A drug inhibitor targeting beta-arrestin2 and preparation method and application thereof

Abstract

The present application relates to a kind of targeting β-arrestin2 drug inhibitor and its preparation method and application, belong to biological medicine technical field.The targeting β-arrestin2 drug inhibitor of the present application includes DNA nano drug-loading complex nucleic acid aptamer Chol-Td, which carries the drug inhibiting β-arrestin2 on it.The drug inhibitor of the present application is the DNA nano drug of targeted inhibition β-arrestin2, by specific targeting inhibition β-arrestin2 in hepatocyte in vivo, improve liver fibrosis, non-alcoholic fatty liver disease and autoimmune hepatitis disease in liver damage, provide new ideas and methods for clinical treatment of non-viral liver disease.The drug inhibitor of the present application is nano system, preparation is simple, raw material is easy to get, the method is ingenious, condition is mild, simple operation, yield is higher, can be effectively applied in industrial production.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to a drug inhibitor targeting beta-arrestin2 and a preparation method and application thereof. BACKGROUND

[0002] China is a big country of liver diseases. With the change of people's lifestyle and dietary structure, the number of liver disease patients in China also increases. The incidence of non-viral liver diseases (such as non-alcoholic fatty liver disease, autoimmune hepatitis, liver fibrosis, etc.) increases year by year, which seriously threatens people's life and health and safety. Therefore, there is an urgent need in the field to research and find new therapeutic targets to develop new and safe drugs for treating liver fibrosis and other liver diseases.

[0003] Beta-arrestin2 is an adapter protein and signal transduction protein expressed in mammalian tissues and organs, and plays an important role in many inflammatory diseases. Previous studies by the research group have shown that beta-arrestin2 has been proven to be abnormally elevated in hepatocytes of diseases such as liver fibrosis, autoimmune hepatitis and non-alcoholic fatty liver disease. Inhibiting beta-arrestin2 to restore it to normal levels can reduce hepatocyte apoptosis and relieve liver damage in diseases such as liver fibrosis, autoimmune hepatitis and non-alcoholic fatty liver disease. It can be seen that targeting and inhibiting beta-arrestin2 may have a protective effect on liver damage. However, so far, there has been no related report on drugs targeting beta-arrestin2. SUMMARY

[0004] Therefore, the purpose of the present application is to provide a drug inhibitor targeting beta-arrestin2 and a preparation method and application thereof. The drug inhibitor of the present application is a DNA nanodrug targeting and inhibiting beta-arrestin2, which targets and inhibits beta-arrestin2 in hepatocytes in vivo, thereby improving liver damage in diseases such as liver fibrosis, non-alcoholic fatty liver disease and autoimmune hepatitis, and providing a new idea and method for the clinical treatment of non-viral liver diseases.

[0005] In order to achieve the above-mentioned purpose, the technical scheme of the present application is as follows:

[0006] The present application provides a drug inhibitor targeting beta-arrestin2, which comprises a DNA nanodrug complex nucleic acid aptamer Chol-Td.

[0007] The DNA nanodrug complex nucleic acid aptamer Chol-Td is a positive DNA tetrahedron formed by complementary pairing of four oligonucleotide chains S1, S2, S3 and S4 which are complementary to each other.

[0008] The sequence of the oligonucleotide chain S1 is:

[0009] 5'- ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGA ACATTCCTAAGTCTGAA-3';

[0010] The sequence of oligonucleotide chain S2 is:

[0011] 5'- ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTC AGACTTAGGAATGTTCG-3';

[0012] The sequence of oligonucleotide chain S3 is:

[0013] 5'- ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGG GAAGAGCATGCCCATCC-3';

[0014] The sequence of oligonucleotide chain S4 is:

[0015] 5'- ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGA TGGGCATGCTCTTCCCG-3';

[0016] The 5' end of the S1 strand of the DNA tetrahedron is covalently connected with a fluorescent labeling group;

[0017] The 5' end of the S3-linker single strand of the DNA tetrahedron is connected with a drug that inhibits the function of β-arrestin2;

[0018] The 3' end of the S4 strand of the DNA tetrahedron is connected with Chol;

[0019] The sequence of Linker is:

[0020] 5'- GGTGTATGAA-3';

[0021] The sequence of S3-linker is:

[0022] 5'- GGTGTATGAAACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC-3'.

[0023] In the technical scheme, preferably, the drug for inhibiting the function of beta-arrestin 2 is siRNA, miRNA, piRNA, artificially synthesized small molecule compound or natural medicine with the function of targeting and inhibiting the function of beta-arrestin 2.

[0024] In the technical scheme, further preferably, the drug for inhibiting the function of beta-arrestin 2 is beta-arrestin 2 siRNA.

[0025] In the technical scheme, preferably, the fluorescent labeling group is any one of FITC, Alexa 488, Cy3, Cy5 and Cy7.

[0026] In the technical scheme, further preferably, the fluorescent labeling group is Cy5.

[0027] In the technical scheme, further preferably, the fluorescent labeling group is Cy5, the drug for inhibiting the function of beta-arrestin 2 is beta-arrestin 2 siRNA, and the obtained targeting beta-arrestin 2 drug inhibitor is labeled as si-beta-arrestin 2@Chol-Td.

[0028] The application further provides a preparation method of the targeting beta-arrestin 2 drug inhibitor.

[0029] Step 1, complementary pairing of four complementary oligonucleotide chains S1, S2, S3 and S4 is carried out by PCR program annealing, to form a positive DNA tetrahedron;

[0030] Step 2, covalently connecting a fluorescent labeling group to the 5' end of the S1 chain of the DNA tetrahedron obtained in step 1 through self-assembly;

[0031] Step 3, connecting the siRNA, miRNA, piRNA, artificially synthesized small molecule compound or natural medicine with the function of targeting and inhibiting the function of beta-arrestin 2 to the 5' end of the S3-linker single strand of the DNA tetrahedron obtained in step 2;

[0032] Step 4, connecting Chol to the 3' end of the S4 chain of the DNA tetrahedron obtained in step 3, to finally obtain the targeting beta-arrestin 2 drug inhibitor.

[0033] The application further provides an application of the targeting beta-arrestin 2 drug inhibitor in the preparation of a medicine for treating non-viral liver diseases.

[0034] Further, the non-viral liver disease is autoimmune hepatitis, non-alcoholic fatty liver disease or liver fibrosis.

[0035] The present application has the following advantages:

[0036] The targeted beta-arrestin2 drug inhibitor of the present application is a nanoparticle, is easily taken up by cells, and has good biocompatibility, and is easy to realize clinical transformation.

[0037] The targeted beta-arrestin2 drug inhibitor of the present application has a metabolite of nucleotide, which is completely harmless to the human body.

[0038] The targeted beta-arrestin2 drug inhibitor of the present application can achieve the effect of inhibiting beta-arrestin2 in liver cells to treat liver diseases, and breaks the limitation of the lack of specific beta-arrestin2 inhibitors in clinical practice.

[0039] The preparation method of the targeted beta-arrestin2 drug inhibitor of the present application is a nanoparticle, which is simple to prepare, easy to obtain raw materials, and has the advantages of ingenious design, mild conditions, simple operation, high yield, and can be effectively applied to industrial production.

[0040] The targeted beta-arrestin2 drug inhibitor of the present application is a DNA nanodrug for targeting and inhibiting beta-arrestin2, which can improve liver fibrosis, non-alcoholic fatty liver disease and autoimmune hepatitis by inhibiting the expression of beta-arrestin2 in liver cells in vivo, and provides a new idea and method for the clinical treatment of non-viral liver diseases. BRIEF DESCRIPTION OF DRAWINGS

[0041] The present application will be further described in detail below in combination with the drawings and specific embodiments.

[0042] Figure 1 is a preparation schematic diagram of si-beta-arrestin2@Chol-Td nanodrug;

[0043] Figure 2 In A, it is a single-stranded gel electrophoresis diagram, and the lanes are: 1 is ladder, 2 is S1-Cy5, 3 is S2, 4 is S3-linker, 5 is S4-Chol, 6 is S1+S2, 7 is S1+S2+S3, 8 is S1+S2+S3+S4(Chol-Td), 9 is ladder; Figure 2 In B, it is a gel electrophoresis diagram of the complex, and the lanes are: 1 is ladder, 2 is Chol-Td, 3 and 4 are both siRNA-carrying complexes si-beta-arrestin2@Chol-Td;

[0044] Figure 3 Fig. 2A is a confocal microscope image of si-β-arrestin2@Chol-Td targeting liver cells AML-12, Figure 3 Fig. 2B is a Western blot detection image of si-β-arrestin2@Chol-Td reducing the expression of β-arrestin2 in AML-12 cells;

[0045] Figure 4 Fig. 3A is a HE staining result image of liver tissue of autoimmune hepatitis mice treated with different doses of si-β-arrestin2@Chol-Td; Figure 4 Fig. 3B is a HE staining result image of liver tissue of non-alcoholic fatty liver disease mice treated with different doses of si-β-arrestin2@Chol-Td; Figure 4 Fig. 3C is a HE staining result image of liver tissue of liver fibrosis mice treated with different doses of si-β-arrestin2@Chol-Td. DETAILED DESCRIPTION

[0046] The inventive idea of the present application is that DNA tetrahedron (Td) is a new nano material emerging in recent years, which has good biological compatibility, editability, low toxicity and side effects, and mechanical rigidity, so that it has wide application prospects in the fields of biological detection, gene delivery, in vivo imaging and drug transportation. Cholesterol (Chol) is the main steroid compound in mammals, which plays an important role in basic cell life activities. Liver cells express a large number of scavenger receptor class B type 1 and low-density lipoprotein receptors on the surface, which can specifically recognize a large amount of cholesterol. Current studies have shown that certain siRNA and antisense oligonucleotides can be coupled with cholesterol to effectively target liver cells for the treatment of liver diseases. Based on this, the present application uses Chol-coupled DNA tetrahedron to carry drugs such as siRNA that inhibit β-arrestin2, to improve the uptake of β-arrestin2 siRNA in liver cells, so that the drugs specifically act on liver cells to exert their effects and achieve targeted therapy. The present application first provides a method for coupling DNA nano-drug complex aptamer Chol-Td on the surface of liver cells. Then, the present application further provides a method for loading drugs that inhibit the function of β-arrestin2, such as β-arrestin2 siRNA, into the above system to form a complex si-β-arrestin2@Chol-Td. Further provided is the application of si-β-arrestin2@Chol-Td in the treatment of liver diseases.

[0047] The application provides a targeting beta-arrestin2 drug inhibitor, which comprises a DNA nano-drug carrier complex nucleic acid aptamer Chol-Td, which is a positive DNA tetrahedron formed by complementary pairing of four oligonucleotide chains S1, S2, S3 and S4 which are complementary to each other; the 5' end of the S1 chain of the DNA tetrahedron is covalently connected with a fluorescent labeling group; the 5' end of the S3-linker single strand of the DNA tetrahedron is connected with a drug for inhibiting the function of beta-arrestin2; and the 3' end of the S4 chain of the DNA tetrahedron is connected with Chol.

[0048] The sequence of the oligonucleotide chain S1 is:

[0049] 5'-ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGA ACATTCCTAAGTCTGAA-3';

[0050] The sequence of the oligonucleotide chain S2 is:

[0051] 5'-ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTC AGACTTAGGAATGTTCG-3';

[0052] The sequence of the oligonucleotide chain S3 is:

[0053] 5'-ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGG GAAGAGCATGCCCATCC-3';

[0054] The sequence of the oligonucleotide chain S4 is:

[0055] 5'-ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGA TGGGCATGCTCTTCCCG-3';

[0056] The sequence of the linker is:

[0057] 5'-GGTGTATGAA-3';

[0058] The sequence of the S3-linker is:

[0059] 5'-GGTGTATGAAACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC-3'.

[0060] In the present application, the drug for inhibiting the function of β-arrestin2 is siRNA, miRNA, piRNA, artificially synthesized small molecule compound or natural medicine with targeted inhibition of the function of β-arrestin2. Preferably, the drug for inhibiting the function of β-arrestin2 is β-arrestin2 siRNA.

[0061] In the present application, the fluorescent labeling group is any one of FITC, Alexa 488, Cy3, Cy5 and Cy7. Preferably, the fluorescent labeling group is Cy5.

[0062] In the present application, more preferably, the fluorescent labeling group is Cy5, the drug for inhibiting the function of β-arrestin2 is β-arrestin2 siRNA, and the obtained targeted β-arrestin2 drug inhibitor is labeled as si-β-arrestin2@Chol-Td.

[0063] The present application also provides a preparation method of a targeted β-arrestin2 drug inhibitor, comprising the following steps:

[0064] Step 1, DNA tetrahedron carrier copolymer

[0065] Firstly, four complementary oligonucleotide chains S1, S2, S3 and S4, each with a length of 63 bp, are annealed after PCR program warming, wherein S1, S2, S3 and S4 each have a pairing region, and form a positive DNA tetrahedron (as shown in Figure 1 A).

[0066] Step 2, covalently connecting a fluorescent labeling group on the DNA tetrahedron, and the fluorescent labeling is any one of FITC, Alexa 488, Cy3, Cy5 and Cy7. In specific implementation, labeled nucleotide chains are directly used for annealing, and the fluorescently labeled copolymer is obtained by self-assembly. Preferably, the fluorescent labeling group of the present application is Cy5, and the connection position is the 5' end of the S1 single strand in the DNA tetrahedron.

[0067] Step 3, connecting siRNA, miRNA, piRNA, artificially synthesized small molecule compound or natural medicine with targeted inhibition of the function of β-arrestin2 on the DNA tetrahedron. Preferably, it is β-arrestin2 siRNA, and the connection position is the 5' end of the S3-linker single strand in the DNA tetrahedron.

[0068] Step 4, connecting Chol at the 3' end of the S4 chain of the DNA tetrahedron, and combining together to form si-β-arrestin2@Chol-Td (as shown inFigure 1 B as shown).

[0069] The present application also provides a use of a β-arrestin2 drug inhibitor in the preparation of a medicament for treating non-viral liver diseases, wherein the non-viral liver diseases are autoimmune hepatitis, non-alcoholic fatty liver disease or liver fibrosis.

[0070] For the purpose of promoting the understanding of the present application, a more comprehensive description of the present application will be given below with reference to the relevant drawings. The preferred embodiments of the present application are shown in the drawings. However, the present application can be realized in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.

[0071] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terminology used in the specification of the present application herein is only for the purpose of describing specific embodiments and is not intended to limit the present application. The term "and / or" used herein includes any and all combinations of one or more of the associated listed items.

[0072] The raw materials used in the following examples, unless otherwise specified, are commercially available; the methods used in the following examples, unless otherwise specified, are conventional methods that can be achieved.

[0073] In the following examples, the statistical data, unless otherwise specified, are mean (MEAN) ± standard deviation (SD), and the statistical graph is analyzed and processed using SPSS 26.0 software. The comparison of differences between multiple groups uses one-way ANOVA (One-way ANOVA), and when the condition of P<0.05 is met, it is considered that there is a statistical difference.

[0074] Example 1: Preparation method of si-β-arrestin2@Chol-Td nanodrug

[0075] 1.1 Synthesis

[0076] The four single strands of the DNA tetrahedron are named S1, S2, S3 and S4, respectively. The 5' end of the S1 strand is connected with Cy5, labeled as S1-Cy5; the 5' end of the S3 strand is connected with a linker that can carry β-arrestin2 siRNA, labeled as S3-linker; the S2 strand is not treated; the 3' end of the S4 strand is connected with Chol, labeled as S4-Chol. The sequences of the single strands S1, S2, S3, S4, S1-Cy5, S3-linker and S4-chol are shown in Table 1:

[0077] Table 1 DNA tetrahedron single strand sequences

[0078]

[0079]

[0080] Four special DNA single strands were added into 2 μL of TM buffer (containing 10 mM Tris-HCl, 50 mM MgCl2, pH=8) at the same concentration of 0.5 μM, and ddH2O was added to make the reaction system of 10 μL. The solution was vortexed and mixed, centrifuged and placed in a thermal cycler. The reaction was carried out at 95 °C for 10 min, and then rapidly cooled to 4 °C for 20 min, and the Chol-Td synthesis was completed. The Chol-Td solution was stored in a 4 °C refrigerator.

[0081] The β-arrestin2 siRNA (sense strand: 5'-GGACCAGGGUCUUCAAGAATT-3', antisense strand: 5'-UUCUUGAAGACCCUGGUCCTT-3') was covalently connected to the DNA single strand S3-linker. The sequence that can bind to the linker was designed on the antisense strand of the siRNA to ensure stable connection, and was marked as linker-siRNA-SS; the sense strand was marked as siRNA-AS. The sequence of linker-si-β-arrestin2 is shown in Table 2.

[0082] Table 2 Sequence of linker-si-β-arrestin2 double strand

[0083] Single-stranded RNA Orientation Sequence linker-siRNA-SS 5’→3’ TTCATACACCGGACCAGGGUCUUCAAGAATT siRNA-AS 5’→3’ UUCUUGAAGACCCUGGUCCTT

[0084] The 0.5 μM linker-si-β-arrestin2 was mixed with the same concentration of Chol-Td, the solution was vortexed and mixed, centrifuged and placed in a thermal cycler. Slow annealing was carried out from 35 °C to 20 °C, 10 min per degree Celsius, to stably connect the linker-si-β-arrestin2 and Chol-Td.

[0085] 1.2 Identification

[0086] The DNA tetrahedron prepared by the above method was verified by polyacrylamide gel electrophoresis (PAGE) method.

[0087] (1) Preparation of gel: The gel was prepared from 7 mL of distilled water, 2 mL of 40% Arc-Bis solution, 1 mL of 10x TAE / Mg buffer, 100 μL of AP and 10 μL of TEMED. 2+

[0088] ​(2) Loading and electrophoresis: After diluting the unmodified tetrahedron and the modified tetrahedron mixture by 10 times, 5 μL of the mixture was mixed with 2 μL of 6x loading buffer, and then added to the prepared gel. Ladder was added to both sides for comparison. The gel was subjected to electrophoresis at 80 V for 80 min in ice bath.

[0089] (3) GelRed staining and exposure: The polyacrylamide gel was placed in a mixture of GelRed and distilled water at a ratio of 1:50. The mixture was placed in a shaker for 15-25 min in the dark. The gel was exposed.

[0090] The results are shown in Figure 2 A and Figure 2 B. The electrophoretic speed of S1+S2+S3+S4 (Chol-Td) was significantly slower than that of each single strand. There was a very bright band of large molecular weight, indicating that the Chol-Td tetrahedron was successfully assembled. The electrophoretic speed of si-β-arrestin2@Chol-Td was slower than that of Chol-Td tetrahedron, indicating that si-β-arrestin2@Chol-Td was successfully synthesized.

[0091] Example 2: Verification of si-β-arrestin2@Chol-Td targeting liver cells to inhibit β-arrestin2

[0092] The cell lines used in the following examples and the detection methods of the research indicators are as follows:

[0093] (1) Cell culture:

[0094] The AML-12 cells were cultured in DMEM medium supplemented with 10% fetal bovine serum, 100 U / mL penicillin and 100 μg / mL streptomycin in a 37°C, 5% CO2 incubator.

[0095] (2) Cell treatment:

[0096] The AML-12 cells were cultured in serum-free conditions, and then the tetrahedron Chol-Td without siRNA and the tetrahedron si-β-arrestin2@Chol-Td with siRNA were added, respectively, and cultured for 24 h. At the same time, unmodified β-arrestin2 siRNA was transfected using the transfection reagent Lip2000 for comparison to test the transfection efficiency of the tetrahedron.

[0097] (3) Cell immunofluorescence

[0098] The treated AML-12 cells were inoculated on a slide, 4% paraformaldehyde cell fixing solution was added to each well for fixation for 20 min, PBS was used for washing for 3 times, 1% BSA was used for incubation for blocking at room temperature for 30 min, and PBS was used for washing; anti-β-arrestin2 primary antibody solution (1:200) diluted was added to each well, and incubation was performed at 4°C overnight, and PBS was used for washing; Alexa Fluor 488 labeled IgG fluorescent secondary antibody solution diluted at a certain ratio was added to each well, and incubation was performed for 1 h in the dark, and PBS was used for washing; finally, 4', 6-diamidino-2-phenylindole (DAPI) solution was added to each well, and nuclear staining was performed at room temperature for 10 min, and PBS was used for washing; the slide was clamped with tweezers, and an anti-fluorescence quenching agent was added dropwise, and the slide was sealed. Images were obtained under a laser confocal microscope.

[0099] Results are shown in Figure 3 A shows that the fluorescence intensity (green light) of β-arrestin2 in the si-β-arrestin2@Chol-Td group is obviously reduced compared with the Chol-Td control group, and is specifically combined with AML-12 cells, showing strong targeting (red light); the fluorescence intensity of β-arrestin2 in the si-β-arrestin2@Chol-Td group is equivalent to that in the reagent Lip2000 transfection group.

[0100] (4) Western blot detection of protein expression

[0101] The treated AML-12 cells were collected, and pre-cooled RIPA (containing protease inhibitors) was used for homogenization, and centrifugation was performed at 4°C and 12000 rpm for 20 min, and the supernatant was taken for protein quantification. After sample addition, 12% SDS-PAGE electrophoresis was performed, and transfer was performed to a PVDF membrane at 100 V for 1 hour, and blocking was performed for 1 hour; anti-β-arrestin2 and anti-β-actin primary antibody solutions were used for incubation at 4°C overnight, respectively, and anti-rabbit IgG (H+L) and anti-mouse IgG (H+L) secondary antibody solutions were used for incubation at room temperature for 2 hours, respectively, ECL development was performed, and ImageJ was used for analyzing the gray value of the Western blot band.

[0102] Results are shown in Figure 3 B shows that the expression level of β-arrestin2 in the si-β-arrestin2@Chol-Td group is obviously reduced, and the reduction ability is equivalent to that in the Lip2000 transfection group. These results suggest that si-β-arrestin2@Chol-Td can specifically target liver cells, and reduce the level of β-arrestin2 in liver cells.

[0103] Therapeutic effect of si-beta-arrestin2@Chol-Td on autoimmune hepatitis, non-alcoholic fatty liver disease and liver fibrosis

[0104] The experimental animals, model establishment and detection methods of each research index used in the following examples are as follows:

[0105] (1) Experimental animals

[0106] Wild type (WT) C57BL / 6J mice, 6-8 weeks old, weighing about 20 g, purchased from Jiangsu Jicui Yekang Biotechnology Co., Ltd., production license: (Su) 2018-0008. Experimental animals were bred and bred in specific pathogen free (SPF) level animal room.

[0107] (2) Establishment of animal models

[0108] ①Establishment of autoimmune hepatitis model

[0109] After the mice were anesthetized, the abdominal cavity was opened with scissors, and pre-cooled phosphate buffer was perfused into the portal vein. After observing that the color of the liver changed from dark red to gray white, the liver was taken out and placed on ice to cut it into pieces, and then homogenized in a homogenizer. After centrifugation to remove nuclei, the supernatant was ultracentrifuged at 100,000 x g for 1 h, and the final supernatant was obtained, which was called S-100. Then S-100 was mixed with complete Freund's adjuvant (CFA) at a volume ratio of 1:1 to emulsify and prepare an immunization preparation. The model group mice were injected intraperitoneally with 0.5 mL of freshly prepared immunization preparation on days 1 and 7, and the modeling was completed after 21 days. The normal group mice were injected intraperitoneally with the same amount of normal saline every week.

[0110] ②Establishment of non-alcoholic fatty liver disease model

[0111] The model group mice were fed with western diet feed, and on this basis, they were injected intraperitoneally with 50 μL of 0.02% CCl4 oil solution, once a week, and the modeling was completed after 16 weeks. The normal group mice were injected intraperitoneally with the same amount of oil solution every week.

[0112] ③Establishment of liver fibrosis model

[0113] The model group mice were injected intraperitoneally with 5 mL / kg of 10% CCl4 oil solution, twice a week, for 8 weeks, to establish a mouse liver fibrosis model. The normal group mice were injected intraperitoneally with the same amount of oil solution every week.

[0114] (3) Detection methods

[0115] ① Specimen collection

[0116] After the end of modeling, the mice were sacrificed to collect blood, centrifuged to collect serum for next operation. After the mice were sacrificed, the liver tissue was taken out and fixed with 10% formaldehyde solution.

[0117] ② Liver tissue pathological HE staining

[0118] The fixed liver tissue was placed in a dehydration box and dehydrated by gradient ethanol (70%, 80%, 90%, 100%) and xylene solution. Then the liver was placed in an embedding frame immersed in liquid wax for impregnation and cooling. After the liquid wax solidified, the wax block was taken out and trimmed. Paraffin sections were prepared by a paraffin section machine. The paraffin sections were sequentially immersed in xylene and anhydrous ethanol solution. Hematoxylin staining solution was added dropwise for staining, and then washed with water, returned to blue solution, and then washed with water again. Sequentially immersed in different gradient (70%, 80%, 90%, 100%) ethanol for dehydration, and immersed in eosin solution for staining. Sequentially immersed in 95% ethanol, 100% ethanol, and xylene for dehydration and transparency, and then mounted. Observed under a microscope and collected images.

[0119] ③ Detection of serum biochemical indicators

[0120] The levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum of mice, and the levels of triglyceride (TG) and total cholesterol (T-CHO) related to lipid metabolism were detected by a fully automatic biochemical analyzer. The selected method was rate method, and the absorbance values of two points in the time-absorbance curve were selected to be equal, and the linear unit absorbance ratio was used to calculate the results.

[0121] ④ Detection of the level of anti-nuclear antibody (ANA) in serum

[0122] According to the instructions of the kit, the level of autoantibody ANA in serum was detected.

[0123] ⑤ Determination of the content of hydroxyproline (Hyp) in liver tissue

[0124] The liver was taken out, 0.5 g of liver tissue was weighed and washed with cold physiological saline to remove floating blood, and 10% liver homogenate was prepared with cold physiological saline. The content of Hyp was detected according to the instructions of the kit.

[0125] The number of mice in the normal group, the model group, and the si-β-arrestin2@Chol-Td treatment groups with different doses of the present application was 6.

[0126] (4) Results

[0127] ① The HE staining results are shown in 4A. The liver cells of the AIH model mice are swollen and ruptured, and inflammatory cell infiltration of different degrees is observed in the hepatic portal area, and part of the severe infiltration forms interfacial hepatitis. The inflammatory cell infiltration and liver cell swelling of the model mice are reduced to different degrees after the administration of si-β-arrestin2@Chol-Td. At the same time, Table 3 shows that, compared with the normal group of mice, the ANA, ALT and AST levels of the model group of mice are significantly increased; compared with the model group of mice, the ANA and transaminase levels of the administration group are reduced to different degrees.

[0128] Table 3 Influence of si-β-arrestin2@Chol-Td on serum ANA and transaminase of autoimmune hepatitis mice

[0129]

[0130] **P < 0.01 vs normal group; # P < 0.05, ## P < 0.01 vs model group

[0131] ② The HE staining results are shown in 4A. The liver cells of the AIH model mice are swollen and ruptured, and inflammatory cell infiltration of different degrees is observed in the hepatic portal area, and part of the severe infiltration forms interfacial hepatitis. The inflammatory cell infiltration and liver cell swelling of the model mice are reduced to different degrees after the administration of si-β-arrestin2@Chol-Td. At the same time, Table 3 shows that, compared with the normal group of mice, the ANA, ALT and AST levels of the model group of mice are significantly increased; compared with the model group of mice, the ANA and transaminase levels of the administration group are reduced to different degrees. Figure 4 B shows that the liver cells of the normal group of mice are closely and regularly arranged, and are arranged radially along the liver cord; the fatty degeneration vacuoles can be obviously observed in the liver of the model group, and the cytoplasm is changed to be thin; the inflammatory cell infiltration and fatty vacuoles of the liver of the model mice are reduced to different degrees by si-β-arrestin2@Chol-Td. The serum biochemical test results are shown in Table 4. The serum ALT, AST, TG and T-CHO levels of the model group of mice are significantly increased, and the serum transaminase and lipid levels are significantly reduced after administration.

[0132] Table 4 Influence of si-β-arrestin2@Chol-Td on serum transaminase and blood lipid of non-alcoholic fatty liver disease mice

[0133]

[0134] ** P < 0.01 vs normal group; # P < 0.05, ## P < 0.01 vs model group

[0135] ③The liver fibrosis model mice were treated by tail vein injection of 100 μL of si-β-arrestin2@Chol-Td (0.5, 1, 2 μM) at different doses, and the HE staining results are as follows Figure 4 C shows that the liver lobule structure of the normal group of mice is complete and clear, the liver cells are arranged in order, and there is no cell necrosis; the liver lobule structure of the fibrosis model group is severely damaged, the liver cells are arranged in disorder, the perisinusoidal space is clearly visible, the collagen fibers extend, the fibrosis of the portal area and its surrounding is obvious, and false lobules are formed; compared with the model group, the drug administration group has no false lobule formation, and the collagen fibers are shortened. The serum biochemical test results are shown in Table 5, and the model group of mice has a significant increase in serum ALT and AST, and the level of collagen protein synthesis amino acid Hyp in the liver tissue is significantly increased, and after drug administration, the serum transaminase level and the Hyp content in the liver tissue can be significantly reduced.

[0136] Table 5 Effect of si-β-arrestin2@Chol-Td on serum transaminase and Hyp in liver tissue of liver fibrosis mice

[0137]

[0138] ** P < 0.01 vs normal group; # P < 0.05, ## P < 0.01 vs model group

[0139] In summary, the present application provides a preparation idea and method of a bispecific DNA nanodrug specifically targeting liver cells and specifically inhibiting the expression of β-arrestin2, and application in non-viral liver diseases. There are many methods and ways to realize this technical solution, and the above description is only the preferred embodiment of the present application. It should be pointed out that for ordinary skilled persons in the technical field, some improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should be regarded as the protection scope of the present application. The components not explicitly described in the embodiment can be realized by existing technology.

Claims

1. Use of a drug inhibitor targeting β-arrestin2 in the preparation of a drug for treating non-viral liver diseases, the non-viral liver disease is autoimmune hepatitis or non-alcoholic fatty liver disease; the drug inhibitor targeting β-arrestin2 comprises a DNA nano-drug carrier complex aptamer Chol-Td; the DNA nano-drug carrier complex aptamer Chol-Td is a positive DNA tetrahedron formed by complementary pairing of four oligonucleotide chains S1, S2, S3 and S4 which are complementary to each other; the sequence of the oligonucleotide chain S1 is: 5'-ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA-3'; the sequence of the oligonucleotide chain S2 is: 5'-ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG-3'; the sequence of the oligonucleotide chain S3 is: 5'-ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC-3'; the sequence of the oligonucleotide chain S4 is: 5'-ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG-3'; the 5' end of the S1 strand of the DNA tetrahedron is covalently linked to a fluorescent labeling group; the 5' end of the S3-linker single strand of the DNA tetrahedron is linked to a drug that inhibits the function of β-arrestin2; the 3' end of the S4 strand of the DNA tetrahedron is linked to Chol; the sequence of Linker is: 5'-GGTGTATGAA-3'; the sequence of S3-linker is: 5'-GGTGTATGAAACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC-3'; the fluorescent labeling group is Cy5, the drug that inhibits the function of β-arrestin2 is β-arrestin2 siRNA, and the resulting drug inhibitor targeting β-arrestin2 is labeled as si-β-arrestin2@Chol-Td; the sense strand of the β-arrestin2 siRNA is: 5'-GGACCAGGGUCUUCAAGAATT-3', and the antisense strand is: 5'-UUCUUGAAGACCCUGGUCCTT-3'; the sequence designed to bind with the linker on the sense strand of the β-arrestin2 siRNA is labeled as linker-siRNA-SS; The sequence of the linker-siRNA-SS is: 5'-TTCATACACCGGACCAGGGUCUUCAAGAATT-3'.

2. Use according to claim 1, characterized in that, The fluorescent labeling group is replaced by any one of FITC, Alexa 488, Cy3 and Cy7. The sequence of the linker-siRNA-SS is: 5'-TTCATACACCGGACCAGGGUCUUCAAGAATT-3'. The fluorescent labeling group is replaced by any one of FITC, Alexa 488, Cy3 and Cy7.

Images