Exosome Test Strip Based on DNA Tetrahedron Sensing Interface and Aptamer Logic Operation
Exosome test strips through DNA tetrahedral sensing interface and aptamer logic operation solve the complex problem of antibody preparation in the prior art, and realize simple and fast exosome detection, which is suitable for biosensing platforms for untrained personnel.
Patent Information
- Application Number
- CN202310072394.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-07
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2043-02-07
AI Technical Summary
Existing lateral flow chromatography test strips detect exosomes in complex antibody preparation, high cost and cumbersome process, making it difficult to achieve simple and fast exosome detection.
The DNA tetrahedral sensing interface and aptamer logic operation are used to construct tetrahedral nanostructure probes using DNA self-assembly technology, and logical operations are performed by combining aptamer probes and reporting probes to achieve efficient capture and detection of exosomes.
It provides a reliable, simple and instant exosome detection method, suitable for biosensing platform for untrained personnel, and realizes high specificity of exosome recognition and detection.
Smart Images

Figure CN116203230B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of test strip detection, and specifically to an exosome test strip based on a DNA tetrahedron sensing interface and aptamer logic operation. Background Art
[0002] Exosomes are a type of microvesicle secreted by all living cells, with a diameter of approximately 30 - 150 nm. The exosome cell membrane contains abundant antigen expression and is a new medium for intercellular signal transmission. Its cytoplasm is rich in DNA, RNA, proteins, and other bioactive substances. These inclusion components are related to their cell sources and are products produced by parental cells. Different cells have different rates of generating and releasing exosomes, and there is also a high degree of heterogeneity in the size and components of exosomes. However, their components are closely related to the source cells and reflect the physiological or pathological state of the parental cells. Exosomes obtained from body fluids (including blood, urine, saliva, and milk, etc.) can be used as biomarkers for disease and health diagnosis. Exosome-based diagnosis provides a way for early diagnosis of diseases such as cancer and provides a method for timely and accurate monitoring of changes in the molecular biomarker profile during disease development. This liquid biopsy based on body fluid samples is easier to collect than tissue biopsy and is easier to achieve real-time monitoring of disease development and prognosis. It is an important part of liquid biopsy. Exosomes have good stability, can protect their contents from being degraded by enzymes in body fluids, and when they fuse with cell membranes, they can transfer the carried substances and signals to recipient cells and change their biological functions. They are potential carriers for nano-drug delivery or gene therapy. Therefore, there is an urgent need for new, simple, and rapid detection technologies for exosomes in both disease diagnosis and treatment.
[0003] Lateral flow test strips (LFTS) are an important point-of-care sensing and detection platform. Due to their advantages such as portability, simple operation, rapid detection, and the absence of the need for special instruments, strip-based sensors show great potential in self-service rapid detection such as early cancer diagnosis, infection detection, and environmental monitoring. Among these sensing and detection methods, the LFTS assay format is usually based on antibody-antigen reactions for determination, known as lateral flow immunoassay. However, the antibody-antigen reaction mechanism is usually limited by antibody preparation, and the antibody has high production costs, a long production cycle, and high requirements for storage conditions. However, aptamers screened by systematic evolution of ligands by exponential enrichment (SELEX), although essentially a nucleic acid fragment, can replace antibodies to specifically recognize and bind to antigens, thus providing a nucleic acid strategy for exosome detection. The capture probe based on the nucleic acid strategy for LFTS detection needs to be connected to a protein molecule to form a protein-nucleic acid probe complex to prevent the capture probe from moving self with the chromatography of the sample. Usually, biotin molecules are modified on the nucleic acid and then the biotin-avidin reaction is used to form a biotin-nucleic acid probe complex. However, the preparation process of this nucleic acid capture probe is complex, requires special modification of the nucleic acid probe, and is still limited by the need for protein molecules, which is not conducive to the extended application of strip-based sensors based on the nucleic acid strategy. Summary of the Invention
[0004] The object of the present invention is to overcome the above difficulties in the background art and provide a reliable, simple, and point-of-care exosome detection lateral flow test strip based on a DNA tetrahedron sensing interface and aptamer logic operation.
[0005] To achieve the above object, the technical solution adopted is: an exosome test strip based on a DNA tetrahedron sensing interface and aptamer logic operation, comprising:
[0006] The preparation principle of the test strip is based on DNA self-assembly technology. Four DNA single strands are assembled into a tetrahedral nanostructure. A complementary sequence or a biotin molecule is encoded and designed at the 5'-end or 3'-end of each single strand as a capture probe. After being assembled into a tetrahedron, the capture probe is located at the four vertices of the tetrahedron. The test strip constructs a lateral flow test strip biosensing interface for the DNA tetrahedron capture probe.
[0007] The test strip includes a detection layer and a back layer. The back layer is provided with a back pad. The detection layer is sequentially provided with a gold conjugate pad, a test line, and a control line from left to right. A sample pad is provided on the gold conjugate pad away from the test line. An absorbent pad is provided on the side of the control line away from the test line. The surface of the detection layer of the test strip is provided with a nitrocellulose membrane.
[0008] The detection line includes four single-stranded probe strands, namely Strand A-T, Strand B-T, Strand C-T, and Strand D-T. The tetrahedron assembles the complementary sequences encoded at the 3'-ends of the four single-stranded probe strands to form a tetrahedron capture probe at the detection line position. The solution of the tetrahedron capture probe is scribed on the nitrocellulose membrane of the test strip to form the detection line;
[0009] The quality control line includes four single-stranded probe strands, namely Strand A-5B, Strand B-5B, Strand C-5B, and Strand D-5B. The tetrahedron assembles biotin molecules modified at the 5'-ends of the four single-stranded probe strands to form a biotinylated tetrahedron capture probe at the quality control line position. The solution of the biotinylated tetrahedron capture probe is scribed on the nitrocellulose membrane to form the quality control line;
[0010] The test strip also includes a reporter probe and an aptamer probe. The tetrahedron capture probe of the detection line captures the aptamer probe. The biotinylated tetrahedron probe of the quality control line directly captures the functionalized colloidal gold for color development of the quality control line. The reporter probe performs an "AND" logic operation with the aptamer probe and then captures the functionalized colloidal gold at the tetrahedron capture probe of the detection line for color development of the detection line;
[0011] The synthetic nucleic acid sequence information used for the test strip is as follows:
[0012] Name Sequences Chol-A (Reporting Probe) 5'cholesteryl-AAAAAAAAAGACTCTAGACATACATGCTCACTGACGCTAGGATAA- 3'Biotin -TEG CD63-B (Aptamer Probe) <![CDATA[ATATACACCCCACCTCGCTCCCGTGACACTAATGCTAAAAAAAAAAAAAA CCAGTCTGCCGGCACCGCCGC > Strand A-5B 5'Biotin -TEG –TTCCCTAGTCATTGGAGGTGACAAAAAAAACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTA Strand B-5B 5'Biotin -TEG –TTCCCTAGTCATTGGAGGTGACAAAAAAAACGAGCGAGTTGATGTGATGCAAGCTGAATGCGAGGGTCCT Strand C-5B 5'Biotin -TEG –TTCCCTAGTCATTGGAGGTGACAAAAAAATCAACTCGCTCGTAACTACACTGTGCAATACTCTGGTGACC Strand D-5B 5'Biotin -TEG –TTCCCTAGTCATTGGAGGTGACAAAAAAATCTGACGTAGTGTATGCACAGTGTAGTAAGGACCCTCGCAT Strand A-T <![CDATA[ACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTAAAAAAAAAAA GCGGCGGTGCCGGCAGACTGG > Strand B-T <![CDATA[ACGAGCGAGTTGATGTGATGCAAGCTGAATGCGAGGGTCCTAAAAAAAAAA GCGGCGGTGCCGGCAGACTGG > Strand C-T <![CDATA[TCAACTCGCTCGTAACTACACTGTGCAATACTCTGGTGACCAAAAAAAAAA GCGGCGGTGCCGGCAGACTGG > Strand D-T <![CDATA[TCTGACGTAGTGTATGCACAGTGTAGTAAGGACCCTCGCATAAAAAAAAAA GCGGCGGTGCCGGCAGACTGG >
[0013] Furthermore, the preparation method of the exosome test strip based on the DNA tetrahedron sensing interface and aptamer logic operation includes the following steps:
[0014] (1) Construct a lateral flow chromatography test strip biosensing interface using the DNA tetrahedron capture probe;
[0015] (2) Modify colloidal gold with streptavidin to prepare streptavidin-colloidal gold particles for preparing the gold conjugate pad;
[0016] (3) Use aptamer probe B to specifically recognize and bind to exosomes. A sequence complementary to the tetrahedron capture probe is encoded at the 3'-end of this aptamer probe, so as to promote the exosomes in the sample flow to be captured at the detection line position;
[0017] (4) Insert the cholesterol molecule modified at the 5'-end of reporter probe A into and anchor it to the lipid bilayer cell membrane of exosomes, and capture the streptavidin-modified colloidal gold nanoparticles with the biotin modified at the 3'-end of the reporter probe;
[0018] (5) Modify biotin molecules at the 5'-ends of single strands assembled by the tetrahedron to form a biotinylated tetrahedron capture probe at the quality control line position;
[0019] Among them, the position of the detection line in step (2) is obtained from an agarose gel electrophoresis experiment. The loading solution used in the agarose gel electrophoresis experiment includes four single-stranded probe strands of the detection line: Strand A-T, Strand B-T, Strand C-T, and Strand D-T. Among them, during electrophoresis, the loading solutions in lanes 1, 2, 3, and 4 are single-stranded probe strand A (Strand A-T), strand B (Strand B-T), strand C (Strand C-T), and strand D (Strand D-T) respectively. The loading solution in lane 5 is the reaction solution of strand B and strand C, and its band is behind that in lanes 2 and 3. The loading solution in lane 6 is the reaction solution of strands B, C, and D, and the band is further behind compared to lane 5. The loading solution in lane 7 is the hybridization reaction solution of strands A, B, C, and D, and the obtained band in lane 7 is further behind and migrates the slowest. Therefore, the tetrahedral nanostructure probe constructed in lane 7 can be used to prepare the sensing detection interface of the detection line;
[0020] Among them, the position of the quality control line in step (5) is obtained from an agarose gel electrophoresis experiment; the biotinylated capture probe of the quality control line includes four single-stranded probe strands of the quality control line: Strand A-5B, Strand B-5B, Strand C-5B, and Strand D-5B. Lanes 1-7 are obtained according to the same operation as the agarose gel electrophoresis experiment for the detection line position, and the result is that the band in lane 7 is further behind and migrates the slowest. Therefore, the tetrahedral nanostructure probe constructed in lane 7 can be used to prepare the sensing detection interface of the quality control line.
[0021] Furthermore, the gold conjugate pad includes a colloidal gold solution, and the preparation steps of the colloidal gold solution are as follows:
[0022] (1) Reducing the boiling HAuCl4 solution with a citrate solution to obtain a solution for synthesizing spherical colloidal gold nanoparticles;
[0023] (2) Mixing the solution obtained in step (1) with streptavidin to obtain a colloidal gold solution of streptavidin-functionalized modified colloidal gold nanoparticles for preparing the gold conjugate pad.
[0024] The beneficial effects of adopting the above - mentioned scheme are as follows: The present invention discloses an exosome test strip based on a DNA tetrahedron sensing interface and aptamer logic operation, belonging to the technical field of test strip detection. This exosome test strip based on a DNA tetrahedron sensing interface and aptamer logic operation can efficiently capture the biocoding sequence (barcode) at the tail of the aptamer probe on the surface of exosomes by using the strategy of a DNA tetrahedron nanostructure probe sensing interface, and then capture the exosomes at the test line position in the sample flow. Further, through the introduction of an "AND" - gate logic operation between the reporting probe A and the aptamer probe B triggered by the presence of exosomes, the exosomes can be specifically recognized and detected. The lateral flow chromatography test strip is one of the most convenient biosensing platforms for untrained personnel. Therefore, the test strip based on DNA tetrahedron capture probes and nucleic acid aptamers is expected to provide a reliable, simple, and rapid detection new method for the rapid and accurate diagnosis of non - nucleic acid biomarkers such as exosomes. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 It is a schematic diagram of the detection principle of the test strip based on the DNA tetrahedron sensing interface and aptamer logic operation.
[0026] Figure 2 It is a feasibility analysis diagram of the construction of DNA tetrahedron nanostructure probes.
[0027] Figure 3 It is a characterization schematic diagram of the preparation of colloidal gold.
[0028] Figure 4 It is a feasibility analysis diagram of the exosome detection of the lateral flow test strip based on the tetrahedron sensing interface and aptamer logic operation probe by changing different experimental conditions. EMBODIMENTS
[0029] Next, in combination with the specific embodiments of the present invention, the technical solutions of the present invention will be clearly and completely described. The described embodiments are only a part of the embodiments of the present invention, rather than all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative efforts belong to the scope of protection of the present invention. EXAMPLE
[0030] In the experiments of the present invention, the reagents used were trisodium citrate (C6H5Na3O7) and HAuCl4•3H2O, which were purchased from Sangon Biotech (Shanghai) Co., Ltd. Streptavidin was ordered from Solarbio Science & Technology Co., Ltd. in Beijing. The sample pad, gold conjugate pad, absorbent pad, and backing layer were all purchased from Shanghai Jieyi Co., Ltd., and the nitrocellulose membrane was purchased from Millipore Corporation. The oligonucleotides were all synthesized, modified, and purified by Beijing Tsingke Biotechnology Co., Ltd.
[0031] Exosome test strip based on DNA tetrahedron sensing interface and aptamer logic operation, including: (The preparation principle of the test strip is based on DNA self-assembly technology. Four DNA single strands are assembled into a tetrahedral nanostructure. A complementary sequence or a biotin molecule is encoded and designed at the 5' end or 3' end of each single strand as a capture probe. After being assembled into a tetrahedron, the capture probe is located at the four vertices of the tetrahedron. The test strip constructs a lateral flow chromatography test strip biosensing interface with the DNA tetrahedron capture probe;
[0032] The test strip includes a detection layer and a back layer. The back layer is provided with a backing pad. The detection layer is sequentially provided with a gold label pad, a detection line, and a quality control line from left to right. A sample pad is provided on the gold label pad away from the detection line. An absorbent pad is provided on the side of the quality control line away from the detection line. The surface of the detection layer of the test strip is provided with a nitrocellulose membrane;
[0033] The detection line includes four single-stranded probe strands Strand A-T, Strand B-T, Strand C-T, and Strand D-T. The tetrahedron is assembled with complementary sequences encoded at the 3' ends of the four single-stranded probe strands to form a tetrahedron capture probe at the detection line position. The tetrahedron capture probe solution is scribed on the nitrocellulose membrane of the test strip to form a detection line;
[0034] The quality control line includes four single-stranded probe strands Strand A-5B, Strand B-5B, Strand C-5B, and Strand D-5B. The tetrahedron is assembled with biotin molecules modified at the 5' ends of the four single-stranded probe strands to form a biotinylated tetrahedron capture probe at the quality control line position. The biotinylated tetrahedron capture probe solution is scribed on the nitrocellulose membrane to form a quality control line;
[0035] The test strip also includes a reporter probe and an aptamer probe. The tetrahedron capture probe of the detection line captures the aptamer probe. The biotinylated tetrahedron probe of the quality control line directly captures functionalized colloidal gold for color development of the quality control line. The reporter probe performs an "AND" gate logic operation with the aptamer probe and then captures functionalized colloidal gold at the tetrahedron capture probe of the detection line for color development of the detection line;
[0036] The synthetic nucleic acid sequence information used for the test strip is: (In the table, "___" is the complementary sequence of the aptamer probe and the tetrahedron capture probe of the detection line)
[0037] Name Sequences Chol-A (Reporting Probe) 5'cholesteryl-AAAAAAAAAGACTCTAGACATACATGCTCACTGACGCTAGGATAA- 3'Biotin -TEG CD63-B (Aptamer Probe) <![CDATA[ATATACACCCCACCTCGCTCCCGTGACACTAATGCTAAAAAAAAAAAAAA CCAGTCTGCCGGCACCGCCGC > Strand A-5B 5'Biotin -TEG –TTCCCTAGTCATTGGAGGTGACAAAAAAAACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTA Strand B-5B 5'Biotin -TEG –TTCCCTAGTCATTGGAGGTGACAAAAAAAACGAGCGAGTTGATGTGATGCAAGCTGAATGCGAGGGTCCT Strand C-5B 5'Biotin -TEG –TTCCCTAGTCATTGGAGGTGACAAAAAAATCAACTCGCTCGTAACTACACTGTGCAATACTCTGGTGACC Strand D-5B 5'Biotin -TEG –TTCCCTAGTCATTGGAGGTGACAAAAAAATCTGACGTAGTGTATGCACAGTGTAGTAAGGACCCTCGCAT Strand A-T <![CDATA[ACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTAAAAAAAAAAA GCGGCGGTGCCGGCAGACTGG > Strand B-T <![CDATA[ACGAGCGAGTTGATGTGATGCAAGCTGAATGCGAGGGTCCTAAAAAAAAAA GCGGCGGTGCCGGCAGACTGG > Strand C-T <![CDATA[TCAACTCGCTCGTAACTACACTGTGCAATACTCTGGTGACCAAAAAAAAAA GCGGCGGTGCCGGCAGACTGG > Strand D-T <![CDATA[TCTGACGTAGTGTATGCACAGTGTAGTAAGGACCCTCGCATAAAAAAAAAA GCGGCGGTGCCGGCAGACTGG >
[0038] As Figure 1, The present invention is based on DNA self-assembly technology and uses four DNA single strands to assemble into a tetrahedral nanostructure. A complementary sequence is encoded or a biotin molecule is modified at the 5' end or 3' end of each single strand as a capture probe. After assembling into a tetrahedron, the capture probe is located at the four vertices of the tetrahedron. The capture probe sequence anchored at the vertices of the tetrahedron can efficiently capture nucleic acid molecules in the sample flow, and then capture functionalized colloidal gold, so as to display a red detection band at the test line position. The biotin molecule anchored at the vertices of the tetrahedron can directly and efficiently capture streptavidin-functionalized colloidal gold in the sample flow, so as to display a quality control band at the quality control line position. The detection design principle is as shown in the schematic Figure 1 as follows. (1) The present invention uses a DNA tetrahedron capture probe to construct a lateral flow strip biosensing interface. (2) The present invention uses streptavidin to modify colloidal gold to prepare streptavidin-colloidal gold particles for preparing a gold conjugate pad. (3) The present invention uses aptamer probe B to specifically recognize and bind to exosomes. A sequence complementary to the tetrahedron capture probe is encoded at the 3' end of the aptamer probe, so as to promote the exosomes in the sample flow to be captured at the test line position. (4) The present invention uses the cholesterol molecule (cholesteryl) modified at the 5' end of the reporter probe A to insert into the lipid bilayer cell membrane anchored to the exosomes, and the biotin (biotin) modified at the 3' end of the reporter probe captures streptavidin-modified colloidal gold nanoparticles. Only when exosomes are present, aptamer probe B and reporter probe A are simultaneously connected to the membrane of the exosomes to form an aptamer probe-exosome-reporter probe nanostructure. This nanostructure is similar to a "bridge" structure, with one end connected to the capture probe on the test line and the other end connected to the functionalized colloidal gold, so as to capture the colloidal gold at the test line position and present a red test line. When no exosomes are present, aptamer probe B and reporter probe A exist freely, and at this time, no red band appears at the test line position. The presence of exosomes is equivalent to performing an "AND" gate logic operation on aptamer probe B and reporter probe A, thus forming an aptamer probe-exosome-reporter probe nanostructure, resulting in a red test band appearing at the test line position. (5) The present invention uses the biotin molecule modified at the 5' end of the tetrahedron assembly single strand to form a biotinylated tetrahedron capture probe at the quality control line position. Whether exosomes are present or not, when the streptavidin-colloidal gold particles flow through the quality control area with the sample solution, the biotinylated tetrahedron capture probe captures the colloidal gold at the quality control line position through reaction with streptavidin, thus forming a red quality control line.
[0039] The present invention designs and constructs a DNA tetrahedron nanostructure probe sensing interface on a lateral flow strip, and explores a new method for rapid and point-of-care detection of exosomes with a fully nucleic acid strategy through the "AND" gate logic operation of aptamer probe B and reporter probe A on the exosome membrane. Examples
[0040] The preparation method of the exosome test strip based on the DNA tetrahedron sensing interface and aptamer logic operation includes the following steps:
[0041] (1) Construct a lateral flow chromatography test strip biosensing interface using DNA tetrahedron capture probes;
[0042] (2) Modify colloidal gold with streptavidin to prepare streptavidin-colloidal gold particles for preparing the gold conjugate pad;
[0043] (3) Use aptamer probe B to specifically recognize and bind to exosomes. The 3'-end of this aptamer probe is encoded with a sequence complementary to the tetrahedron capture probe, so as to promote the exosomes in the sample flow to be captured at the test line position;
[0044] (4) Use the cholesterol molecule modified at the 5'-end of the reporter probe A to insert and anchor into the lipid bilayer cell membrane of exosomes, and the biotin modified at the 3'-end of the reporter probe captures streptavidin-modified colloidal gold nanoparticles;
[0045] (5) Use the biotin molecule modified at the 5'-end of the single strand for tetrahedron assembly to form a biotinylated tetrahedron capture probe at the control line position;
[0046] To evaluate the feasibility of constructing a lateral flow chromatography test strip based on the DNA tetrahedron sensing interface, agarose gel electrophoresis analysis was performed on the tetrahedron capture probe at the test line position and the biotinylated tetrahedron capture probe at the control line position respectively in the experiment. Agarose gel electrophoresis was carried out on an electrophoresis analyzer of China Liuyi Instrument Company, and then imaging was carried out on a Bio-rad ChemDoc XRS (Bio-Rad, USA).
[0047] As Figure 2 , Figure 2 shown in 2A: Electrophoresis verification of the assembly of the DNA tetrahedron capture probe at the test line position; 2B: Electrophoresis verification of the assembly of the biotinylated DNA tetrahedron capture probe at the control line position.
[0048] Among them, the position of the test line in step (2) is obtained from an agarose gel electrophoresis experiment. The loading solution for the agarose gel electrophoresis experiment includes four single-stranded probe chains of the test line: Strand A-T, Strand B-T, Strand C-T, and Strand D-T. During electrophoresis, the loading solutions in lanes 1, 2, 3, and 4 are single-stranded probe chain A (Strand A-T), chain B (Strand B-T), chain C (Strand C-T), and chain D (Strand D-T) respectively. The loading solution in lane 5 is the reaction solution of chain B and chain C, and its band is behind those in lanes 2 and 3. The loading solution in lane 6 is the reaction solution of chains B, C, and D, and its band is further behind compared to lane 5. The loading solution in lane 7 is the hybridization reaction solution of chains A, B, C, and D, and the band obtained in lane 7 is further behind and migrates the slowest. Therefore, the tetrahedral nanostructure probe constructed in lane 7 can be used to prepare the sensing detection interface of the test line.
[0049] Among them, the position of the quality control line in step (5) is obtained from an agarose gel electrophoresis experiment. The biotinylated capture probe for the quality control line includes four single-stranded probe chains of the quality control line: Strand A-5B, Strand B-5B, Strand C-5B, and Strand D-5B. Lanes 1-7 are obtained according to the same operation as the agarose gel electrophoresis experiment for the test line position. The same result is that the band in lane 7 is further behind and migrates the slowest. Therefore, the tetrahedral nanostructure probe constructed in lane 7 can be used to prepare the sensing detection interface of the quality control line.
[0050] The continuous backward placement of the electrophoresis bands indicates that a larger DNA nanostructure is formed by the hybridization reaction. Therefore, the four single strands in lane 7 successfully assemble into a DNA tetrahedral nanostructure capture probe. Similar to the tetrahedral capture probe of the test line, gel electrophoresis verification is performed on the biotinylated tetrahedral capture probe of the quality control line, and the results are as Figure 2 shown in B. The nanocapture probe assembled from the four single strands (Strand A-5B, Strand B-5B, Strand C-5B, and Strand D-5B) of the tetrahedron of the quality control line shows a consistent phenomenon of backward placement of the electrophoresis bands, revealing that the assembly of the biotinylated tetrahedral capture probe at the quality control line position is as expected.
[0051] Therefore, the constructed DNA tetrahedral nanostructure probe can be scribed on different regions of the cellulose membrane of the lateral flow chromatographic test strip to prepare the sensing detection interfaces of the test line and quality control line regions. Example
[0052] Colloidal gold is the key to the preparation of the gold conjugate pad of the lateral flow chromatographic test strip, and exosomes are the actual samples for the rapid detection of the test strip. The experiment analyzed and verified the preparation of colloidal gold and the ultracentrifugation extraction of exosomes.
[0053] As Figure 3 , wherein, Figure 3 3A: Colloidal gold (AuNPs) solution prepared by sodium citrate reduction method; 3B: TEM characterization of colloidal gold; 3C: Exosome precipitate after the first ultracentrifugation (the position at the bottom of the tube indicated by the arrow). 3D; TEM characterization of exosomes.
[0054] The gold conjugate pad comprises a colloidal gold solution, and the preparation steps of the colloidal gold solution are as follows:
[0055] (1) Reducing the boiling HAuCl4 solution with a citrate solution to obtain a solution for synthesizing spherical colloidal gold nanoparticles;
[0056] (2) Mixing the solution obtained in step (1) with streptavidin to obtain a colloidal gold solution of streptavidin-functionalized modified colloidal gold nanoparticles for preparing the gold conjugate pad.
[0057] The ultracentrifugation extraction of exosomes was analyzed and verified, and the exosome extraction verification steps are as follows:
[0058] (1) Collect exosomes in the cell supernatant according to the differential ultracentrifugation method. First, centrifuge at 800 g for 5 min, then centrifuge at 2000 g for 10 min to remove cell debris, and then centrifuge at 174,900 rpm for 90 min twice to obtain exosome precipitate;
[0059] (2) Resuspend the exosome precipitate with phosphate buffered saline for standby;
[0060] (3) Adsorb the diluted exosome sample on a carbon-coated copper grid, perform negative staining with 2% phosphotungstic acid solution, and then perform transmission electron microscopy characterization;
[0061] (4) Exosomes are disc-shaped, with a lipid bilayer membrane structure, and the size is about 50 - 150 nm, indicating the successful ultracentrifugation extraction and purification of exosomes in the cell supernatant. Example
[0062] As Figure 4 , whether a test strip based on a tetrahedral sensing interface and aptamer probe logical operation works as shown in the detection principle schematic Figure 1 shown. The HM3035 XYZ platform purchased from Shanghai Gold Label Company was used to draw two kinds of tetrahedral capture probe solutions prepared on the nitrocellulose membrane of the test strip to prepare the test line and the control line. As Figure 4 shown. Figure 4As shown in [[A]], in the sample reaction solution, there are aptamer probe [[B]] and reporter probe [[A]]. In the absence of exosomes, for the gold conjugate pad prepared with colloidal gold, no red test line appears at the test line and control line positions, indicating that the colloidal gold not functionalized with streptavidin cannot be captured. As Figure 4 As shown in [[B]], in the sample reaction solution, there are aptamer probe [[B]] and reporter probe [[A]]. In the absence of exosomes, for the gold conjugate pad prepared with colloidal gold functionalized with streptavidin, no red test line appears at the test line position, while red test lines appear at the control line positions. This result indicates that the streptavidin-functionalized colloidal gold is captured by the biotinylated tetrahedron capture probe at the control line, and when there are no exosomes, the aptamer probe [[B]] and reporter probe [[A]] do not perform the "AND" gate logic operation, and the streptavidin-functionalized colloidal gold cannot be captured by the tetrahedron capture probe at the test line position. Compared with Figure 4 [[A]], Figure 4 in [[B]], a red control strip appears because the biotinylated tetrahedron captures the functionalized colloidal gold through the reaction of biotin molecules with streptavidin, indicating the successful preparation of the streptavidin-functionalized colloidal gold. As Figure 4 As shown in [[C]], in the sample reaction solution, there are aptamer probe [[B]] and reporter probe [[A]], and in the presence of exosomes, for the gold conjugate pad prepared with colloidal gold functionalized with streptavidin, a red test line appears at the test line position, and red control lines appear at the control line positions. Compared with Figure 4 [[B]], Figure 4A red detection band appears for C. On the one hand, this result is due to the specific recognition and binding of the aptamer probe to the CD63 molecule on the exosome, and aptamer probe B is captured at the test line position by complementary hybridization of its 3'-end coding sequence with the tetrahedron capture probe, thereby capturing the exosome from the sample solution to the test line. On the other hand, since the cholesterol molecule (cholesteryl) modified at the 5'-end of the reporter probe A is inserted and anchored in the exosome lipid bilayer membrane, streptavidin-modified colloidal gold is captured outside the exosome membrane through the biotin modified at its 3'-end. That is, along with the exosome being captured to the test line, a red band appears. Therefore, in the presence of exosomes, aptamer probe B and reporter probe A are simultaneously connected to the exosome membrane, that is, aptamer probe B and reporter probe A perform an "AND" gate logic operation on the exosome membrane, thereby forming a nano-structure of aptamer probe-exosome-reporter probe. This structure acts as a "bridge" to connect streptavidin-functionalized colloidal gold at the test line position, presenting a red detection band. These test strip results indicate that the test strip based on the DNA tetrahedron capture probe is successfully prepared, and the aptamer probe and reporter probe reaction system can specifically respond to exosomes for logical operations, and then output a visually observable red detection band signal. The newly constructed test strip detection method works as shown in the detection principle diagram and has good feasibility. This lateral flow chromatographic test strip based on the DNA tetrahedron capture probe and aptamer probe logic operation provides a simple and rapid new detection method with a full nucleic acid strategy for exosome detection.
[0063] Combined with Examples 1-4, it can be seen that in the present invention, a sensing detection interface based on a DNA tetrahedron capture probe is designed and constructed on the test line and the quality control line of the lateral flow chromatographic test strip. Further, colloidal gold is prepared by the sodium citrate reduction method and functionalized with streptavidin to form a streptavidin / gold nanoparticle (SA-AuNPs) for preparing the gold conjugate pad of the lateral flow chromatographic test strip. At the same time, reporter probe A and aptamer probe B are designed in the experimental technique. The 5'-end of reporter probe A is modified with a cholesterol molecule (5'-cholesteryl), and its 3'-end is modified with a biotin molecule (3'-Biotin-TEG). Probe A can insert into the outer membrane of exosomes through 5'-cholesteryl and react with SA-AuNPs through Biotin, thereby capturing colloidal gold outside the exosome membrane. The 5'-end of aptamer probe B is encoded with an aptamer sequence (Aptamer) for the CD63 molecule, and a biological coding sequence (Barcode) is designed at its 3'-end. Probe B can recognize and bind to the CD63 molecule on the surface of the exosome membrane through Aptamer and hybridize complementarily with the tetrahedron capture probe on the test line through Barcode, thereby capturing exosomes on the test line. When exosomes are present, both reporter probe A and aptamer probe B bind to its surface, and the binding event of anchoring the two probes on the surface of the exosome membrane is regarded as two signal inputs of the "AND" gate in computer operation. Aptamer probe B hybridizes complementarily with the tetrahedron capture probe through Barcode, promoting the capture of exosomes on the test line; reporter probe A binds to streptavidin through the biotin molecule, promoting the capture of streptavidin-modified colloidal gold on the surface of the exosome membrane. At this time, a large amount of colloidal gold aggregates at the test line position of the lateral flow chromatographic test strip to form a red band, that is, the two signal inputs of the "AND" gate result in a visual signal output of the red band. When exosomes are absent, reporter probe A and aptamer probe B are both in a free state, which is equivalent to only one signal input in the "AND" gate. At this time, streptavidin-modified colloidal gold is not captured at the test line position of the lateral flow chromatographic test strip, and no red band is formed. Thus, the strategy of using a DNA tetrahedron nanostructure probe sensing interface in the present invention can efficiently capture the barcode probe on the surface of exosomes, and then capture exosomes at the test line position in the sample flow. Further, through the introduction of the "AND" gate logic operation between reporter probe A and aptamer probe B triggered by the presence of exosomes, exosomes can be specifically recognized and detected. The lateral flow chromatographic test strip is one of the most convenient biosensing platforms for untrained personnel. Therefore, based on the DNA tetrahedron capture probe sensing interface and the nucleic acid aptamer test strip, it is expected to provide a reliable, simple, and point-of-care detection new method for the rapid and accurate diagnosis of non-nucleic acid biomarkers such as exosomes.
[0064] For those skilled in the art, it is obvious that the present invention is not limited to the details of the above-described exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic characteristics of the present invention. Therefore, in any regard, the embodiments should be regarded as exemplary and non-limiting. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be embraced within the present invention.
[0065] In addition, it should be understood that although this specification is described according to embodiments, not every embodiment only contains an independent technical solution. This narrative manner of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.
Claims
1. An exosome test strip based on a DNA tetrahedron sensing interface and aptamer logic operation, characterized in that: The preparation principle of the test strip is based on DNA self-assembly technology. Four single-stranded DNAs are assembled into a tetrahedral nanostructure, and a complementary sequence or a biotin molecule is encoded and designed at the 5' end or 3' end of each single-stranded DNA as a capture probe. After being assembled into a tetrahedron, the capture probe is located at the four vertices of the tetrahedron. The test strip constructs a lateral flow chromatography test strip biosensing interface with the DNA tetrahedron capture probe; The test strip includes a detection layer and a back layer. The back layer is provided with a back pad. The detection layer is sequentially provided with a gold label pad, a detection line, and a quality control line from left to right. A sample pad is provided on the gold label pad away from the detection line. An absorbent pad is provided on the side of the quality control line away from the detection line. The surface of the detection layer is provided with a nitrocellulose membrane; The detection line includes four single-stranded probe chains Strand A-T, Strand B-T, Strand C-T, and Strand D-T. The tetrahedron is assembled with complementary sequences encoded at the 3' ends of the four single-stranded probe chains to form a tetrahedron capture probe at the detection line position. The tetrahedron capture probe solution is scribed on the nitrocellulose membrane of the test strip to form a detection line; The quality control line includes four single-stranded probe chains Strand A-5B, Strand B-5B, Strand C-5B, and Strand D-5B. The tetrahedron is assembled with biotin molecules modified at the 5' ends of the four single-stranded probe chains to form a biotinylated tetrahedron capture probe at the quality control line position. The biotinylated tetrahedron capture probe solution is scribed on the nitrocellulose membrane to form a quality control line; The test strip also includes a reporter probe and an aptamer probe. The tetrahedron capture probe on the detection line captures the aptamer probe. The biotinylated tetrahedron probe on the quality control line directly captures streptavidin-functionalized colloidal gold for quality control line color development. The reporter probe performs an "AND" gate logic operation with the aptamer probe and then captures streptavidin-functionalized colloidal gold at the tetrahedron capture probe on the detection line for detection line color development; The synthetic nucleic acid sequence information used for the test strip is: The reporter probe is Chol-A, and the aptamer probe is CD63-B.
2. The preparation method of the exosome test strip based on the DNA tetrahedron sensing interface and aptamer logical operation according to claim 1, characterized in that: Including the following steps: (1) Construct a lateral flow chromatography test strip biosensing interface with the DNA tetrahedron capture probe; (2) Modify colloidal gold with streptavidin to prepare streptavidin-colloidal gold particles for preparing the gold label pad; (3) Specifically recognize and bind the aptamer probe with exosomes. A sequence complementary to the tetrahedron capture probe is encoded at the 3' end of the aptamer probe, so that exosomes in the sample flow are captured at the detection line position; (4) Use the cholesterol molecule modified at the 5' end of the reporter probe to insert and anchor to the lipid bilayer cell membrane of exosomes, and the biotin modified at the 3' end of the reporter probe captures streptavidin-modified colloidal gold nanoparticles; (5) Use biotin molecules to modify the 5' ends of the single-stranded tetrahedron assemblies to form biotinylated tetrahedron capture probes at the quality control line position.
3. The preparation method of the exosome test strip based on the DNA tetrahedron sensing interface and aptamer logic operation according to claim 2, wherein: The gold label pad includes a colloidal gold solution, and the preparation steps of the colloidal gold solution are as follows: (1) Reducing the HAuCl4 solution in a boiling state with a citrate solution to obtain a solution for synthesizing spherical colloidal gold nanoparticles; (2) Mixing the solution obtained in step (1) with streptavidin to obtain a colloidal gold solution of streptavidin-functionalized colloidal gold nanoparticles for preparing the gold label pad.
Citation Information
Patent Citations
Kit for rapid quantification of cancer cell exosome as well as preparation method and application of kit
CN111521785A
DNA probe for detecting nucleic acid of influenza B virus and application of DNA probe
CN113981150A