotene. Further overexpression of related enzymes in the β-carotene synthesis pathway and increase in the copy number of the crtBIY gene, as well as promoter optimization further increase the yield of β-carotene. Finally, the fed-batch fermentation strategy is used to further increase the yield of β-carotene.

[0006] The first object of the present invention is to provide a Yarrowia lipolytica strain with improved β-carotene production, wherein the Yarrowia lipolytica strain is obtained by introducing and overexpressing a phytoene synthase encoding gene crtB, a phytoene dehydrogenase encoding gene crtI and a lycopene cyclase encoding gene crtY into a starting strain, and simultaneously overexpressing a GGPP synthase encoding gene GGS1 and an HMG-CoA reductase encoding gene HMG;

[0007] Among them, the phytoene synthase encoding gene crtB, the phytoene dehydrogenase encoding gene crtI and the lycopene cyclase encoding gene crtY are expressed by the gap promoter, the GGPP synthase encoding gene GGS1 is expressed by the PGK1 promoter, and the HMG-CoA reductase encoding gene HMG is expressed by the TEF1 promoter.

[0008] Furthermore, the NCBI number of the phytoene synthase encoding gene crtB is WP_033773805.1, the NCBI number of the phytoene dehydrogenase encoding gene crtI is WP_010670728.1, and the NCBI number of the lycopene cyclase encoding gene crtY is WP_062759152.1.

[0009] Furthermore, the NCBI number of the GGPP synthase encoding gene GGS1 is XP_045941587.1.

[0010] Furthermore, the NCBI number of the HMG-CoA reductase encoding gene HMG is NP_732900.1.

[0011] Furthermore, the nucleotide sequence of the gap promoter is.

[0012] Furthermore, the nucleotide sequence of the PGK1 promoter is gggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcctcgcacacattccacatccaccggtaggcgccaaccggctccgttctttggtggccccttcgcgccaccttctactcctcccctagtcaggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaagtagcatgtctcactaggctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcg。

[0013] Furthermore, the nucleotide sequence of the TEF1 promoter is atagcttcaaaatgtttctactccttttttactcttccagattttctcggactccgcgcatcgccgtaccacttcaaaacacccaagcacagcatactaaatttcccctctttcttcctctagggtgtcgttaattacccgtactaaaggtttggaaaagaaaaaagagaccgcctcgtttctttttcttcgtcgaaaaaggcaataaaaatttttatcacgtttctttttcttgaaaattttttttttgatttttttctctttcgatgacctcccattgatatttaagttaataaacggtcttcaatttctcaagtttcagtttcatttttcttgttctattacaactttttttacttcttgctcattagaaagaaagcatagcaatctaatctaagttt。

[0014] Furthermore, overexpression of the phytoene synthase encoding gene crtB, the phytoene dehydrogenase encoding gene crtI and the lycopene cyclase encoding gene crtY refers to increasing one copy number, respectively.

[0015] The second object of the present invention is to provide a method for producing β-carotene, which uses the above-mentioned Yarrowia lipolytica strain for fermentation production.

[0016] Furthermore, after culturing in the fermentation medium for 5-7 hours, glucose was added in a batch feed manner to maintain its concentration at 0.05-0.2%.

[0017] Furthermore, the fermentation medium comprises: 2-10% peptone, 1-5% yeast extract and 20-40% glucose.

[0018] Furthermore, the fermentation temperature is 28-33°C.

[0019] Beneficial effects of the present invention:

[0020] In order to attempt to produce beta-carotene in a Yarrowia lipolytica strain, the present invention carries out a series of different engineering strategies to enhance the biosynthesis of beta-carotene. After introducing a synthesis module, the production of beta-carotene is effectively enhanced by increasing the copy number of crtB, crtI, and crtY genes and overexpressing genes GGS1 and HMG related to the mevalonic acid (MVA) pathway, as well as optimizing the promoter. The highest known beta-carotene yield (507.7±6.6 mg / L) is achieved in a shake flask, and the maximum beta-carotene yield obtained in a 5L fermenter is 5.5 g / L, which is 11 times higher than that of shake flask culture and can meet the needs of industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is the nucleic acid gel image of genes crtI, crtY and crtB;

[0022] Figure 2 This is the situation of producing β-carotene by fermentation in a fermenter. DETAILED DESCRIPTION

[0023] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0024] Example 1 Construction of strains

[0025] To construct a starting platform for β-carotene production in Yarrowia lipolytica, the CRISPR / Cas9 strategy was used to clone crtB (WP_033773805.1), crtI (WP_010670728.1), and crtY (WP_062759152.1) encoding phytoene synthase, lycopene cyclase, and phytoene dehydrogenase ( Figure 1 ) genes were integrated into the genome of Yarrowia lipolytica. Specifically, the expression of these heterologous genes was controlled by the gap promoter () and the CYC1 terminator. The engineered strain YL2 co-expressing crtB, crtI and crtY successfully produced detectable amounts of β-carotene (125.1 ± 0.5 mg / L) and was therefore used as a starting strain for further optimization to increase β-carotene production in Yarrowia lipolytica.

[0026] Example 2 Overexpression of GGS1 and HMG leads to increased β-carotene production

[0027] Geranylgeranyl pyrophosphate (GGPP) is a basic building block of carotenoids and is derived from pyrophosphate (FPP) catalyzed by GGPP synthase. Since FPP accelerates the conversion to GGPP, GGS1 (XP_045941587.1) encoding GGPP synthase was overexpressed in Yarrowia lipolytica under the control of the PGK1 promoter (gggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcctcgcacacattccacatccaccggtaggcgccaaccggctccgttctttggtggccccttcgcgccaccttctactcctcccctagtcaggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaa The expression of the gene tggaagtagcatgtctcactaggctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggcgggctcaggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcg) may increase the production of β-carotene. The colony color produced on the YPD agar plate showed significant differences, and the β-carotene concentration was also 256.1±0.2mg / L. Other carotenoid building blocks IPP and DMAPP are synthesized in Yarrowia lipolytica through the endogenous MVA pathway.Therefore, we further overexpressed TEF1 (atagcttcaaaatgtttctactccttttttactcttccagattttctcggactccgcgcatcgccgtaccacttcaaaacacccaagcacagcatactaaatttcccctctttcttcctctagggtgtcgttaattacccgtactaaaggtttggaaaagaaaaaagagaccgcctcgtttctttttcttcgtcgaaaaaggcaataaaaatt The gene HMG (NP_732900.1) under the control of the promoter of the YL3 strain was overexpressed to test its effect on β-carotene production. Overexpression of the HMG gene in the YL3 strain further increased the production of β-carotene in YPD medium in shake flask culture (279.3±0.9 mg / L).

[0028] Example 3 Increasing the number of crtI, crtY and crtB copies to further increase the yield of β-carotene

[0029] In order to further enhance the flux of the downstream pathway of β-carotene biosynthesis, improving the catalytic activity of CrtI, CrtY and CrtB by increasing the copy number is a possible solution. First, we added a copy of crtB to strain YL3, and the β-carotene production in the resulting strain YL4 was 303±2.3mg / L. In addition, the integration of a crtI led to an increase in β-carotene production to 425±5.5mg / L. On this basis, the integration of a crtY resulted in the YL6 strain, which had a production of 507.7±6.6mg / L. Therefore, optimizing the levels of crtY, crtI and crtB is an effective way to increase β-carotene production.

[0030] Example 4 Fed-batch fermentation to increase the yield of β-carotene

[0031] The engineered bacteria (YL6 strain) with strong β-carotene biosynthesis ability were cultured in a 5L fermentor and glucose was continuously supplemented. The initial culture was carried out in a batch feeding mode with a total volume of 2L. The culture medium contained 4% peptone, 2% yeast extract and 30% glucose at a temperature of 30°C. After 6 hours of culture, the glucose concentration in the fermentor can be maintained at or slightly above 0.1% at a glucose (500g / L) feed rate of 12mL / h. 2×YPD medium was used and 50% glucose solution was added to maintain the glucose concentration at 0.1%. The culture results showed that after 6.5 days of fermentation, the final β-carotene concentration was 5.5g / L ( Figure 2 ).

[0032] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A Yarrowia lipolytica for increasing β-carotene production ( Yarrowia lipolytica ) strain, characterized in that: The Yarrowia lipolytica strain is prepared by introducing and over-expressing the phytoene synthase encoding gene into the starting strain. B , phytoene dehydrogenase encoding gene ikB and lycopene cyclase encoding gene ikB , while overexpressing the GGPP synthase encoding gene GGS1 , HMG-CoA reductase encoding gene HMG get; among them, The phytoene synthase encoding gene B , phytoene dehydrogenase encoding gene ikB and lycopene cyclase encoding gene ikB Expression is regulated by the gap promoter, encoding the gene for GGPP synthase GGS1 Expression is regulated by the PGK1 promoter, encoding the gene for HMG-CoA reductase HMG Expression is regulated by the TEF1 promoter; The phytoene synthase encoding gene B The NCBI number is WP_033773805.1, and the phytoene dehydrogenase encoding gene ikB The NCBI number is WP_010670728.1, and the lycopene cyclase encoding gene ikB The NCBI accession number is WP_062759152.1, and the GGPP synthase encoding gene GGS1 The NCBI number is XP_045941587.1, and the HMG-CoA reductase encoding gene HMG The NCBI accession number is NP_732900.

1.

2. The Yarrowia lipolytica according to claim 1 ( Yarrowia lipolytica ) strain, characterized in that: Overexpression of phytoene synthase encoding gene B , phytoene dehydrogenase encoding gene ikB and lycopene cyclase encoding gene ikB Increase the number of copies by one respectively.

3. A method for producing beta-carotene, characterized in that: The Yarrowia lipolytica strain according to claim 1 or 2 is used for fermentation production.

4. The method according to claim 3, characterized in that: The Yarrowia lipolytica strain was cultured in a fed-batch manner.

5. The method according to claim 4, characterized in that: After 5-7 h of cultivation in the fermentation medium, glucose was added in a fed-batch manner.

6. The method according to claim 5, characterized in that: The glucose concentration was maintained at 0.05~0.2%.

7. The method according to claim 5, characterized in that The fermentation medium comprises 2-10% peptone, 1-5% yeast extract and 20-40% glucose.

8. The method according to claim 3, characterized in that: The fermentation temperature is 28~33ºC.

Images