Molecular marker specific primer of b4galnt2 gene of mongolian sheep and application thereof
By detecting the g.25929793G/T SNP site in the 7th intron region of the Mongolian sheep gene B4GALNT2, individuals with high prolificacy were screened, solving the problems of long breeding cycles and low accuracy in existing technologies, and thus improving the reproductive capacity of Mongolian sheep.
Patent Information
- Application Number
- CN202310157175.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-23
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2043-02-23
AI Technical Summary
Existing technologies make it difficult to effectively screen Mongolian sheep individuals with excellent reproductive capacity and prolific traits, resulting in long breeding cycles and low accuracy.
Specific primers were designed to detect the g.25929793G/T SNP site in the 7th intron region of the B4GALNT2 gene in Mongolian sheep. The genotype of individual Mongolian sheep was determined by PCR amplification and sequencing, and individuals with high prolificacy were screened out.
It has improved the reproductive capacity of Mongolian sheep, especially the number of lambs per litter, shortened the breeding cycle, and improved the accuracy and efficiency of breeding.
Smart Images
Figure CN116219035B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of molecular biology, and particularly relates to specific primers of a molecular marker of B4GALNT2 gene of Mongolian sheep and application thereof. BACKGROUND
[0002] B4GALNT2 (beta-1,4-N-acetyl-galactosaminyl transferase 2) is a beta-1,4-N-acetyl-galactosaminyl transferase 2, which belongs to the family of N-acetyl-galactosaminyl transferases (GalNAc-Tases). The family is an important class of initial enzymes for catalyzing O-glycosylation, and is mainly responsible for transferring N-acetyl galactosamine (GalNAc) from a UDP-GalNAc donor to the hydroxyl group of a specific sequence of serine or threonine in the polypeptide chain of a receptor protein to synthesize O-glycan. The B4GALNT2 gene of sheep is located on chromosome 11, has a full length of 62654 bp, and contains 11 exons and 10 introns.
[0003] In the study of identifying the gene locus of the major gene FecL affecting the ovulation rate of (Lacaune) sheep, it was found that the B4GALNT2 gene was one of the two genes contained in the gene locus of FecL. In the study of the correlation between the ectopic expression of B4GALNT2 and the high-yield phenotype of Lacaune sheep, it was found that the expression amount of the B4GALNT2 gene in the ovary of a female sheep carrying a homozygous mutation of FecL was 1000 times higher than that of a wild type individual. It was also found that the overexpression of the B4GALNT2 gene would cause atypical glycosylation of more than 10 glycoproteins in the ovary of a female sheep carrying a homozygous mutation of FecL, and such glycosylation has been proved to enhance the fertility of mice. It was identified that the SNP g.36938224A / T (GenBank accession: NC_040262.1) existing in the 7th intron of the gene was in complete linkage disequilibrium with the FecL gene, and therefore the B4GALNT2 gene was the best positioning and expression candidate gene of FecL. Since the FecL gene is a major gene affecting the ovulation rate of Lacaune sheep, it can be considered that the B4GALNT2 gene is a candidate functional gene affecting the ovulation rate and multiple birth rate of sheep.
[0004] Singlenucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by change of single nucleotide, which is widely used due to advantages of large quantity, high density and high genetic stability. The genetic markers are associated with growth traits, so that selection breeding at DNA level is realized, human influence is effectively avoided, selection breeding accuracy is improved, individuals with excellent traits are identified at early stage, excellent backup parents are screened, breeding cycle is shortened and breeding process is greatly accelerated. KAPA blood PCR method is used to genotype and detect g.36938224A / T SNP site of B4GALNT2 gene of high multiple pregnancy trait sheep variety D' Man sheep population B4GALNT2, it is found that the site is significantly related to multiple pregnancy rate of D' Man sheep, and the g.36938224A / T SNP site of B4GALNT2 gene is also significantly related to multiple pregnancy trait of Noire du Velay sheep.
[0005] Sanger sequencing method finds that the g.36938224A / T SNP site mutation of B4GALNT2 gene is not detected in 11 kinds of sheep samples of small-tail han sheep, lake sheep, cele black sheep, tan sheep, white suffolk sheep, black suffolk sheep, east friesian sheep, tibetan sheep, mutton merino sheep, dorper sheep and corriedale sheep. However, they find that the g.36946470C / T SNP site located in the 5th exon of B4GALNT2 gene and the g.36933082C / T SNP site located in the 8th exon are significantly related to the first multiple pregnancy trait of small-tail han sheep (P<0.05). SUMMARY
[0006] The purpose of the present application is to provide a specific primer of a molecular marker of B4GALNT2 gene of Mongolian sheep.
[0007] The purpose of the present application is to provide a specific primer of a molecular marker of B4GALNT2 gene of Mongolian sheep.
[0008] The present application adopts DNA sequencing technology to detect whether the g.25929793G / T mutation site exists in the 7th intron region of B4GALNT2 gene in the genome of the to-be-tested Mongolian sheep, determines the genetic effect of the g.25929793G / T SNP site in the B4GALNT2 gene on the multiple pregnancy trait of Mongolian sheep in China, so as to screen the Mongolian sheep for breeding by judging the genotype of the Mongolian sheep at the above site.
[0009] The specific primer of the molecular marker of B4GALNT2 gene of Mongolian sheep according to the specific embodiment of the present application has the following primer sequence:
[0010] SEQ ID NO. 1: 5'-GGGTCTTTTGTGTTATAAAACT-3';
[0011] SEQ ID NO. 2: 5'-AAACTACCTAAGACCAAATCC-3'.
[0012] The specific primer of the molecular marker of the Mongolian sheep fertility-related gene B4GALNT2 can be applied to a kit for detecting the Mongolian sheep multiple pregnancy trait, or applied to assist in breeding of the Mongolian sheep.
[0013] The method for improving the fertility of the Mongolian sheep according to the specific embodiment of the present application comprises the step of amplifying the genomic DNA of the Mongolian sheep by using the specific primer.
[0014] Specifically, the method for improving the fertility of the Mongolian sheep according to the specific embodiment of the present application comprises the steps of:
[0015] comprising the steps of:
[0016] (1) extracting the genomic DNA of the Mongolian sheep to be detected;
[0017] (2) using the genomic DNA of the Mongolian sheep extracted in the step (1) as a template, performing PCR amplification by using the specific primer, and obtaining an amplification product;
[0018] (3) judging whether the g.25929793 G / T mutation site exists in the 7th intron region of the B4GALNT2 gene in the genomic DNA of the Mongolian sheep in the amplification product, so as to determine the genotype of the individual Mongolian sheep at the above site, and then screening the Mongolian sheep by using the genotype. The nucleotide sequence NCBI Reference Sequence of the B4GALNT2 gene of the sheep 11th chromosome is NC_040262.1, and the nucleotide at the position of 25929578 to 25930324.
[0019] The detection method of the g.25929793 G / T SNP of the B4GALNT2 gene in the genomic DNA of the Mongolian sheep is as follows:
[0020] amplifying the fragment of the nucleotide at the position of 25929578 to 25930324 of the B4GALNT2 gene of the Mongolian sheep NC_040262.1 by using the PCR method, and performing DNA sequencing on the amplification product;
[0021] If a single peak appears at the position of the 25929793th base of the 11th chromosome and the genotype is G, then the genotype is GG; Figure 2 )
[0022] If a peak is present at the position of 25929793 bases of chromosome 11, then the genotype is GT; Figure 2 ]
[0023] The multiple birth traits of the Mongolian sheep with the GT genotype of g.25929793G / T are improved, and the results show that the above-mentioned site can act as a molecular marker for the multiple birth traits of the Mongolian sheep.
[0024] A method for detecting the molecular marker of the application comprises using the primers to amplify the molecular marker in the genome of the Mongolian sheep by PCR, sequencing the amplification product, and determining the polymorphism of the g.25929793G / T site of the B4GALNT2 gene of the Mongolian sheep.
[0025] In the application, the reproductive capacity of the Mongolian sheep is specifically embodied as the number of lambs produced per birth.
[0026] According to the method for improving the reproductive capacity of the Mongolian sheep according to the specific embodiment of the application, in the reaction system of 25 μL, 10 pmol / μL of the upper and lower primers are 1.25 μL each, 2×Taq Master Mix is 12.5 μL, genomic DNA (50~100 ng / μL) is 2 μL, and ddH2O is 8 μL.
[0027] According to the method for improving the reproductive capacity of the Mongolian sheep according to the specific embodiment of the application, the PCR amplification program is 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 50 s, 35 cycles, 72℃ extension for 10 min, 4℃ preservation, and then sequencing.
[0028] The application has the following beneficial effects:
[0029] The application finds that the fragment region of nucleotides from 25929578 to 25930324 of the chromosome 11 of the sheep with the NCBI Reference Sequence of the B4GALNT2 gene as NC_040262.1 exists a molecular marker related to the multiple birth traits of the Mongolian sheep.
[0030] The application designs specific primers, and uses DNA sequencing technology to detect the genetic effect of the g.25929793G / T SNP site in the B4GALNT2 gene in the genome of the Mongolian sheep on the multiple birth traits of the Mongolian sheep in China.
[0031] The data statistics result shows that the specific primer of the application can detect the molecular marker, so that the application can be used for assisting Mongolian sheep breeding and improving the lambing number of Mongolian sheep, and the method of the application can be used as an effective method for assisting improving the multiple pregnancy trait of Mongolian sheep. BRIEF DESCRIPTION OF DRAWINGS
[0032] In order to more clearly illustrate the technical solutions of the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.
[0033] Figure 1 PCR product diagram of NC_040262.1: g.25929793G / T site of B4GALNT2 gene of Mongolian sheep;
[0034] Figure 2 Sequencing result of NC_040262.1: g.25929793G / T site of B4GALNT2 gene of Mongolian sheep. DETAILED DESCRIPTION
[0035] In order to make the purpose, technical solutions and advantages of the present application more clear, the technical solutions of the present application will be described in detail below. Obviously, the described embodiments are only some embodiments of the present application, not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the scope of the present application.
[0036] Example 1: Method for establishing a molecular marker for detecting the multiple pregnancy trait of Mongolian sheep
[0037] 1) Template material preparation
[0038] Blood samples of Mongolian sheep were collected and the number of births was recorded. The collected 250 Mongolian sheep samples were selected from Sunitezuo Banner and Dong Ujimqin Banner of Inner Mongolia Autonomous Region, and the blood samples were stored in an anticoagulant tube for use.
[0039] 2) Sequencing of PCR product
[0040] Sequencing of the PCR product was performed using 250 Mongolian sheep, and a SNP site located in the 7th intron region of the B4GALNT2 gene, i.e. NC_040262.1: g.25929793G / T site, was found.
[0041] 3) Primer design
[0042] According to the sheep gene sequence (GeneBank accession number: NC_040262.1) reported by GeneBank, the upstream and downstream primers F and R are designed by the present application
[0043] F: 5'-GGGTCTTTTGTGTTATAAAACT-3';
[0044] R: 5'-AAACTACCTAAGACCAAATCC-3' (747bp).
[0045] The genome extracted from the experimental material of Mongolian sheep is used as a template, and the above-mentioned primers are used for amplification.
[0046] The amplification systems of the upstream and downstream primers are consistent, and the total volume of the amplification system is 50 μL, wherein the upstream and downstream primers are 1 μL each, the template is 2 μL, the premix is 25 μL, and the deionized water is 21 μL.
[0047] The amplification product is pre-denatured at 94℃ for 5 min, denatured at 94℃ for 30 s, annealed at 60℃ for 30 s, extended at 72℃ for 50 s, 35 cycles, extended at 72℃ for 10 min, and stored at 4℃, and the amplification product is sequenced.
[0048] The PCR amplification results of the NC_040262.1:g.25929793 G / T site of B4GALNT2 are shown in Figure 1 .
[0049] The PCR sequencing results of the NC_040262.1:g.25929793 G / T site of B4GALNT2 are shown in Figure 2 .
[0050] The nucleotide sequence of the PCR product is shown in SEQ ID NO. 3:
[0051] gggtcttttgtgttataaaactttattctttaataaaatggattcattgtttttttctagcttttgctcttttgccttaattcaagaaattcttccctacattgaagccgtaaagatattctcctgtatttttttttcaaaagttacctatgctttattctcacatttagatacttaatccacctagaagttatgtttatgcatggcatgtgata gggacctaatattttacacatggagcacctactgtcccgccaccatggaccaagtggtccagccttgtcccgcttgaacagccagcccctcacacacgcagcttcttgcatgtaggagtttgaaccagcctttgttgaggcacattgatctgtatcctggggctcattttacatttccatatgctttatagcaggttttctatctagtgcagataaattctgtgttgcaggatgactgtacttcatttagtgaaattttcttagctcttcttggtcatttactttttcattggagttttagcatcagctcatcaagatcctccaaaatgccttgagattttgattagaattttctaaaatttgttgattaattagagatgaactgacagttttatgaggttgaatattcacaaccatgaatctgctgtatctctccatgtcatagtctcttcacaggttcttcagtaatttattttgtagtcctatttgtaaaggaattgtacattttattggatttggtcttaggtagttt
[0052] Statistical analysis of B4GALNT2 genotype and its relationship with the multiple birth trait of the Mongolian sheep population in Example 2
[0053] The primers designed according to the method of step 3) were used to detect the genes of the Mongolian sheep, and the genotype frequency and allele frequency of the Mongolian sheep were calculated, and the statistical results are shown in Table 1.
[0054]
[0055] The results in Table 1 show that the g.25929793 G / T site in the Mongolian sheep population is polymorphic.
[0056] 3. Association analysis
[0057] (1) The g.25929793 G / T site in the selected sample population was analyzed for individual genotype, the allele frequency and genotype frequency were calculated, and χ 2 test was performed.
[0058] (2) According to the test results, the gene frequency and genotype frequency of the above-mentioned sites are calculated, and the chi-square goodness-of-fit test of the Hardy-Weinberg equilibrium of the genotype distribution of the site is performed. The correlation between the multiple birth traits of the Mongolian sheep population and the genotype is analyzed by using the single factor analysis of variance of SPSS 19.0.
[0059]
[0060] Note: The numerical value is represented by mean ± standard deviation; the same column and different lowercase letters represent significant difference P <0.05).
[0061] The results in Table 2 show that the above-mentioned mutation sites have significant differences with the multiple birth traits of the Mongolian sheep. The results show that the polymorphism of these sites can be used to screen the Mongolian sheep of high multiple birth traits.
[0062] Example 3: Breeding of Mongolian sheep
[0063] The present application finds that the number of lambs of the GT genotype of the g.25929793G / T site is 0.17 more than that of the GG genotype, and increases by 13.6%. Therefore, the molecular marker of the present application can be used to screen the Mongolian sheep breeding rams, and the individual with the genotype that can promote the number of lambs of the above-mentioned site is selected as the Mongolian sheep breeding ram for genetic breeding, so as to achieve the breeding goal of promoting the number of lambs of the Mongolian sheep.
[0064] The specific method comprises the following steps:
[0065] (1) Extracting the genomic DNA of the Mongolian sheep to be tested;
[0066] (2) Using the genomic DNA of the Mongolian sheep extracted in step (1) as a template, performing PCR amplification with specific primers to obtain an amplification product;
[0067] The total volume of the amplification system is 50 μL, wherein 1 μL of the upstream and downstream primers, 2 μL of the template, 25 μL of the premix, and 21 μL of the deionized water.
[0068] The amplification product is pre-denatured at 94℃ for 5 min, denatured at 94℃ for 30 s, annealed at 60℃ for 30 s, extended at 72℃ for 50 s, 35 cycles, extended at 72℃ for 10 min, and stored at 4℃;
[0069] (3) Determining whether the g.25929793G / T mutation site exists in the B4GALNT2 gene 7 intron region of the genomic DNA of the Mongolian sheep in the amplification product, so as to determine the genotype of the individual at the above-mentioned site, and then screening the Mongolian sheep by genotype.
[0070] The above merely preferred embodiments of the present application are not intended to limit the present application, and any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A method for improving the reproductive performance of Mongolian sheep, characterized in that, The method comprises the following steps: (1) extracting the genomic DNA of the Mongolian sheep to be tested; (2) using the genomic DNA of the Mongolian sheep extracted in step (1) as a template, performing PCR amplification with specific primers to obtain an amplification product; The specific primer sequence is as follows: SEQ ID NO. 1: 5'-GGGTCTTTTGTGTTATAAAACT-3'; SEQ ID NO. 2: 5'-AAACTACCTAAGACCAAATCC-3'; (3) detecting whether a g.25929793 G / T mutation site exists in the B4GALNT2 gene 7 intron region in the genome of the Mongolian sheep to be tested, so as to determine the genotype of the Mongolian sheep individual at the site, and screening the Mongolian sheep for breeding through the genotype, wherein the fecundity is the number of lambs produced per pregnancy.
2. The method for improving the reproductive performance of Mongolian sheep according to claim 1, characterized in that, In step (2), the reaction system is 25 μL, wherein 10 pmol / μL of the upstream and downstream primers are 1.25 μL each, 2×Taq Master Mix is 12.5 μL, 50~100 ng / μL of genomic DNA is 2 μL, and ddH2O is 8 μL.
3. The method for improving the reproductive performance of Mongolian sheep according to claim 1, characterized in that, The amplification procedure of step (2) is as follows: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 s, 60 ℃ annealing for 30 s, 72 ℃ extension for 50 s, 35 cycles; finally, 72 ℃ extension for 10 min, and storage at 4 ℃.