A pCasRA plasmid and its preparation method and application

Abstract

The present invention discloses a pCasRA plasmid, the nucleotide information of the pCasRA plasmid is shown in SEQ ID NO: 1. The pCasRA plasmid uses the pCas9 plasmid as a vector skeleton, accesses the conjugation transfer site oriT, the replicon of the pRA0726 plasmid and the cefoxitin resistance gene on the vector skeleton, and replaces the crRNA part in the pCas9 plasmid with the connection product of the Cas9 protein gene (SEQ ID NO: 20) and the integrated sgRNA (SEQ ID NO: 7). The pCasRA plasmid of the present invention can be transferred to Riemerella anatipestifer by conjugation in Escherichia coli, and the pCasRA plasmid can stably express the Cas9 protein gene in Riemerella anatipestifer, perform genomic DNA editing, and achieve gene knockout and / or single base mutation.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a pCasRA plasmid and a preparation method and application thereof. Background Art

[0002] Riemerella anatipestifer mainly infects ducklings, turkeys, geese and other poultry, and is widely prevalent throughout the country. It is mainly transmitted horizontally through the respiratory tract, digestive tract and mosquito bites, such as droplets, contaminated objects, water sources, excrement and damaged lower limb skin. The disease mainly presents typical "three-week inflammation" symptoms, namely air sacculitis, perihepatitis and fibrinous pericarditis. The infected young birds often show a variety of clinical symptoms such as lethargy, diarrhea, head and neck tremors and opisthotonos. Clinically, this disease is also called duck infectious serositis, duck septicemia or duck plague syndrome, and the mortality rate can be as high as 80%.

[0003] The serotypes of Riemerella anatipestifer are very complex, and the cross-protection between serotypes is not obvious. In addition, multiple serotypes may be prevalent in the same farm at the same time, so it is difficult to effectively prevent and control them with vaccines. In addition, Riemerella anatipestifer has a wide spectrum of drug resistance. Studies have reported that it is resistant to multiple antibiotics such as chloramphenicol, tetracyclines, quinolones, macrolides, lincosamides, aminoglycosides, and cephalosporins. Therefore, it is also difficult to prevent and control Riemerella anatipestifer infection through antibiotic treatment in production. In order to better understand the virulence factors and pathogenic mechanisms of Riemerella anatipestifer and explore new ways to prevent and control Riemerella anatipestifer disease, it is necessary to establish an efficient gene editing method. At present, the genetic research of Riemerella anatipestifer uses traditional homologous recombination technology, but due to the limitations of homologous recombination technology itself, its development in experimental research is limited. Summary of the invention

[0004] The purpose of the present invention is to overcome the above-mentioned deficiencies in the prior art and to provide a pCasRA plasmid and a preparation method and application thereof.

[0005] The first object of the present invention is to provide a pCasRA plasmid.

[0006] The second object of the present invention is to provide the use of the above-mentioned pCasRA plasmid in rapid gene editing of Riemerella anatipestifer.

[0007] The third object of the present invention is to provide a method for preparing the above-mentioned pCasRA plasmid.

[0008] The fourth object of the present invention is to provide a kit for rapid gene editing of Riemerella anatipestifer.

[0009] CRISPR / Cas9 is a new gene editing technology developed in recent years. It has great potential to revolutionize genome modification and mutation technology in living organisms. This technology originally originated from the innate immune system of microorganisms and is an extremely effective method for microorganisms to fight against phage invasion. It is mainly composed of a nuclease Cas9 and a sgRNA that mediates RNA. The Cas9 nuclease can specifically bind to the sgRNA, target the genome through complementary pairing of sgRNA and genomic DNA bases, and achieve double-strand breaks in the genomic DNA. Combined with gene recombinase, this technology can quickly, conveniently and accurately target and mutate any part of the genome. With the breakthrough development of large-scale DNA microarray synthesis technology, this technology can achieve large-scale transcriptional inhibition and activation at the genome level or specific gene groups, greatly improving the efficiency of functional gene screening.

[0010] CRISPR / Cas9 genome editing technology has achieved efficient genome editing in mammalian cells and some model organisms, such as Escherichia coli and yeast, but has not yet achieved genome editing in Riemerella anatipestifer. It will greatly simplify the genetic manipulation of Riemerella anatipestifer and improve the efficiency of screening functional genes, laying the foundation for subsequent genetic biological function research, drug target discovery, new drug design and gene therapy.

[0011] In order to achieve the above object, the present invention is implemented by the following scheme:

[0012] A pCasRA plasmid, the nucleotide sequence information of the pCasRA plasmid is shown in SEQ ID NO: 1.

[0013] The present invention also seeks to protect the use of the above-mentioned pCasRA plasmid in rapid gene editing of Riemerella anatipestifer.

[0014] Preferably, the gene editing is gene knockout and / or single base mutation.

[0015] More preferably, the competent Escherichia coli in step S4 is competent Escherichia coli DH5α.

[0016] More preferably, the gene knockout is the knockout of the dprA gene (NC_017045.1) with the gene number NC_017045.1.

[0017] More preferably, the single base mutation is a mutation of cytosine C at position 271 in the dprA gene to adenine A.

[0018] The above gene knockout method comprises the following steps:

[0019] S1. Select the DNA fragment of 20 bp before the NGG sequence on the gene to be knocked out as the spacer DNA, and obtain the reverse complementary sequence of the spacer DNA, add GAAA to the 5' end of the spacer DNA, add AAAC to the 5' end of the reverse complementary sequence, anneal and connect the spacer DNA and the reverse complementary sequence, and then insert them into the BsaI restriction site of the pCasRA plasmid to obtain the pCasRA-spacer plasmid; N of the NGG sequence is an arbitrary base;

[0020] S2. Amplify the DNA fragment of 600 to 1000 bp before the 5' end of the target gene to obtain the upstream DNA fragment of the target gene, amplify the DNA fragment of 600 to 1000 bp after the 3' end of the target gene to obtain the downstream DNA fragment of the target gene, and connect the upstream DNA fragment of the target gene and the downstream DNA fragment of the target gene to obtain the target gene upstream and downstream DNA fragment connection product;

[0021] S3. Connect the target gene upstream and downstream DNA fragment ligation product obtained in step S2 to the SaII restriction site of the pCasRA-spacer plasmid obtained in step S1 to obtain a ligation product;

[0022] S4. The ligation product obtained in step S3 is transformed into competent Escherichia coli. After culture, the plasmid is extracted to obtain the pCasRA-target gene plasmid;

[0023] S5. The pCasRA-target gene plasmid obtained in step S4 is transferred into Riemerella anatipestifer to achieve gene knockout.

[0024] The present invention also claims a method for preparing the above-mentioned pCasRA plasmid, comprising the following steps:

[0025] S1. Using pCas9 plasmid as the vector backbone, pEX18Gm plasmid as the template to clone the oriT conjugation transfer site, synthesizing the replicon of pRA0726 plasmid and the cefoxitin resistance gene according to the data published on NCBI, and connecting them to the vector backbone to construct the Escherichia coli-Riemannella anatipestifer shuttle vector plasmid;

[0026] The nucleotide sequence of the oriT conjugative transfer site is shown in SEQ ID NO: 2; the nucleotide sequence of the replicon of the pRA0726 plasmid is shown in SEQ ID NO: 3;

[0027] S2. Replace the promoter of the Cas9 gene in the Escherichia coli-Riemannii anatipestifer shuttle vector plasmid obtained in step S1 with the promoter of the Riemerella anatipestifer RA-CH-1 genome;

[0028] The nucleotide sequence of the promoter of the Riemerella anatipestifer RA-CH-1 genome is shown in SEQ ID NO: 4; the nucleotide sequence of the promoter of the Cas9 gene is shown in SEQ ID NO: 5;

[0029] S3. Use pCasSA plasmid as template to clone sgRNA sequence; use the genome of Riemerella anatipestifer standard strain 11845 as template to clone rpsL gene promoter, connect rpsL gene promoter and sgRNA sequence to obtain integrated sgRNA; use pCas9 plasmid as template to amplify Cas9 protein gene, connect Cas9 protein gene and 5' end of integrated sgRNA to obtain connection product;

[0030] The nucleotide information of the sgRNA sequence is shown in SEQ ID NO: 17; the nucleotide sequence of the rpsL gene promoter is shown in SEQ ID NO: 6; the nucleotide sequence of the integrated sgRNA is shown in SEQ ID NO: 7; the nucleotide sequence of the Cas9 protein gene is shown in SEQ ID NO: 20;

[0031] S4. The ligation product obtained in step S3 and the Escherichia coli-Riemerella anatipestifer shuttle vector plasmid obtained in step S1 are simultaneously digested with Sail enzyme and SacI enzyme and then ligated to obtain.

[0032] The present invention also claims protection for a kit for rapid gene editing of Riemerella anatipestifer, wherein the kit comprises the above-mentioned pCasRA plasmid; the kit also contains BsaI enzyme and / or SaII enzyme.

[0033] Preferably, the gene editing is gene knockout and / or single base mutation.

[0034] More preferably, the gene knockout is the knockout of the dprA gene with the gene number NC_017045.1.

[0035] More preferably, the single base mutation is a mutation of cytosine C at position 271 in the dprA gene to adenine A.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] The present invention provides a pCasRA plasmid, the nucleotide information of the pCasRA plasmid is shown in SEQ ID NO: 1. The pCasRA plasmid uses the pCas9 plasmid as a vector skeleton, accesses the conjugation transfer site oriT, the replicon of the pRA0726 plasmid and the cefoxitin resistance gene on the vector skeleton, and replaces the crRNA part in the pCas9 plasmid with the connection product of the Cas9 protein gene (SEQ ID NO: 20) and the integrated sgRNA (SEQ ID NO: 7). The pCasRA plasmid of the present invention is a shuttle plasmid that can replicate and propagate in Escherichia coli and Riemerella anatipestifer, and the plasmid contains a conjugation transfer site oriT, which can be transferred to Riemerella anatipestifer by conjugation in Escherichia coli; the plasmid shows chloramphenicol resistance in Escherichia coli and cefoxitin resistance in Riemerella anatipestifer, and can be used for strain screening; the plasmid can stably express the Cas9 protein gene in Riemerella anatipestifer, perform genomic DNA editing, and realize functions such as gene knockout and single base mutation. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 is a schematic diagram of the pCasRA plasmid;

[0039] Figure 2 This is the gel electrophoresis result of pCasRA plasmid used in gene knockout experiment;

[0040] Figure 3 This is a diagram showing the sequencing results of the pCasRA plasmid used in gene knockout experiments;

[0041] Figure 4 This is the sequencing result of the pCasRA plasmid used in the single-base mutation experiment. DETAILED DESCRIPTION

[0042] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0043] Example 1 Construction of pCasRA plasmid

[0044] 1. Experimental methods

[0045] (1) Construction of recombinant plasmid 1

[0046] The conjugation transfer site oriT was obtained by PCR amplification from the pEX18GM plasmid. The nucleotide sequence of the conjugation transfer site oriT is shown in SEQ ID NO:2; wherein the 5' primer sequence for amplifying oriT is shown in SEQ ID NO:8, and the 3' primer sequence for amplifying oriT is shown in SEQ ID NO:9.

[0047] 5′ primer for amplifying oriT (SEQ ID NO: 8): 5′-ccgTCTAGActagagtcgatcttcgccagc-3′;

[0048] 3' primer for amplification of oriT (SEQ ID NO:9): 5'-cggTCTAGAcgcctgatgcggtattttctcc-3'.

[0049] The uppercase part is the XbaI restriction site.

[0050] The reaction system for PCR amplification was: 25 μL of PrimerStar Max Premix, 1 μL of 5' primer for amplifying oriT (10 μM) (SEQ ID NO: 8), 1 μL of 3' primer for amplifying oriT (10 μM) (SEQ ID NO: 9), 2 μL of template DNA (100 ng / μL of pEX18GM plasmid (AAC27024.1)), and 21 μL of ddH2O.

[0051] The PCR amplification reaction program was: 98°C, 1 min; 98°C, 15 s, 55°C, 15 s, 72°C, 30 s, 30 cycles; 72°C, 10 min.

[0052] After the PCR reaction, the PCR product was purified using a PCR product purification kit (Beijing Anolun Biotechnology Co., Ltd.). The purification steps were performed according to the kit operation manual to obtain the amplified oriT fragment.

[0053] The pCas9 plasmid was digested with XbaI enzyme, wherein the digestion reaction system was: 5 μL of 10× CutSmart Buffer (NEB), 1 μL of XbaI enzyme (NEB), 1 μg of pCas9 plasmid, and ddH2O was added to make the volume up to 50 μL to obtain a linearized pCas9 plasmid.

[0054] The amplified oriT fragment was digested with XbaI enzyme, wherein the digestion reaction system was: 5 μL of 10×CutSmart Buffer (NEB), 1 μL of XbaI enzyme (NEB), 1 μg of amplified oriT fragment, and ddH2O was added to make the volume up to 50 μL to obtain the digested oriT fragment.

[0055] The linearized pCas9 plasmid and the oriT fragment after restriction digestion were connected with T4 DNA ligase. The connection reaction system was: 1 μL of 10×T4 DNA ligase Buffer (NEB), 1 μL of T4 DNA ligase (NEB), 30-50 ng of linearized pCas9 plasmid, the linearized pCas9 plasmid and the oriT fragment after restriction digestion were added in a molar ratio of 1:3, and ddH2O was added to make up the volume to 10 μL.

[0056] The pCas9 plasmid connected with the oriT fragment was obtained.

[0057] Take 10 μL of the pCas9 plasmid connected with the oriT fragment and transform it into the competent Escherichia coli Dh5α strain. Spread the transformed Dh5α strain on LB solid culture medium containing 50 μg / mL chloramphenicol. After the DH5α strain is completely absorbed by the LB solid culture medium, place the culture medium in an incubator at 37°C and invert it for overnight culture.

[0058] The next day, the transformed strains grown on the culture medium were verified by PCR and sent to a biological company (Qingke Biotechnology Co., Ltd.) for sequencing. The strains with correct sequencing were transferred and stored, and the plasmids were extracted using a plasmid mini-extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd.) to obtain recombinant plasmid 1.

[0059] (2) Construction of recombinant plasmid 2

[0060] The promoter of the genome of the RA-CH-1 strain published on NCBI, the replicon of the pRA0726 plasmid (KU997673.1, SEQ ID NO: 3) and the cefoxitin resistance gene fragment (NG_047633.1) were synthesized at Sangon Biotech Co., Ltd. and inserted into the pUC57 plasmid to obtain the recombinant pUC57 plasmid. The nucleotide sequence of the recombinant pUC57 plasmid is shown in SEQ ID NO: 12.

[0061] The nucleotide sequence of the promoter of the Riemerella anatipestifer RA-CH-1 genome is shown in SEQ ID NO:4.

[0062] The promoter of the genome of Riemerella anatipestifer RA-CH-1, the replicon of the pRA0726 plasmid and the cefoxitin resistance gene are obtained by PCR amplification using the recombinant pUC57 plasmid as a template. The 5' primer sequence used for amplifying the promoter of the genome of Riemerella anatipestifer RA-CH-1, the replicon of the pRA0726 plasmid and the cefoxitin resistance gene is shown in SEQ ID NO: 10; the 3' primer sequence used for amplifying the promoter of the genome of Riemerella anatipestifer RA-CH-1, the replicon of the pRA0726 plasmid and the cefoxitin resistance gene is shown in SEQ ID NO: 11.

[0063] 5' primer (SEQ ID NO: 10): 5'-cggGCTGAGGaattttaaataattttttta-3';

[0064] 3' primer (SEQ ID NO: 11): 5'-cggCCTCAGCaaaatcagttctttagcga-3';

[0065] The capitalized part is the restriction site of BbvCI enzyme.

[0066] The reaction system for PCR amplification was: 25 μL of PrimerStar Max Premix, 1 μL of 5' primer (10 μM) (SEQ ID NO: 10), 1 μL of 3' primer (10 μM) (SEQ ID NO: 11), 2 μL of template DNA (100 ng / μL of pUC57 plasmid), and 21 μL of ddH2O.

[0067] The PCR amplification reaction program was: 98°C, 1 min; 98°C, 15 s, 51°C, 15 s, 72°C, 90 s, 30 cycles; 72°C, 10 min.

[0068] After the PCR reaction was completed, the PCR product was recovered and purified using a PCR product purification recovery kit (Beijing Anolun Biotechnology Co., Ltd.). The recovery and purification steps were carried out according to the kit operation manual to obtain PCR product 1, namely the amplified promoter of the Riemerella anatipestifer RA-CH-1 genome, the replicon of the pRA0726 plasmid, and the cefoxitin resistance gene fragment.

[0069] The recombinant plasmid 1 obtained in step (1) is amplified by reverse PCR to remove the promoter (SEQ ID NO: 5) in front of its Cas9 protein gene, wherein the 5' primer sequence of reverse PCR amplification is shown in SEQ ID NO: 13; the 3' primer sequence of reverse PCR amplification is shown in SEQ ID NO: 14.

[0070] 5' primer (SEQ ID NO: 13): 5'-ggcGCTGAGGcccaatacttaataataaatagattataacac-3';

[0071] 3' primer (SEQ ID NO: 14): 5'-ccgCCTCAGCatggataagaaatactcaataggc-3';

[0072] The capitalized part is the restriction site of BbvCI enzyme.

[0073] The reaction system for PCR amplification was: 25 μL of PrimerStar Max Premix, 1 μL of 5' primer (10 μM) (SEQ ID NO: 13), 1 μL of 3' primer (10 μM) (SEQ ID NO: 14), 2 μL of template DNA (100 ng / μL of pCas9 plasmid), and 21 μL of ddH2O.

[0074] The PCR amplification reaction program was: 98°C, 3 min; 98°C, 15 s, 57°C, 15 s, 72°C, 3 min, 30 cycles; 72°C, 10 min.

[0075] After the PCR reaction was completed, the PCR product was recovered and purified using a PCR product purification recovery kit (Beijing Anolun Biotechnology Co., Ltd.). The recovery and purification steps were carried out according to the kit operation manual to obtain PCR product 2, that is, the recombinant plasmid 1 amplified by reverse PCR.

[0076] PCR product 1 and PCR product 2 were digested with BbvCI enzyme to obtain linearized PCR product 2 and digested PCR product 1. Linearized PCR product 2 and digested PCR product 1 were connected with T4 DNA ligase to obtain a connection product, i.e., a recombinant plasmid 1 connected with the promoter of the Riemerella anatipestifer RA-CH-1 genome, the replicon of the pRA0726 plasmid, and the inverse PCR amplification of the cefoxitin resistance gene.

[0077] Take 10 μL of the ligation product and transform it into the competent Escherichia coli Dh5α strain. Spread the transformed Dh5α strain on LB solid medium containing 50 μg / mL chloramphenicol. After the DH5α strain is completely absorbed by the LB solid medium, place the medium in an incubator at 37°C and invert it for overnight culture.

[0078] The next day, the transformed strains grown on the culture medium were verified by PCR and sent to a biological company (Qingke Biotechnology Co., Ltd.) for sequencing. The strains with correct sequencing were transferred and stored, and the plasmids were extracted using a plasmid mini-extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd.) to obtain recombinant plasmid 2.

[0079] (3) Construction of pCasRA plasmid

[0080] The rpsL gene promoter was amplified by PCR using the genome (NC_017045.1) of Riemerella anatipestifer strain 11845 as a template. The nucleotide sequence of the rpsL gene promoter is shown in SEQ ID NO: 6; the 5' primer sequence used to amplify the rpsL gene promoter is shown in SEQ ID NO: 15; and the 3' primer sequence used to amplify the rpsL gene promoter is shown in SEQ ID NO: 16.

[0081] 5' primer (SEQ ID NO: 15): 5'-aggtgactgaagtatattttcagacaactttatccatt-3';

[0082] 3' Primer (SEQ ID NO: 16): 5'-gtctcgtttccattatatatagtaggcatttaattgct-3'.

[0083] The reaction system for PCR amplification was: 25 μL of PrimerStar Max Premix, 1 μL of 5' primer (10 μM) (SEQ ID NO: 15), 1 μL of 3' primer (10 μM) (SEQ ID NO: 16), 2 μL of template DNA (100 ng / μL of the genome of Riemerella anatipestifer strain 11845 (NC_017045.1)), and 21 μL of ddH2O.

[0084] The PCR amplification reaction program was: 98°C, 1 min; 98°C, 15 s, 51°C, 15 s, 72°C, 15 s, 30 cycles; 72°C, 10 min.

[0085] After the PCR reaction was completed, the PCR product was purified using a PCR product purification kit (Beijing Anolun Biotechnology Co., Ltd.). The purification steps were carried out according to the kit operation manual to obtain the rpsL gene promoter.

[0086] The sgRNA sequence was obtained by PCR amplification using the pCasSA plasmid as a template. The nucleotide sequence of the sgRNA is shown in SEQ ID NO: 17, wherein the 5' primer sequence for amplifying the sgRNA sequence is shown in SEQ ID NO: 18, and the 3' primer sequence for amplifying the sgRNA sequence is shown in SEQ ID NO: 19.

[0087] 5' primer (SEQ ID NO: 18): 5'-agcaattaaatgcctactatatataatggaaacgagac-3';

[0088] 3' primer (SEQ ID NO: 19): 5'-aggGTCGACattctagaccatgggtat-3';

[0089] The capitalized part is the restriction site of saII enzyme.

[0090] The reaction system for PCR amplification was: 25 μL of PrimerStar Max Premix, 1 μL of 5' primer (10 μM) (SEQ ID NO: 18), 1 μL of 3' primer (10 μM) (SEQ ID NO: 19), 2 μL of template DNA (100 ng / μL of pCasSA plasmid), and 21 μL of ddH2O.

[0091] The PCR amplification reaction program was: 98°C, 1 min; 98°C, 15 s, 51°C, 15 s, 72°C, 15 s, 30 cycles; 72°C, 10 min.

[0092] After the PCR reaction, the PCR product was purified using a PCR product purification kit (Beijing Anolun Biotechnology Co., Ltd.). The purification steps were performed according to the kit operating manual to obtain the sgRNA sequence.

[0093] The Cas9 protein gene was obtained by PCR amplification using the pCas9 plasmid as a template. The nucleotide sequence of the Cas9 protein gene is shown in SEQ ID NO: 20, the 5' primer sequence used to amplify the Cas9 protein gene is shown in SEQ ID NO: 21, and the 3' primer sequence used to amplify the Cas9 protein gene is shown in SEQ ID NO: 22.

[0094] 5' Primer (SEQ ID NO: 21): 5'-ggc gagctc ccgctgcttttaaatat-3';

[0095] 3' primer (SEQ ID NO: 22): 5'-aatggataaagttgtctgaaaatatacttcagtcacct-3';

[0096] The underlined part is the restriction site of SacI enzyme.

[0097] The reaction system for PCR amplification was: 25 μL of PrimerStar Max Premix, 1 μL of 5' primer (10 μM) (SEQ ID NO: 21), 1 μL of 3' primer (10 μM) (SEQ ID NO: 22), 2 μL of template DNA (100 ng / μL of pCas9 plasmid), and 21 μL of ddH2O.

[0098] The PCR amplification reaction program was: 98°C, 1 min; 98°C, 15 s, 51°C, 15 s, 72°C, 15 s, 30 cycles; 72°C, 10 min.

[0099] After the PCR reaction, the PCR product was purified using a PCR product purification kit (Beijing Anolun Biotechnology Co., Ltd.). The purification steps were performed according to the kit operating manual to obtain the Cas9 protein gene.

[0100] The rpsL gene promoter and sgRNA sequence were connected. The connection reaction system was: 25 μL of PrimerStar MaxPremix, 0.5 μL of rpsL gene promoter, 0.5 μL of sgRNA sequence, and 22 μL of ddH2O.

[0101] After the ligation reaction system was prepared, PCR reaction was carried out. The PCR reaction program was: 98°C, 30s; 98°C, 15s, 51°C, 15s, 72°C, 15s, 15 cycles; 72°C, 5min.

[0102] After the PCR reaction was completed, 1 μL of 5' primer (10 μM) (SEQ ID NO: 15) for amplifying the rpsL gene promoter and 1 μL of 3' primer (10 μM) (SEQ ID NO: 19) for amplifying the sgRNA sequence were added thereto, and the same PCR reaction procedure was maintained, and amplification was continued for another 30 cycles.

[0103] Then, the PCR product was recovered and purified using a PCR product purification and recovery kit (Beijing Anolun Biotechnology Co., Ltd.). The recovery and purification steps were carried out according to the kit operating manual to obtain a connection product 1, i.e., the product of the connection between the rpsL gene promoter and the sgRNA sequence (integrated sgRNA (SEQ ID NO: 7)).

[0104] The ligation product 1 was connected to the Cas9 protein gene. The ligation reaction system was: 25 μL of PrimerStar MaxPremix, 0.5 μL of ligation product 1, 0.5 μL of Cas9 protein gene, and 22 μL of ddH2O.

[0105] After the ligation reaction system was prepared, PCR reaction was carried out. The PCR reaction program was: 98°C, 30s; 98°C, 15s, 51°C, 15s, 72°C, 15s, 15 cycles; 72°C, 5min.

[0106] After the PCR reaction was completed, 1 μL of 5' primer (10 μM) (SEQ ID NO: 15) for amplifying the rpsL gene promoter and 1 μL of 3' primer (10 μM) (SEQ ID NO: 22) for amplifying the Cas9 protein gene were added thereto, and the same PCR reaction procedure was maintained, and amplification was continued for another 30 cycles.

[0107] Then, the PCR product was purified using a PCR product purification kit (Beijing Anolun Biotechnology Co., Ltd.), and the purification steps were performed according to the kit operation manual to obtain a ligation product 2, i.e., a ligated fragment.

[0108] The recombinant plasmid 2 obtained in step (2) is digested with SaII enzyme and SacI enzyme simultaneously to obtain a linearized recombinant plasmid 2; the ligation product 2 is digested with SaII enzyme and SacI enzyme simultaneously to obtain a ligation product 2 after digestion.

[0109] The linearized recombinant plasmid 2 and the ligation product 2 after enzyme digestion were connected with T4 DNA ligase. The connection reaction system was: 1 μL of 10×T4 DNA ligase Buffer (NEB), 1 μL of T4 DNA ligase (NEB), 30-50 ng of linearized recombinant plasmid 2, the linearized recombinant plasmid 2 and the ligation product 2 after enzyme digestion were added in a molar ratio of 1:3, and ddH2O was added to make up the volume to 10 μL.

[0110] After the ligation reaction system was prepared, the reaction was carried out at 16°C overnight to obtain the ligation product 3. 10 μL of the ligation product 3 was transformed into the competent E. coli Dh5α strain, and the transformed Dh5α strain was spread on the LB solid medium containing 50 μg / mL chloramphenicol. After the DH5α strain was completely absorbed by the LB solid medium, the medium was placed in a 37°C incubator and inverted overnight for culture.

[0111] The next day, the transformed strains grown on the culture medium were verified by PCR and sent to a biological company (Qingke Biotechnology Co., Ltd.) for sequencing. The strains with correct sequencing were transferred and stored, and the plasmid was extracted using a plasmid mini-extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd.) to obtain the pCasRA plasmid.

[0112] 2. Experimental results

[0113] The schematic diagram of pCasRA plasmid is as follows Figure 1 As shown, the nucleotide sequence of the pCasRA plasmid is shown in SEQ ID NO: 1.

[0114] Example 2 pCasRA plasmid is used for gene knockout in Riemerella anatipestifer

[0115] The present invention takes the dprA gene (NC_017045.1) as an example, and performs gene knockout in the Riemerella anatipestifer 11845 strain (NC_017045.1) (but not limited to knockout of the dprA gene, all genes that meet the conditions of this embodiment can be knocked out).

[0116] 1. Experimental methods

[0117] (1) Construction of pCasRA-dprA-spacer plasmid

[0118] A DNA fragment of the first 20 bases of a NGG (N is an arbitrary base) sequence on the dprA gene was selected as a spacer fragment (SEQ ID NO: 23), and the reverse complementary sequence of the spacer fragment was synthesized. GAAA was added to the 5' end of the spacer fragment to obtain a modified spacer fragment (SEQ ID NO: 24); AAAC was added to the 5' end of the reverse complementary sequence to obtain a modified reverse complementary sequence (SEQ ID NO: 25).

[0119] spacer fragment (SEQ ID NO: 23): 5′-taacattcacctaaaagacg-3′;

[0120] Modified spacer fragment (SEQ ID NO: 24): 5'-GAAAtaacattcacctaaaagacg-3';

[0121] The modified reverse complementary sequence (SEQ ID NO: 25): 3'-attgtaagtggattttctgcCAAA-5'.

[0122] The modified spacer fragment and the modified reverse complementary sequence are annealed and connected.

[0123] The reaction system is: 1 μL of modified spacer fragment (100 μM) (SEQ ID NO: 24), 1 μL of modified reverse complementary sequence (100 μM) (SEQ ID NO: 25), 1 μL of T4 PNK Buffer, 0.5 μL of T4 PNK enzyme, and 6.5 μL of ddH2O.

[0124] Add at 95°C for 30 minutes, then cool naturally to room temperature to obtain an annealed connection product (i.e., spacer double-stranded DNA), and dilute the annealed connection product 200 times with ddH2O to obtain diluted spacer double-stranded DNA.

[0125] The pCasRA plasmid prepared in Example 1 was digested with BsaI enzyme to obtain a linearized pCasRA plasmid. The digestion reaction system was: 5 μL of 10×CutSmart Buffer (NEB), 1 μL of BsaI (NEB), 1 μg of pCasRA plasmid, and ddH2O was added to make the volume 50 μL. After preparing the digestion reaction system, react at 37°C for 3 to 5 hours. After the PCR reaction was completed, the PCR product was recovered and purified using a PCR product purification and recovery kit (Beijing Anolun Biotechnology Co., Ltd.), and the recovery and purification steps were performed according to the kit operation manual to obtain a linearized pCasRA plasmid.

[0126] The diluted spacer double-stranded DNA and the linearized pCasRA plasmid were ligated with T4 DNA ligase. The ligation reaction system was: 1 μL of 10×T4 DNA ligase Buffer (NEB), 1 μL of T4 DNA ligase (NEB), 30-50 ng of linearized pCasRA plasmid, the linearized pCasRA plasmid and the diluted spacer double-stranded DNA were added at a molar ratio of 1:3, and ddH2O was added to make up the volume to 10 μL.

[0127] After the ligation reaction system is prepared, it is mixed and reacted at 16°C overnight to connect the spacer double-stranded DNA between the BsaI restriction sites of the pCasRA plasmid to obtain the pCasRA plasmid connected with the spacer double-stranded DNA, and the ligase is inactivated at 65°C for 10 min.

[0128] The pCasRA plasmid connected with the spacer double-stranded DNA was transformed into the competent Escherichia coli Dh5α strain, and the transformed Dh5α strain was spread on the LB solid medium containing 50 μg / mL chloramphenicol. After the DH5α strain was completely absorbed by the LB solid medium, the culture medium was placed in an incubator at 37°C and cultured inverted overnight.

[0129] The next day, the transformed strains grown on the culture medium were verified by PCR and sent to a biological company (Qingke Biotechnology Co., Ltd.) for sequencing. The strains with correct sequencing were transferred and stored, and the plasmid was extracted using a plasmid mini-extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd.) to obtain the pCasRA-dprA-spacer plasmid.

[0130] (2) Amplification and ligation of upstream and downstream fragments of the dprA gene

[0131] Amplify 600 bp DNA fragments upstream and downstream of the dprA gene. The specific amplification primers are as follows:

[0132] 5' primer sequence for amplifying the DNA fragment upstream of the dprA gene (SEQ ID NO: 26):

[0133] 5'-aggGTCGACctcataatttccatatccga-3';

[0134] 3' primer sequence for amplifying the upstream DNA fragment of dprA gene (SEQ ID NO: 27):

[0135] 5'-atggcaaggcgctagttagttgaaaaattacttttttaaaa-3';

[0136] 5' primer sequence for amplifying the DNA fragment downstream of the dprA gene (SEQ ID NO: 28):

[0137] 5'-ttttaaaaaagtaatttttcaactaactagcgccttgccat-3';

[0138] 3' primer sequence for amplifying the DNA fragment downstream of the dprA gene (SEQ ID NO: 29):

[0139] 5'-aacGTCGACggctatggcggcaagtc-3';

[0140] The capitalized part is the restriction site of SaII enzyme.

[0141] The genomic DNA was extracted from Riemerella anatipestifer strain 11845 (NC_017045.1) using a bacterial genomic DNA extraction kit as the template DNA for PCR amplification.

[0142] A 600 bp DNA fragment upstream of the dprA gene was amplified, and the reaction system was: 25 μL of PrimerStar MaxPremix, 1 μL of a 5' primer sequence (10 μM) (SEQ ID NO: 26) for amplifying the DNA fragment upstream of the dprA gene, 1 μL of a 3' primer sequence (10 μM) (SEQ ID NO: 27) for amplifying the DNA fragment upstream of the dprA gene, 2 μL of template DNA (100 ng / μL of the genome of Riemerella anatipestifer strain 11845 (NC_017045.1)), and 21 μL of ddH2O.

[0143] The PCR reaction program was: 98°C, 1 min; 98°C, 15 s, 54°C, 15 s, 72°C, 30 s, 30 cycles; 72°C, 5 min. At the end of the reaction, the upstream fragment of the dprA gene was obtained.

[0144] A 600 bp DNA fragment downstream of the dprA gene was amplified, and the reaction system was: 25 μL of PrimerStar MaxPremix, 1 μL of 5' primer sequence (10 μM) (SEQ ID NO: 28) for amplifying the DNA fragment downstream of the dprA gene, 1 μL of 3' primer sequence (10 μM) (SEQ ID NO: 29) for amplifying the DNA fragment downstream of the dprA gene, 2 μL of template DNA (100 ng / μL of the genome of Riemerella anatipestifer strain 11845 (NC_017045.1)), and 21 μL of ddH2O.

[0145] The PCR reaction procedure was the same as that of the upstream fragment of the dprA gene to obtain the downstream fragment of the dprA gene.

[0146] The upstream fragment of the dprA gene and the downstream fragment of the dprA gene were connected. The connection reaction system was: 25 μL of PrimerStar Max Premix, 0.5 μL of the upstream fragment of dprA, 0.5 μL of the downstream fragment of dprA, and 22 μL of ddH2O.

[0147] After the ligation reaction system was prepared, PCR reaction was carried out. The PCR reaction program was: 98°C, 30s; 98°C, 15s, 54°C, 15s, 72°C, 30s, 15 cycles; 72°C, 5min.

[0148] After the PCR reaction was completed, 1 μL of the 5' primer sequence (10 μM) (SEQ ID NO: 26) for amplifying the upstream DNA fragment of the dprA gene and 1 μL of the 3' primer sequence (10 μM) (SEQ ID NO: 29) for amplifying the downstream DNA fragment of the dprA gene were added thereto, and the same PCR reaction procedure was maintained, and amplification was continued for another 30 cycles.

[0149] Then, the PCR product was purified using a PCR product purification kit (Beijing Anolun Biotechnology Co., Ltd.). The purification steps were carried out according to the kit operation manual to obtain the dprA upstream and downstream fragment connection product.

[0150] (3) Construction of pCasRA-dprA plasmid

[0151] The pCasRA-dprA-spacer plasmid obtained in step (1) is digested with SaII enzyme to obtain a linearized pCasRA-dprA-spacer plasmid; the dprA upstream and downstream fragment ligation product obtained in step (2) is digested with SaII enzyme to obtain a dprA upstream and downstream fragment ligation product after digestion.

[0152] The linearized pCasRA-dprA-spacer plasmid and the ligation product of the upstream and downstream fragments of dprA after restriction digestion were ligated with T4 DNA ligase. The ligation reaction system was: 1 μL of 10×T4 DNA ligase Buffer (NEB), 1 μL of T4 DNA ligase (NEB), 30-50 ng of linearized pCasRA-dprA-spacer plasmid, the linearized pCasRA-dprA-spacer plasmid and the ligation product of the upstream and downstream fragments of dprA after restriction digestion were added in a molar ratio of 1:3, and ddH2O was added to make up the volume to 10 μL.

[0153] After the ligation reaction system was prepared, the reaction was carried out at 16°C overnight to obtain the ligation product 4 (pCasRA-dprA-spacer plasmid connected with the ligation product of the upstream and downstream fragments of dprA). 10 μL of ligation product 4 was transformed into the competent E. coli Dh5α strain, and the transformed Dh5α strain was spread on the LB solid medium containing 50 μg / mL chloramphenicol. After the DH5α strain was completely absorbed by the LB solid medium, the medium was placed in a 37°C incubator and inverted overnight for culture.

[0154] The next day, the transformed strains grown on the culture medium were verified by PCR and sent to a biological company (Qingke Biotechnology Co., Ltd.) for sequencing. The strains with correct sequencing were transferred and stored, and the plasmid was extracted using a plasmid mini-extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd.) to obtain the pCasRA-dprA plasmid.

[0155] (4) Knockout of the dprA gene in Riemerella anatipestifer

[0156] The pCasRA-dprA plasmid obtained in step (3) was transformed into the competent Escherichia coli S17-1 strain and plated on LB solid medium containing 50 μg / mL chloramphenicol; at the same time, the Riemerella anatipestifer ATCC 11845 strain was streaked on a TSA solid plate.

[0157] Escherichia coli S17-1 and Riemerella anatipestifer ATCC 11845 containing the pCasRA-dprA plasmid were cultured in LB and TSB, respectively, until OD 600 It is about 0.6.

[0158] Take Escherichia coli S17-1 containing the pCasRA-dprA plasmid as an example: take 1 mL of Escherichia coli S17-1 bacterial solution containing the pCasRA-dprA plasmid into a 2 mL EP tube, centrifuge it in a high-speed desktop low-temperature centrifuge at 4°C, 5000 rpm for 5 min, remove the supernatant, and collect the bacteria; wash and resuspend the bacteria with 1 mL of 10 mmol / L MgSO4 solution after ice bath, centrifuge it at 4°C, 5000 rpm for 5 min, remove the supernatant, collect the bacteria, repeat this process 3 times to obtain Escherichia coli S17-1 bacteria.

[0159] The Riemerella anatipestifer ATCC 11845 strain was treated in the same manner to obtain ATCC 11845 bacteria.

[0160] Resuspend E. coli S17-1 and ATCC 11845 with 100 μL of MgSO4 solution (10 mmol / L) and mix to obtain a mixed bacterial solution. Attach a sterile filter membrane with a pore size of 0.22 μm to a TSA solid culture medium, drip the mixed bacterial solution onto the filter membrane, and place it in a 37°C incubator for 24 hours. After the incubation, use clean tweezers to place the filter membrane in a sterile culture dish and elute the bacteria with 5 mL of MgSO4 solution (10 mmol / L) to obtain an eluted bacterial solution. Take 100 μL of the eluted bacterial solution and spread it on a TSA agar plate containing 50 μg / mL of kanamycin and 1 μg / mL of cefoxitin. Place the TSA agar plate in a 37°C incubator for inverted culture, and collect 12 monoclonal colonies, which are the infected Riemerella anatipestifer ATCC 11845.

[0161] (5) Verification of gene knockout

[0162] Twelve monoclonal colonies were inoculated into 12 50 μL TSB (Tryptone Soy Broth) liquid culture media to obtain the corresponding ATCC bacterial liquid.

[0163] One of the ATCC bacterial solutions was selected, and PCR amplification was performed using the ATCC bacterial solution as a template to obtain a PCR amplification product. The reaction system was: 25 μL of PrimeStar Max Premix, 1 μL of 5' primer (10 μM) (SEQ ID NO: 30), 1 μL of 3' primer (10 μM) (SEQ ID NO: 31), 2 μL of template DNA (ATCC bacterial solution), and 21 μL of ddH2O.

[0164] 5' primer (SEQ ID NO: 30): 5'-gctaatcctttaccagtaagtac-3';

[0165] 3' Primer (SEQ ID NO:31): 5'-gagagaactctatcgcttataga-3'.

[0166] The 8 PCR amplification products (8 single colonies) obtained by amplification were subjected to gel electrophoresis on 1% agarose gel to observe the electrophoresis bands, and the PCR amplification products with correct bands were sent to a biological company (Qingke Biotechnology Company) for sequencing verification.

[0167] The remaining 11 ATCC bacterial cultures were subjected to the same treatment and verification.

[0168] 2. Experimental results

[0169] Gel electrophoresis results Figure 2 As shown, the results showed that among the 96 single colonies amplified from 12 ATCC bacterial solutions, 14 single colonies showed gene deletion, indicating that the gene knockout was successful.

[0170] The sequencing verification results are as follows Figure 3 As shown, the red box portion in the figure indicates that the gene is deleted. Because the actual deleted gene is too long, in order to display it in one figure, only the 5' end partial sequence and the 3' end partial sequence of the deleted gene are given. This shows that this embodiment can effectively achieve gene knockout.

[0171] Example 3 pCasRA plasmid is used for single base mutation in Riemerella anatipestifer

[0172] The present invention targets the cytosine C at position 271 in the dprA gene (NC_017045.1) and mutates it to adenine A. (Not limited to the mutation of the amino acid at position 271 of the dprA gene)

[0173] 1. Experimental methods

[0174] (1) Construction of pCasRA-dprAm plasmid

[0175] The pCasRA-dprA-spacer plasmid obtained in step (1) of Example 2 was digested with SalI enzyme to obtain a linearized pCasRA-dprA-spacer plasmid.

[0176] Amplify DNA fragments of 600 bp upstream and downstream of the single base mutation site of the dprA gene (position 271 in the dprA gene), and the specific amplification primers are as follows:

[0177] 5' primer sequence for amplifying the DNA fragment upstream of the single base mutation site of the dprA gene (SEQ ID NO: 32):

[0178] 5'-ggaGTCGACagctccaaaactttagaag-3';

[0179] 3' primer sequence for amplifying the DNA fragment upstream of the single base mutation site of the dprA gene (SEQ ID NO: 33):

[0180] 5'-tacgacatcttaatcagctt a ctcgtctttttaggtgaa-3';

[0181] 5' primer sequence for amplifying a DNA fragment downstream of the single base mutation site of the dprA gene (SEQ ID NO: 34):

[0182] 5'-ttcacctaaaagacgag t aagctgattaagatgtcgta-3';

[0183] 3' primer sequence for amplifying a DNA fragment downstream of the single base mutation site of the dprA gene (SEQ ID NO: 35):

[0184] 5'-aggGTCGACgacactattgtttagcaaa-3';

[0185] The capitalized part is the restriction site of SaII enzyme, and the underlined part is the gene with point mutation.

[0186] According to the method of step (2) of Example 2, the genomic DNA of Riemerella anatipestifer 11845 strain in step (2) of Example 2 was used as a template to amplify 600 bp DNA fragments upstream and downstream of the single base mutation site of the dprA gene, respectively, to obtain the upstream fragment of the single base mutation of the dprA gene and the downstream fragment of the single base mutation of the dprA gene.

[0187] The upstream fragment of the dprA gene single base mutation and the downstream fragment of the dprA gene single base mutation are connected to obtain the dprA gene single base mutation connection fragment.

[0188] The dprA gene single base mutation connection fragment is digested with SaII enzyme to obtain the dprA gene single base mutation connection fragment after digestion.

[0189] According to the method described in step (3) of Example 2, the linearized pCasRA-dprA-spacer plasmid and the dprA gene single-base mutation linker fragment after restriction digestion were connected to obtain the pCasRA-dprAm plasmid.

[0190] (2) Single base mutation and verification in Riemerella anatipestifer

[0191] According to the method described in step (4) of Example 2, the pCasRA-dprAm plasmid was transferred into the Riemerella anatipestifer ATCC11845 strain, and 12 monoclonal colonies were obtained by culture, namely the modified Riemerella anatipestifer.

[0192] Twelve monoclonal colonies were inoculated into 12 50 μL TSB (Tryptone Soy Broth) liquid culture media to obtain corresponding bacterial liquids.

[0193] One of the bacterial solutions was selected and PCR amplification was performed using the bacterial solution as a template to obtain PCR amplification product 1. The reaction system was: 25 μL of PrimeStar Max Premix, 1 μL of 5' primer (10 μM) (SEQ ID NO: 36), 1 μL of 3' primer (10 μM) (SEQ ID NO: 37), 2 μL of template DNA, and 21 μL of ddH2O.

[0194] 5' primer (SEQ ID NO: 36): 5'-ctaaatgatagaatatctcctccca-3';

[0195] 3' Primer (SEQ ID NO:37): 5'-cgacatcttaatcagcttactc-3'.

[0196] The PCR amplification product 1 was subjected to gel electrophoresis on 1% agarose gel to observe the electrophoresis bands, and the PCR amplification products with correct bands were sent to a biological company (Qingke Biotechnology Company) for sequencing verification.

[0197] The primers used for sequencing verification are:

[0198] 5' primer (SEQ ID NO: 38): 5'-ctaaatgatagaatatctcctccca-3';

[0199] 3' Primer (SEQ ID NO:39): 5'-atggtaaatgcggaagaaatt-3'.

[0200] The remaining 11 bacterial cultures were subjected to the same treatment and verification.

[0201] 2. Experimental results

[0202] The results of sequencing verification are as follows Figure 4 As shown, the red box represents a successful single base mutation. The results show that among the 12 monoclonal colonies, 4 monoclonal colonies have successful single base mutations, indicating that the method described in this example can effectively achieve single base mutations.

[0203] Comparative Example 1 Construction and Verification of pCasRA1 Plasmid without Replacement of sgRNA

[0204] 1. Experimental methods

[0205] The difference between Comparative Example 1 and Example 1 is that the pCasRA1 plasmid prepared in Comparative Example 1 does not amplify the sgRNA sequence using the pCasSA plasmid as a template and connect it to the rpsL gene promoter according to step (3) of Example 1, and the remaining steps are the same.

[0206] The nucleotide sequence of the prepared pCasRA1 plasmid is shown in SEQ ID NO: 40.

[0207] The prepared pCasRA1 plasmid was digested with BsaI and connected to the target, wherein the nucleotide sequence information of the target F is shown in SEQ ID NO: 41, and the nucleotide sequence information of the target R is shown in SEQ ID NO: 42.

[0208] Target F (SEQ ID NO: 41): 5'- AAAC GTGGTTGTAGAAGCAATCAG G -3';

[0209] Target R (SEQ ID NO: 42): 5'- AAAAC CTGATTGCTTCTACAACCAC-3'.

[0210] The underlined part is the complementary base added due to the BsaI enzyme cleavage characteristics, and the rest is the target sequence.

[0211] The pCasRA1 plasmid connected with the target site was transferred into the Riemerella anatipestifer 11845 (NC_017045.1) strain according to the method described in Example 2, and the bacterial solution was plated to observe the growth of the colony, which was recorded as experimental group 1.

[0212] Two sets of experiments were repeated and the colony growth was recorded, which were recorded as Experimental Group 2 and Experimental Group 3.

[0213] The control group was set to be the Riemerella anatipestifer 11845 (NC_017045.1) strain without the pCasRA1 plasmid connected with the target site, and a total of 3 control groups were set, namely control group 1, control group 2 and control group 3.

[0214] The pCasRA plasmid prepared in Example 1 was digested with BsaI and connected to the target, wherein the nucleotide sequence information of the target F is shown in SEQ ID NO: 43, and the nucleotide sequence information of the target R is shown in SEQ ID NO: 44.

[0215] Target F (SEQ ID NO: 43): 5'- GAAA GTGGTTGTAGAAGCAATCAG-3′;

[0216] Target R (SEQ ID NO: 44): 5'- AAAC CTGATTGCTTCTACAACCAC-3'.

[0217] The underlined part is the complementary base added due to the BsaI enzyme cleavage characteristics, and the rest is the target sequence.

[0218] The pCasRA plasmid connected with the target site was transferred into the Riemerella anatipestifer 11845 (NC_017045.1) strain according to the method described in Example 2, and the bacterial solution was observed by drop plate, which was recorded as experimental group 4.

[0219] Two groups of experiments were repeated and the colony growth was recorded, which were named Experimental Group 5 and Experimental Group 6.

[0220] The control group was set to be the Riemerella anatipestifer 11845 (NC_017045.1) strain without the pCasRA plasmid connected with the target site, and a total of 3 control groups were set, namely control group 4, control group 5 and control group 6.

[0221] 2. Experimental results

[0222] The colony growth conditions of experimental groups 1 to 3 and control groups 1 to 3 are shown in Table 1.

[0223] Table 1 Colony growth

[0224]

[0225] The results showed that the pCasRA1 plasmid without replacing the sgRNA had no effect on the Riemerella anatipestifer 11845 strain.

[0226] The colony growth conditions of experimental groups 4 to 6 and control groups 4 to 6 are shown in Table 1.

[0227] Table 1 Colony growth

[0228]

[0229] The results showed that the pCasRA plasmid prepared in Example 1 had a bactericidal effect on the Riemerella anatipestifer 11845 strain.

[0230] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. For ordinary technicians in this field, other different forms of changes or modifications can be made based on the above descriptions and ideas. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. An application of a pCasRA plasmid in rapid gene editing of Riemerella anatipestifer, the nucleotide sequence of the pCasRA plasmid is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The gene editing is gene knockout and / or single base mutation.

3. The use according to claim 2, characterized in that: The gene knockout is to knock out the dprA gene with the gene number NC_017045.

1.

4. The use according to claim 2, characterized in that: The single base mutation is that cytosine C at position 271 in the dprA gene is mutated into adenine A.

Images