Use of otud5 in preparation of drugs for preventing and treating myocardial ischemia-reperfusion injury

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to application of OTUD5 in preparation of drugs for preventing and treating myocardial ischemia-reperfusion injury. The application provides a theoretical basis of OTUD5 in preparation of heart-protecting drugs, and particularly reflects application of OTUD5 in screening or preparation of drugs for preventing, relieving and / or treating myocardial ischemia-reperfusion injury. By determining the regulation of OTUD5 in myocardial ischemia-reperfusion injury (MIRI), OTUD5 is used as a target to resist myocardial iron death. The application provides an OTUD5 inducer or a pharmaceutical preparation thereof, including drugs capable of promoting expression or activity of OTUD5, for preventing or treating MIRI, and has very important clinical transformation value.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of OTUD5 in the preparation of drugs for the prevention and treatment of myocardial ischemia-reperfusion injury. Background Technology

[0002] Myocardial infarction (MI) is a severe and dangerous condition that seriously threatens human health. Its primary cause is atherosclerotic plaque formation in the coronary arteries, leading to coronary artery stenosis, significant myocardial blood supply insufficiency, or plaque rupture. Timely reperfusion is the most effective treatment for MI, but it can also lead to myocardial infarction-related intraperitoneal injury (MIRI). Nearly 50% of MIRI cases involve reperfusion injury. However, effective interventions for MIRI are currently lacking in clinical practice. Therefore, identifying key regulatory molecules in the MIRI mechanism as potential targets for prevention and treatment is of significant clinical importance.

[0003] OTUD5 is a member of the OTU family of deubiquitinating enzymes. It releases ubiquitin molecules from polypeptide substrates, influencing ubiquitin degradation of the substrate and enhancing protein stability. Previous studies have shown that OTUD5 plays a crucial role in many cellular processes, participating in the regulation of vital activities such as signal transduction, transcriptional regulation, cell cycle, proliferation and apoptosis, and inflammation and immunity.

[0004] MIRI leads to cardiomyocyte death, and if intervention is not timely, it can impair cardiac function and progress to heart failure. Ferroprelation, a form of cell death caused by the accumulation of iron-dependent lipid peroxides, has been found to play an important role in MIRI in recent years. Combating cardiomyocyte ferroptosis can effectively reduce the infarct size in MIRI and alleviate cardiac dysfunction.

[0005] Previous studies have shown that deubiquitinating enzymes can affect cell fate by regulating the stability of substrate proteins in cell death pathways. However, whether OTUD5 participates in MIRI by regulating ferroptosis to prevent reperfusion myocardial injury has not been reported. Summary of the Invention

[0006] To address the lack of effective treatments for the prevention or treatment of MIRI in clinical practice, the main objective of this invention is to provide a theoretical basis for the development of cardioprotective drugs using OTUD5. By determining the regulatory role of OTUD5 in MIRI, and targeting OTUD5 to combat myocardial ferroptosis, this invention aims to develop drugs that promote OTUD5 expression or activity for the prevention or treatment of MIRI.

[0007] To achieve the above objectives, the present invention can adopt the following technical solutions:

[0008] This invention provides the use of OTUD5 in screening or preparing drugs that protect the heart, wherein the cardioprotective agent is an OTUD5 single-component reagent or a reagent that increases the expression level of OTUD5 as the active ingredient.

[0009] The screening method described in this invention refers to using OTUD5 as a drug target and detecting the expression level of OTUD5 in subjects before and after drug administration. Overexpression of OTUD5 after drug administration indicates a candidate drug. This method is also within the scope of protection of this invention.

[0010] As a preferred embodiment, the application includes the use of OTUD5 in screening or preparing drugs for the prevention, mitigation and / or treatment of myocardial ischemia-reperfusion injury.

[0011] Furthermore, the applications include using OTUD5 as a drug target or substances that promote OTUD5 expression in the preparation of drugs for the prevention, relief, and / or treatment of myocardial ischemia-reperfusion injury.

[0012] This invention also provides the use of OTUD5 inducers in the preparation of drugs that protect cardiac function.

[0013] Furthermore, the OTUD5 inducer includes substances that promote OTUD5 gene expression, agonists that promote OTUD5 protein activity or protein levels, agonists that promote OTUD5 mRNA levels, or miRNAs, lncRNAs, circRNAs, etc. that regulate OTUD5 expression, and their promoting effect is reversible or irreversible; the substances that promote OTUD5 gene expression increase the expression level of OTUD5 by more than 1 time.

[0014] Furthermore, the agonists that promote OTUD5 protein activity or protein levels include proteins, peptides, enzymes, natural compounds, synthetic compounds, organic and inorganic substances.

[0015] Preferably, the OTUD5 inducer of the present invention comprises an adeno-associated virus vector with the OTUD5 gene fragment inserted, namely, a recombinant adeno-associated virus AAV9-OTUD5 carrying the cTnT promoter.

[0016] The present invention also provides a pharmaceutical formulation characterized in that it comprises an OTUD5 inducer or a single-component OTUD5, combined with a pharmaceutically acceptable diluent or carrier, said pharmaceutical formulation being used to prevent, alleviate and / or treat myocardial ischemia-reperfusion injury.

[0017] The "pharmaceutically acceptable diluent or carrier" used in this invention includes one or more of any and all physiologically suitable solvents, dispersion media, coatings, antimicrobial and antifungal agents, isotonic agents, or absorption delay agents. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate-buffered saline, glucose, glycerol, or ethanol, and combinations thereof. In many cases, it is preferable to include an isotonic agent in the composition, such as one or more of sugars, mannitol, sorbitol, polyols of sorbitol, or sodium chloride. Pharmaceutically acceptable carriers may also contain small amounts of excipients, such as wetting agents or emulsifiers, preservatives or buffers, nanomaterials, etc., which enhance the invention for the preparation of pharmaceutical formulations against myocardial ischemia-reperfusion injury.

[0018] The pharmaceutical formulation of the present invention can be administered to humans or other non-human animals.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] This invention utilizes AAV9-OTUD5 to specifically overexpress OTUD5 in mouse hearts, discovering that OTUD5 overexpression can significantly reduce acute myocardial injury (MIRI) and improve chronic cardiac dysfunction and cardiac remodeling. This invention elucidates that OTUD5 can improve acute and chronic myocardial injury during reperfusion by counteracting cardiomyocyte ferroptosis. This invention is the first to reveal that OTUD5 can improve MIRI, providing a new target for the prevention and treatment of reperfusion injury, and has significant clinical translational value. Attached Figure Description

[0021] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0022] Figure 1 The results show the overexpression of OTUD5 in mouse hearts detected by Western blotting (A) and the statistical results (B).

[0023] Figure 2 OTUD5 overexpression reduces myocardial injury induced by acute myocardial ischemia-reperfusion. A: Evens blue / TTC staining map and statistical results of danger zone and infarct area; B: CK-MB level; C: LDH level.

[0024] Figure 3 OTUD5 overexpression reduces myocardial ferroptosis induced by acute myocardial ischemia-reperfusion. A: Iron ion content; B: MDA level; C: GSH level.

[0025] Figure 4The results of echocardiography showed that OTUD5 overexpression improved cardiac dysfunction in mice induced by chronic myocardial ischemia-reperfusion. A: Echocardiography; B: Ejection fraction (EF%) statistics; C: Short axis shortening (FS%) statistics.

[0026] Figure 5 Masson staining and WGA staining experiments suggest that OTUD5 overexpression improves cardiac fibrosis in mice induced by chronic myocardial ischemia-reperfusion and reduces cardiomyocyte hypertrophy. A: Masson staining and statistical results; B: WGA staining and statistical results.

[0027] In the figures above, Sham: sham surgery group; I / R: ischemia-reperfusion surgery group; AAV9-Control: injection of negative control adeno-associated virus; AAV9-OTUD5: injection of OTUD5 overexpressing adeno-associated virus. Detailed Implementation

[0028] The present invention will now be described through specific embodiments. Unless otherwise specified, all technical means used in this invention are methods well known to those skilled in the art. Furthermore, the embodiments should be understood as illustrative, not limiting, of the scope of the invention; the essence and scope of the invention are defined only by the claims. For those skilled in the art, various changes or modifications to the material composition and dosage in these embodiments without departing from the essence and scope of the invention also fall within the protection scope of this invention.

[0029] Example 1

[0030] 1 Experimental Methods

[0031] 1.1 Modeling of ischemia-reperfusion injury in mice

[0032] Mice were anesthetized with sevoflurane and placed on an operating table. The chest was disinfected, and the skin was cut in the 3rd and 4th intercostal spaces on the left side of the sternum. The chest cavity was opened to expose the heart, and a slipknot was tied 1 mm below the auricle to ligate the left anterior descending coronary artery. After 30 minutes of ischemia, the slipknot was released to restore coronary blood flow, and the wound was sutured.

[0033] Modeling of acute myocardial ischemia-reperfusion injury: AAV9-OTUD5 overexpressing virus was injected via tail vein 3 weeks before surgery, followed by 30 minutes of ischemia and 24 hours of reperfusion. Modeling of chronic myocardial ischemia-reperfusion injury: AAV9-OTUD5 overexpressing virus was injected via tail vein 1 week before surgery, followed by 30 minutes of ischemia and 3 weeks of reperfusion.

[0034] 1.2 Construction of adeno-associated virus AAV9-OTUD5

[0035] Adeno-associated virus (AAV9)-OTUD5 construction: PCR amplification primers were designed based on the OTUD5 gene sequence. The primer sequences are shown below:

[0036] OTUD5-F:GCGATCGCGCCACCATGACTATTCTCCCCAAAAAG

[0037] OTUD5-R:ACCGTTCAACTCTTGTCTGGGGGTG

[0038] This invention does not have strict requirements regarding the source of the AAV9-OTUD5. Using conventional plasmid construction methods, the fragment expressing the OTUD5 gene was inserted into an adeno-associated virus vector to obtain recombinant adeno-associated virus AAV9-OTUD5 with a cTnT promoter. The resulting viral titer was 6.67 × 10⁻⁶. 13 (Vg) / mL.

[0039] 1.3 Evans Blue + TTC staining

[0040] After anesthetizing the mice, they were fixed. In both I / R modeling groups, the heart was squeezed out again along the intercostal opening of the myocardial infarction model. The left anterior descending branch of the heart was ligated again at the previous ligation site. Evans blue dye was injected along the aorta, and the mouse heart tissue was observed to turn blue. The mouse heart was removed and washed with PBS. The sutures in the tissue were removed, and the heart was frozen at -20°C for 30 minutes. After freezing, the heart was placed in a mold, cut into thin slices of equal thickness, and incubated in 2% TTC dye at 37°C for 30 minutes. After freezing, the heart slices were placed in 4% tissue fixative overnight and photographed the next day.

[0041] 1.4 Echocardiography

[0042] After successfully establishing the chronic myocardial ischemia-reperfusion injury model, the four groups of mice were anesthetized in a 5% sevoflurane anesthesia box, fixed in a supine position on the operating table, and maintained anesthesia with 1% sevoflurane. An electrocardiogram was connected, and the heart rate was maintained at 400-500 beats / min. Transthoracic echocardiography was performed on the mice using a Vevo 3100 Doppler ultrasound system to obtain M-mode and B-mode images along the parasternal long and short axes to assess cardiac function and structure, and to calculate left ventricular ejection fraction (LVEF) (EF%) and left ventricular fractional shortening (FS%).

[0043] Male mice aged 6-8 weeks were randomly divided into the following 4 groups: (1) sham surgery + AAV9-Control; (2) sham surgery + AAV9-OTUD 5; (3) I / R + AAV9-Control; (4) I / R + AAV9-OTUD 5. After establishing an acute myocardial ischemia-reperfusion model (30 min ischemia followed by 24 h reperfusion), infarct area, myocardial injury markers CK-MB and LDH, and ferroptosis markers were measured. After establishing a chronic myocardial ischemia-reperfusion model (30 min ischemia followed by 21 d reperfusion), cardiac function was measured by echocardiography, cardiac fibrosis was measured by Masson staining, and cardiac remodeling was measured by WGA.

[0044] 2 Experimental Results

[0045] Mice with heart-specific overexpression of OTUD5 were constructed by injecting AAV9-OTUD5 and AAV9-Control. Immunoblotting experiments showed that OTUD5 could be overexpressed by more than 1-fold. Figure 1 ).

[0046] Evens blue / TTC staining results showed that the infarct area in mice induced by acute myocardial ischemia-reperfusion was 65%, while OTUD5 overexpression reduced the infarct area to 45%. Figure 2 A).

[0047] Serum myocardial injury markers showed that acute myocardial ischemia-reperfusion led to a 5-6 fold increase in serum LDH and CK-MB levels in mice, while OTUD5 overexpression reduced these levels to approximately a 3-fold increase. Figure 2 B).

[0048] Biochemical results showed that OTUD5 overexpression reduced myocardial ferroptosis by 40-50% during acute myocardial ischemia-reperfusion, manifested by inhibiting ischemia-reperfusion-induced iron increase, increasing MDA, and decreasing GSH. Figure 3 ).

[0049] Echocardiographic results in mice showed that, in cases of cardiac dysfunction caused by chronic myocardial ischemia-reperfusion, OTUD5 overexpression increased ejection fraction (EF%) from 40% to 55% and fractional shortening (FS%) from 20% to 30%. Figure 4 ).

[0050] Masson staining and WGA staining experiments indicated that chronic myocardial ischemia-reperfusion leads to myocardial fibrosis and myocardial hypertrophy in mice, and OTUD5 overexpression can improve these conditions by approximately 40-50%. Figure 5 ).

Claims

1. The use of recombinant adeno-associated virus AAV9-OTUD5 with a cTnT promoter in the preparation of drugs for the prevention, mitigation, and / or treatment of myocardial ischemia-reperfusion injury, characterized in that, The primer sequences for AAV9-OTUD5 are as follows: OTUD5-F: GCGATCGCCACCATGACTATTCTCCCCAAAAAG; OTUD5-R: ACGCGTTCAACTCTTGTCTGGGGGTG.

2. A pharmaceutical preparation for preventing, alleviating, and / or treating myocardial ischemia-reperfusion injury, characterized in that, The recombinant adeno-associated virus AAV9-OTUD5, which carries a cTnT promoter, is characterized by the following primer sequences: OTUD5-F: GCGATCGCCACCATGACTATTCTCCCCAAAAAG; OTUD5-R: ACGCGTTCAACTCTTGTCTGGGGGTG.

3. The pharmaceutical preparation according to claim 2, characterized in that, It also includes pharmaceutically acceptable diluents or carriers.

Images